Dataset statistics
| Number of variables | 54 |
|---|---|
| Number of observations | 2784 |
| Missing cells | 7695 |
| Missing cells (%) | 5.1% |
| Duplicate rows | 0 |
| Duplicate rows (%) | 0.0% |
| Total size in memory | 122.8 MiB |
| Average record size in memory | 45.2 KiB |
Variable types
| Categorical | 44 |
|---|---|
| Unsupported | 2 |
| Numeric | 8 |
Publication Date has constant value "2014-12-30" | Constant |
Publication Country Code has constant value "US" | Constant |
Publication Month has constant value "12" | Constant |
Publication Year has constant value "2014" | Constant |
Application Country/Region has constant value "US" | Constant |
Publication Number has a high cardinality: 2784 distinct values | High cardinality |
Title has a high cardinality: 2756 distinct values | High cardinality |
Priority Number has a high cardinality: 2784 distinct values | High cardinality |
Priority Date has a high cardinality: 2045 distinct values | High cardinality |
Application Number has a high cardinality: 2784 distinct values | High cardinality |
Application Date has a high cardinality: 1205 distinct values | High cardinality |
Inventor - w/address has a high cardinality: 2768 distinct values | High cardinality |
Assignee/Applicant has a high cardinality: 2704 distinct values | High cardinality |
Assignee - Current US has a high cardinality: 1731 distinct values | High cardinality |
DWPI Class has a high cardinality: 1484 distinct values | High cardinality |
DWPI Manual Codes has a high cardinality: 2482 distinct values | High cardinality |
IPC - Current has a high cardinality: 2729 distinct values | High cardinality |
CPC - Current has a high cardinality: 2783 distinct values | High cardinality |
US Class has a high cardinality: 2697 distinct values | High cardinality |
Abstract has a high cardinality: 2784 distinct values | High cardinality |
Title (Original language) has a high cardinality: 2756 distinct values | High cardinality |
Claims has a high cardinality: 2784 distinct values | High cardinality |
First Claim has a high cardinality: 2784 distinct values | High cardinality |
Independent Claims has a high cardinality: 2784 distinct values | High cardinality |
Description has a high cardinality: 2784 distinct values | High cardinality |
Assignee/Applicant (Original Language) has a high cardinality: 2704 distinct values | High cardinality |
Assignee - Original has a high cardinality: 2672 distinct values | High cardinality |
Optimized Assignee has a high cardinality: 1484 distinct values | High cardinality |
Ultimate Parent has a high cardinality: 1317 distinct values | High cardinality |
Inventor has a high cardinality: 2766 distinct values | High cardinality |
Attorney/Agent has a high cardinality: 1146 distinct values | High cardinality |
Examiner has a high cardinality: 2150 distinct values | High cardinality |
Priority Date - Earliest has a high cardinality: 1467 distinct values | High cardinality |
IPC Class has a high cardinality: 940 distinct values | High cardinality |
CPC Class has a high cardinality: 1115 distinct values | High cardinality |
US Class - Original has a high cardinality: 2698 distinct values | High cardinality |
Cited Refs - Patent has a high cardinality: 2778 distinct values | High cardinality |
Cited Refs - Non-patent has a high cardinality: 1869 distinct values | High cardinality |
Citing Patents has a high cardinality: 2039 distinct values | High cardinality |
INPADOC Legal Status has a high cardinality: 2680 distinct values | High cardinality |
INPADOC Family Members has a high cardinality: 2784 distinct values | High cardinality |
INPADOC Family ID has a high cardinality: 2770 distinct values | High cardinality |
Application Year is highly overall correlated with Earliest Priority Year | High correlation |
Earliest Priority Year is highly overall correlated with Application Year and 1 other fields | High correlation |
Publication Kind Code is highly overall correlated with Earliest Priority Year | High correlation |
Publication Kind Code is highly imbalanced (58.9%) | Imbalance |
DWPI Manual Codes has 242 (8.7%) missing values | Missing |
ECLA has 2784 (100.0%) missing values | Missing |
Attorney/Agent has 226 (8.1%) missing values | Missing |
Correspondent has 2784 (100.0%) missing values | Missing |
Cited Refs - Non-patent has 911 (32.7%) missing values | Missing |
Citing Patents has 741 (26.6%) missing values | Missing |
Publication Number is uniformly distributed | Uniform |
Title is uniformly distributed | Uniform |
Priority Number is uniformly distributed | Uniform |
Priority Date is uniformly distributed | Uniform |
Application Number is uniformly distributed | Uniform |
Inventor - w/address is uniformly distributed | Uniform |
Assignee/Applicant is uniformly distributed | Uniform |
DWPI Manual Codes is uniformly distributed | Uniform |
IPC - Current is uniformly distributed | Uniform |
CPC - Current is uniformly distributed | Uniform |
US Class is uniformly distributed | Uniform |
Abstract is uniformly distributed | Uniform |
Title (Original language) is uniformly distributed | Uniform |
Claims is uniformly distributed | Uniform |
First Claim is uniformly distributed | Uniform |
Independent Claims is uniformly distributed | Uniform |
Description is uniformly distributed | Uniform |
Assignee/Applicant (Original Language) is uniformly distributed | Uniform |
Assignee - Original is uniformly distributed | Uniform |
Inventor is uniformly distributed | Uniform |
Examiner is uniformly distributed | Uniform |
Priority Date - Earliest is uniformly distributed | Uniform |
US Class - Original is uniformly distributed | Uniform |
Cited Refs - Patent is uniformly distributed | Uniform |
Cited Refs - Non-patent is uniformly distributed | Uniform |
Citing Patents is uniformly distributed | Uniform |
INPADOC Legal Status is uniformly distributed | Uniform |
INPADOC Family Members is uniformly distributed | Uniform |
INPADOC Family ID is uniformly distributed | Uniform |
Publication Number has unique values | Unique |
Priority Number has unique values | Unique |
Application Number has unique values | Unique |
Abstract has unique values | Unique |
Claims has unique values | Unique |
First Claim has unique values | Unique |
Independent Claims has unique values | Unique |
Description has unique values | Unique |
INPADOC Family Members has unique values | Unique |
ECLA is an unsupported type, check if it needs cleaning or further analysis | Unsupported |
Correspondent is an unsupported type, check if it needs cleaning or further analysis | Unsupported |
Count of Cited Refs - Non-patent has 911 (32.7%) zeros | Zeros |
Count of Citing Patents has 741 (26.6%) zeros | Zeros |
Reproduction
| Analysis started | 2023-04-13 18:16:13.344218 |
|---|---|
| Analysis finished | 2023-04-13 18:17:01.242862 |
| Duration | 47.9 seconds |
| Software version | pandas-profiling v3.6.6 |
| Download configuration | config.json |
Publication Number
Categorical
HIGH CARDINALITY  UNIFORM  UNIQUE 
| Distinct | 2784 |
|---|---|
| Distinct (%) | 100.0% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 185.0 KiB |
| US8919357B2 | 1 |
|---|---|
| US8921157B2 | 1 |
| US8919110B2 | 1 |
| US8920467B2 | 1 |
| US8922204B2 | 1 |
| Other values (2779) |
Length
| Max length | 11 |
|---|---|
| Median length | 11 |
| Mean length | 11 |
| Min length | 11 |
Characters and Unicode
| Total characters | 30624 |
|---|---|
| Distinct characters | 13 |
| Distinct categories | 2 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 2784 ? |
|---|---|
| Unique (%) | 100.0% |
Sample
| 1st row | US8919357B2 |
|---|---|
| 2nd row | US8920125B2 |
| 3rd row | US8920781B2 |
| 4th row | US8921104B2 |
| 5th row | US8923511B2 |
Common Values
| Value | Count | Frequency (%) |
| US8919357B2 | 1 | < 0.1% |
| US8921157B2 | 1 | < 0.1% |
| US8919110B2 | 1 | < 0.1% |
| US8920467B2 | 1 | < 0.1% |
| US8922204B2 | 1 | < 0.1% |
| US8923129B1 | 1 | < 0.1% |
| US8920967B2 | 1 | < 0.1% |
| US8923012B2 | 1 | < 0.1% |
| US8923185B2 | 1 | < 0.1% |
| US8922793B2 | 1 | < 0.1% |
| Other values (2774) | 2774 |
Length
| Value | Count | Frequency (%) |
| us8919357b2 | 1 | < 0.1% |
| us8921332b2 | 1 | < 0.1% |
| us8924719b2 | 1 | < 0.1% |
| us8920781b2 | 1 | < 0.1% |
| us8921104b2 | 1 | < 0.1% |
| us8923511b2 | 1 | < 0.1% |
| us8922696b2 | 1 | < 0.1% |
| us8921169b2 | 1 | < 0.1% |
| us8924860b2 | 1 | < 0.1% |
| us8920372b2 | 1 | < 0.1% |
| Other values (2774) | 2774 |
Most occurring characters
| Value | Count | Frequency (%) |
| 2 | 6055 | |
| 9 | 4096 | |
| 8 | 3632 | |
| U | 2784 | |
| S | 2784 | |
| B | 2784 | |
| 1 | 1999 | 6.5% |
| 0 | 1517 | 5.0% |
| 3 | 1290 | 4.2% |
| 4 | 1165 | 3.8% |
| Other values (3) | 2518 |
Most occurring categories
| Value | Count | Frequency (%) |
| Decimal Number | 22272 | |
| Uppercase Letter | 8352 | 27.3% |
Most frequent character per category
Decimal Number
| Value | Count | Frequency (%) |
| 2 | 6055 | |
| 9 | 4096 | |
| 8 | 3632 | |
| 1 | 1999 | 9.0% |
| 0 | 1517 | 6.8% |
| 3 | 1290 | 5.8% |
| 4 | 1165 | 5.2% |
| 5 | 854 | 3.8% |
| 6 | 851 | 3.8% |
| 7 | 813 | 3.7% |
Uppercase Letter
| Value | Count | Frequency (%) |
| U | 2784 | |
| S | 2784 | |
| B | 2784 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Common | 22272 | |
| Latin | 8352 | 27.3% |
Most frequent character per script
Common
| Value | Count | Frequency (%) |
| 2 | 6055 | |
| 9 | 4096 | |
| 8 | 3632 | |
| 1 | 1999 | 9.0% |
| 0 | 1517 | 6.8% |
| 3 | 1290 | 5.8% |
| 4 | 1165 | 5.2% |
| 5 | 854 | 3.8% |
| 6 | 851 | 3.8% |
| 7 | 813 | 3.7% |
Latin
| Value | Count | Frequency (%) |
| U | 2784 | |
| S | 2784 | |
| B | 2784 |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 30624 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 2 | 6055 | |
| 9 | 4096 | |
| 8 | 3632 | |
| U | 2784 | |
| S | 2784 | |
| B | 2784 | |
| 1 | 1999 | 6.5% |
| 0 | 1517 | 5.0% |
| 3 | 1290 | 4.2% |
| 4 | 1165 | 3.8% |
| Other values (3) | 2518 |
Title
Categorical
HIGH CARDINALITY  UNIFORM 
| Distinct | 2756 |
|---|---|
| Distinct (%) | 99.0% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 319.3 KiB |
| Semiconductor device | 7 |
|---|---|
| Light emitting device | 4 |
| Display device | 3 |
| User interface system | 3 |
| Liquid crystal display device | 3 |
| Other values (2751) |
Length
| Max length | 244 |
|---|---|
| Median length | 145 |
| Mean length | 60.376796 |
| Min length | 4 |
Characters and Unicode
| Total characters | 168089 |
|---|---|
| Distinct characters | 73 |
| Distinct categories | 10 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 2 ? |
Unique
| Unique | 2738 ? |
|---|---|
| Unique (%) | 98.3% |
Sample
| 1st row | Steam appliance |
|---|---|
| 2nd row | Dual frequency hub mounted vibration suppressor system |
| 3rd row | Carrier particles for use in dry powder inhalers |
| 4th row | Method for producing dendritic cells |
| 5th row | Enciphering apparatus and method, deciphering apparatus and method as well as information processing apparatus and method |
Common Values
| Value | Count | Frequency (%) |
| Semiconductor device | 7 | 0.3% |
| Light emitting device | 4 | 0.1% |
| Display device | 3 | 0.1% |
| User interface system | 3 | 0.1% |
| Liquid crystal display device | 3 | 0.1% |
| Inhaler | 2 | 0.1% |
| Semiconductor device and semiconductor device manufacturing method | 2 | 0.1% |
| Conversion of HF alkylation units for ionic liquid catalyzed alkylation processes | 2 | 0.1% |
| Semiconductor device and manufacturing method thereof | 2 | 0.1% |
| Semiconductor package | 2 | 0.1% |
| Other values (2746) | 2754 |
Length
| Value | Count | Frequency (%) |
| and | 1474 | 6.4% |
| for | 1136 | 5.0% |
| method | 849 | 3.7% |
| of | 630 | 2.8% |
| a | 577 | 2.5% |
| device | 489 | 2.1% |
| system | 480 | 2.1% |
| apparatus | 386 | 1.7% |
| with | 292 | 1.3% |
| the | 277 | 1.2% |
| Other values (4590) | 16301 |
Most occurring characters
| Value | Count | Frequency (%) |
| 20107 | ||
| e | 15295 | 9.1% |
| i | 12109 | 7.2% |
| a | 12001 | 7.1% |
| t | 11869 | 7.1% |
| o | 11436 | 6.8% |
| n | 11281 | 6.7% |
| r | 10072 | 6.0% |
| s | 8363 | 5.0% |
| c | 6790 | 4.0% |
| Other values (63) | 48766 |
Most occurring categories
| Value | Count | Frequency (%) |
| Lowercase Letter | 143190 | |
| Space Separator | 20107 | 12.0% |
| Uppercase Letter | 3455 | 2.1% |
| Dash Punctuation | 608 | 0.4% |
| Other Punctuation | 572 | 0.3% |
| Decimal Number | 86 | 0.1% |
| Close Punctuation | 33 | < 0.1% |
| Open Punctuation | 33 | < 0.1% |
| Math Symbol | 4 | < 0.1% |
| Control | 1 | < 0.1% |
Most frequent character per category
Lowercase Letter
| Value | Count | Frequency (%) |
| e | 15295 | |
| i | 12109 | 8.5% |
| a | 12001 | 8.4% |
| t | 11869 | 8.3% |
| o | 11436 | 8.0% |
| n | 11281 | 7.9% |
| r | 10072 | 7.0% |
| s | 8363 | 5.8% |
| c | 6790 | 4.7% |
| d | 6414 | 4.5% |
| Other values (16) | 37560 |
Uppercase Letter
| Value | Count | Frequency (%) |
| M | 562 | |
| S | 425 | |
| C | 273 | 7.9% |
| D | 257 | 7.4% |
| P | 240 | 6.9% |
| A | 212 | 6.1% |
| I | 175 | 5.1% |
| E | 165 | 4.8% |
| L | 152 | 4.4% |
| T | 143 | 4.1% |
| Other values (15) | 851 |
Decimal Number
| Value | Count | Frequency (%) |
| 3 | 23 | |
| 1 | 21 | |
| 2 | 16 | |
| 0 | 8 | 9.3% |
| 4 | 4 | 4.7% |
| 5 | 4 | 4.7% |
| 9 | 3 | 3.5% |
| 7 | 3 | 3.5% |
| 8 | 2 | 2.3% |
| 6 | 2 | 2.3% |
Other Punctuation
| Value | Count | Frequency (%) |
| , | 511 | |
| / | 48 | 8.4% |
| ' | 5 | 0.9% |
| . | 5 | 0.9% |
| ? | 2 | 0.3% |
| : | 1 | 0.2% |
Space Separator
| Value | Count | Frequency (%) |
| 20107 |
Dash Punctuation
| Value | Count | Frequency (%) |
| - | 608 |
Close Punctuation
| Value | Count | Frequency (%) |
| ) | 33 |
Open Punctuation
| Value | Count | Frequency (%) |
| ( | 33 |
Math Symbol
| Value | Count | Frequency (%) |
| | | 4 |
Control
| Value | Count | Frequency (%) |
| | 1 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Latin | 146645 | |
| Common | 21444 | 12.8% |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| e | 15295 | 10.4% |
| i | 12109 | 8.3% |
| a | 12001 | 8.2% |
| t | 11869 | 8.1% |
| o | 11436 | 7.8% |
| n | 11281 | 7.7% |
| r | 10072 | 6.9% |
| s | 8363 | 5.7% |
| c | 6790 | 4.6% |
| d | 6414 | 4.4% |
| Other values (41) | 41015 |
Common
| Value | Count | Frequency (%) |
| 20107 | ||
| - | 608 | 2.8% |
| , | 511 | 2.4% |
| / | 48 | 0.2% |
| ) | 33 | 0.2% |
| ( | 33 | 0.2% |
| 3 | 23 | 0.1% |
| 1 | 21 | 0.1% |
| 2 | 16 | 0.1% |
| 0 | 8 | < 0.1% |
| Other values (12) | 36 | 0.2% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 168088 | |
| None | 1 | < 0.1% |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 20107 | ||
| e | 15295 | 9.1% |
| i | 12109 | 7.2% |
| a | 12001 | 7.1% |
| t | 11869 | 7.1% |
| o | 11436 | 6.8% |
| n | 11281 | 6.7% |
| r | 10072 | 6.0% |
| s | 8363 | 5.0% |
| c | 6790 | 4.0% |
| Other values (62) | 48765 |
None
| Value | Count | Frequency (%) |
| | 1 |
Priority Number
Categorical
HIGH CARDINALITY  UNIFORM  UNIQUE 
| Distinct | 2784 |
|---|---|
| Distinct (%) | 100.0% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 221.6 KiB |
| US2009567718A | 1 |
|---|---|
| JP201167147A | 1 |
| GB20093262A | GB200922612A | US2010712681A | US13222929A | US13203631A | 1 |
| JP201176520A | WO2011JP59839A | 1 |
| JP201168476A | 1 |
| Other values (2779) |
Length
| Max length | 1055 |
|---|---|
| Median length | 524 |
| Mean length | 24.478089 |
| Min length | 10 |
Characters and Unicode
| Total characters | 68147 |
|---|---|
| Distinct characters | 37 |
| Distinct categories | 4 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 2784 ? |
|---|---|
| Unique (%) | 100.0% |
Sample
| 1st row | US2009567718A |
|---|---|
| 2nd row | US200870097P | US2009353217A |
| 3rd row | GB19951841A | GB199521937A | WO1996GB215A | US1997875391A | US2000680863A | US2002306865A | US2005202741A |
| 4th row | GB199824306A | WO1999GB3653A | US2001849499A | US2007789669A | US2008326831A | US2010841064A |
| 5th row | JP1997106136A | US199859776A | US2001872509A | US2006359928A | US2007824803A | US2010817320A | US13442923A |
Common Values
| Value | Count | Frequency (%) |
| US2009567718A | 1 | < 0.1% |
| JP201167147A | 1 | < 0.1% |
| GB20093262A | GB200922612A | US2010712681A | US13222929A | US13203631A | 1 | < 0.1% |
| JP201176520A | WO2011JP59839A | 1 | < 0.1% |
| JP201168476A | 1 | < 0.1% |
| US2010815997A | 1 | < 0.1% |
| JP2011135166A | JP2012111398A | 1 | < 0.1% |
| US13160880A | 1 | < 0.1% |
| FR20112965A | 1 | < 0.1% |
| JP201166867A | 1 | < 0.1% |
| Other values (2774) | 2774 |
Length
| Value | Count | Frequency (%) |
| 2068 | ||
| us2010385446p | 3 | < 0.1% |
| us2009319334a | 3 | < 0.1% |
| us2008969848a | 3 | < 0.1% |
| us2011537151p | 3 | < 0.1% |
| us2011537146p | 3 | < 0.1% |
| us2009380758a | 2 | < 0.1% |
| us2009207739p | 2 | < 0.1% |
| us2009380780a | 2 | < 0.1% |
| us2009380767a | 2 | < 0.1% |
| Other values (4789) | 4829 |
Most occurring characters
| Value | Count | Frequency (%) |
| 0 | 10398 | |
| 2 | 7517 | 11.0% |
| 1 | 6622 | 9.7% |
| 4136 | 6.1% | |
| A | 3659 | 5.4% |
| 3 | 3395 | 5.0% |
| 9 | 3223 | 4.7% |
| 5 | 3047 | 4.5% |
| 8 | 2972 | 4.4% |
| U | 2921 | 4.3% |
| Other values (27) | 20257 |
Most occurring categories
| Value | Count | Frequency (%) |
| Decimal Number | 45788 | |
| Uppercase Letter | 16155 | 23.7% |
| Space Separator | 4136 | 6.1% |
| Math Symbol | 2068 | 3.0% |
Most frequent character per category
Uppercase Letter
| Value | Count | Frequency (%) |
| A | 3659 | |
| U | 2921 | |
| S | 2896 | |
| P | 2319 | |
| J | 851 | 5.3% |
| W | 802 | 5.0% |
| O | 782 | 4.8% |
| E | 457 | 2.8% |
| R | 309 | 1.9% |
| K | 237 | 1.5% |
| Other values (15) | 922 | 5.7% |
Decimal Number
| Value | Count | Frequency (%) |
| 0 | 10398 | |
| 2 | 7517 | |
| 1 | 6622 | |
| 3 | 3395 | 7.4% |
| 9 | 3223 | 7.0% |
| 5 | 3047 | 6.7% |
| 8 | 2972 | 6.5% |
| 4 | 2918 | 6.4% |
| 7 | 2907 | 6.3% |
| 6 | 2789 | 6.1% |
Space Separator
| Value | Count | Frequency (%) |
| 4136 |
Math Symbol
| Value | Count | Frequency (%) |
| | | 2068 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Common | 51992 | |
| Latin | 16155 | 23.7% |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| A | 3659 | |
| U | 2921 | |
| S | 2896 | |
| P | 2319 | |
| J | 851 | 5.3% |
| W | 802 | 5.0% |
| O | 782 | 4.8% |
| E | 457 | 2.8% |
| R | 309 | 1.9% |
| K | 237 | 1.5% |
| Other values (15) | 922 | 5.7% |
Common
| Value | Count | Frequency (%) |
| 0 | 10398 | |
| 2 | 7517 | |
| 1 | 6622 | |
| 4136 | 8.0% | |
| 3 | 3395 | 6.5% |
| 9 | 3223 | 6.2% |
| 5 | 3047 | 5.9% |
| 8 | 2972 | 5.7% |
| 4 | 2918 | 5.6% |
| 7 | 2907 | 5.6% |
| Other values (2) | 4857 |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 68147 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 0 | 10398 | |
| 2 | 7517 | 11.0% |
| 1 | 6622 | 9.7% |
| 4136 | 6.1% | |
| A | 3659 | 5.4% |
| 3 | 3395 | 5.0% |
| 9 | 3223 | 4.7% |
| 5 | 3047 | 4.5% |
| 8 | 2972 | 4.4% |
| U | 2921 | 4.3% |
| Other values (27) | 20257 |
Priority Date
Categorical
HIGH CARDINALITY  UNIFORM 
| Distinct | 2045 |
|---|---|
| Distinct (%) | 73.5% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 208.5 KiB |
| 2012-04-27 | 8 |
|---|---|
| 2011-06-29 | 8 |
| 2011-09-16 | 8 |
| 2011-12-22 | 7 |
| 2010-09-29 | 7 |
| Other values (2040) |
Length
| Max length | 868 |
|---|---|
| Median length | 10 |
| Mean length | 19.656609 |
| Min length | 10 |
Characters and Unicode
| Total characters | 54724 |
|---|---|
| Distinct characters | 13 |
| Distinct categories | 4 ? |
| Distinct scripts | 1 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 1632 ? |
|---|---|
| Unique (%) | 58.6% |
Sample
| 1st row | 2009-09-25 |
|---|---|
| 2nd row | 2008-03-20 | 2009-01-13 |
| 3rd row | 1995-01-31 | 1995-10-26 | 1996-01-31 | 1997-09-25 | 2000-10-06 | 2002-11-27 | 2005-08-11 |
| 4th row | 1998-11-05 | 1999-11-05 | 2001-05-04 | 2007-04-24 | 2008-12-02 | 2010-07-21 |
| 5th row | 1997-04-23 | 1998-04-14 | 2001-06-01 | 2006-02-22 | 2007-07-03 | 2010-06-17 | 2012-04-10 |
Common Values
| Value | Count | Frequency (%) |
| 2012-04-27 | 8 | 0.3% |
| 2011-06-29 | 8 | 0.3% |
| 2011-09-16 | 8 | 0.3% |
| 2011-12-22 | 7 | 0.3% |
| 2010-09-29 | 7 | 0.3% |
| 2012-01-31 | 7 | 0.3% |
| 2011-06-07 | 6 | 0.2% |
| 2011-06-28 | 6 | 0.2% |
| 2011-12-12 | 6 | 0.2% |
| 2012-03-30 | 6 | 0.2% |
| Other values (2035) | 2715 |
Length
| Value | Count | Frequency (%) |
| 2068 | ||
| 2009-03-02 | 31 | 0.4% |
| 2009-07-10 | 21 | 0.3% |
| 2009-07-30 | 18 | 0.3% |
| 2011-08-02 | 15 | 0.2% |
| 2011-09-21 | 11 | 0.2% |
| 2012-04-27 | 11 | 0.2% |
| 2010-12-13 | 10 | 0.1% |
| 2011-06-07 | 10 | 0.1% |
| 2011-09-09 | 10 | 0.1% |
| Other values (1913) | 4715 |
Most occurring characters
| Value | Count | Frequency (%) |
| 0 | 13988 | |
| - | 9704 | |
| 2 | 8266 | |
| 1 | 7754 | |
| 4136 | 7.6% | |
| | | 2068 | 3.8% |
| 9 | 1766 | 3.2% |
| 3 | 1388 | 2.5% |
| 8 | 1322 | 2.4% |
| 7 | 1205 | 2.2% |
| Other values (3) | 3127 | 5.7% |
Most occurring categories
| Value | Count | Frequency (%) |
| Decimal Number | 38816 | |
| Dash Punctuation | 9704 | 17.7% |
| Space Separator | 4136 | 7.6% |
| Math Symbol | 2068 | 3.8% |
Most frequent character per category
Decimal Number
| Value | Count | Frequency (%) |
| 0 | 13988 | |
| 2 | 8266 | |
| 1 | 7754 | |
| 9 | 1766 | 4.5% |
| 3 | 1388 | 3.6% |
| 8 | 1322 | 3.4% |
| 7 | 1205 | 3.1% |
| 6 | 1171 | 3.0% |
| 4 | 982 | 2.5% |
| 5 | 974 | 2.5% |
Dash Punctuation
| Value | Count | Frequency (%) |
| - | 9704 |
Space Separator
| Value | Count | Frequency (%) |
| 4136 |
Math Symbol
| Value | Count | Frequency (%) |
| | | 2068 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Common | 54724 |
Most frequent character per script
Common
| Value | Count | Frequency (%) |
| 0 | 13988 | |
| - | 9704 | |
| 2 | 8266 | |
| 1 | 7754 | |
| 4136 | 7.6% | |
| | | 2068 | 3.8% |
| 9 | 1766 | 3.2% |
| 3 | 1388 | 2.5% |
| 8 | 1322 | 2.4% |
| 7 | 1205 | 2.2% |
| Other values (3) | 3127 | 5.7% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 54724 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 0 | 13988 | |
| - | 9704 | |
| 2 | 8266 | |
| 1 | 7754 | |
| 4136 | 7.6% | |
| | | 2068 | 3.8% |
| 9 | 1766 | 3.2% |
| 3 | 1388 | 2.5% |
| 8 | 1322 | 2.4% |
| 7 | 1205 | 2.2% |
| Other values (3) | 3127 | 5.7% |
Application Number
Categorical
HIGH CARDINALITY  UNIFORM  UNIQUE 
| Distinct | 2784 |
|---|---|
| Distinct (%) | 100.0% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 186.4 KiB |
| US13653717A | 1 |
|---|---|
| US13426687A | 1 |
| US13970109A | 1 |
| US13375329A | 1 |
| US13417536A | 1 |
| Other values (2779) |
Length
| Max length | 13 |
|---|---|
| Median length | 11 |
| Mean length | 11.503233 |
| Min length | 11 |
Characters and Unicode
| Total characters | 32025 |
|---|---|
| Distinct characters | 13 |
| Distinct categories | 2 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 2784 ? |
|---|---|
| Unique (%) | 100.0% |
Sample
| 1st row | US13653717A |
|---|---|
| 2nd row | US13774011A |
| 3rd row | US2010748275A |
| 4th row | US13538995A |
| 5th row | US13899054A |
Common Values
| Value | Count | Frequency (%) |
| US13653717A | 1 | < 0.1% |
| US13426687A | 1 | < 0.1% |
| US13970109A | 1 | < 0.1% |
| US13375329A | 1 | < 0.1% |
| US13417536A | 1 | < 0.1% |
| US13752288A | 1 | < 0.1% |
| US13523743A | 1 | < 0.1% |
| US13160880A | 1 | < 0.1% |
| US13627830A | 1 | < 0.1% |
| US13237158A | 1 | < 0.1% |
| Other values (2774) | 2774 |
Length
| Value | Count | Frequency (%) |
| us13653717a | 1 | < 0.1% |
| us13417969a | 1 | < 0.1% |
| us13717297a | 1 | < 0.1% |
| us2010748275a | 1 | < 0.1% |
| us13538995a | 1 | < 0.1% |
| us13899054a | 1 | < 0.1% |
| us13271729a | 1 | < 0.1% |
| us13890293a | 1 | < 0.1% |
| us13618470a | 1 | < 0.1% |
| us200560765a | 1 | < 0.1% |
| Other values (2774) | 2774 |
Most occurring characters
| Value | Count | Frequency (%) |
| 1 | 4052 | |
| 3 | 3665 | |
| 0 | 3053 | |
| U | 2784 | |
| S | 2784 | |
| A | 2784 | |
| 2 | 2445 | |
| 7 | 1870 | 5.8% |
| 5 | 1789 | 5.6% |
| 8 | 1740 | 5.4% |
| Other values (3) | 5059 |
Most occurring categories
| Value | Count | Frequency (%) |
| Decimal Number | 23673 | |
| Uppercase Letter | 8352 | 26.1% |
Most frequent character per category
Decimal Number
| Value | Count | Frequency (%) |
| 1 | 4052 | |
| 3 | 3665 | |
| 0 | 3053 | |
| 2 | 2445 | |
| 7 | 1870 | |
| 5 | 1789 | |
| 8 | 1740 | |
| 4 | 1707 | |
| 9 | 1691 | |
| 6 | 1661 |
Uppercase Letter
| Value | Count | Frequency (%) |
| U | 2784 | |
| S | 2784 | |
| A | 2784 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Common | 23673 | |
| Latin | 8352 | 26.1% |
Most frequent character per script
Common
| Value | Count | Frequency (%) |
| 1 | 4052 | |
| 3 | 3665 | |
| 0 | 3053 | |
| 2 | 2445 | |
| 7 | 1870 | |
| 5 | 1789 | |
| 8 | 1740 | |
| 4 | 1707 | |
| 9 | 1691 | |
| 6 | 1661 |
Latin
| Value | Count | Frequency (%) |
| U | 2784 | |
| S | 2784 | |
| A | 2784 |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 32025 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 1 | 4052 | |
| 3 | 3665 | |
| 0 | 3053 | |
| U | 2784 | |
| S | 2784 | |
| A | 2784 | |
| 2 | 2445 | |
| 7 | 1870 | 5.8% |
| 5 | 1789 | 5.6% |
| 8 | 1740 | 5.4% |
| Other values (3) | 5059 |
Application Date
Categorical
| Distinct | 1205 |
|---|---|
| Distinct (%) | 43.3% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 182.3 KiB |
| 2013-03-15 | 13 |
|---|---|
| 2013-01-31 | 11 |
| 2012-04-13 | 11 |
| 2013-02-01 | 10 |
| 2013-03-14 | 10 |
| Other values (1200) |
Length
| Max length | 10 |
|---|---|
| Median length | 10 |
| Mean length | 10 |
| Min length | 10 |
Characters and Unicode
| Total characters | 27840 |
|---|---|
| Distinct characters | 11 |
| Distinct categories | 2 ? |
| Distinct scripts | 1 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 564 ? |
|---|---|
| Unique (%) | 20.3% |
Sample
| 1st row | 2012-10-17 |
|---|---|
| 2nd row | 2013-02-22 |
| 3rd row | 2010-03-26 |
| 4th row | 2012-06-29 |
| 5th row | 2013-05-21 |
Common Values
| Value | Count | Frequency (%) |
| 2013-03-15 | 13 | 0.5% |
| 2013-01-31 | 11 | 0.4% |
| 2012-04-13 | 11 | 0.4% |
| 2013-02-01 | 10 | 0.4% |
| 2013-03-14 | 10 | 0.4% |
| 2013-03-11 | 9 | 0.3% |
| 2011-10-21 | 9 | 0.3% |
| 2012-09-14 | 9 | 0.3% |
| 2012-11-30 | 9 | 0.3% |
| 2012-05-14 | 8 | 0.3% |
| Other values (1195) | 2685 |
Length
| Value | Count | Frequency (%) |
| 2013-03-15 | 13 | 0.5% |
| 2012-04-13 | 11 | 0.4% |
| 2013-01-31 | 11 | 0.4% |
| 2013-02-01 | 10 | 0.4% |
| 2013-03-14 | 10 | 0.4% |
| 2013-03-11 | 9 | 0.3% |
| 2011-10-21 | 9 | 0.3% |
| 2012-09-14 | 9 | 0.3% |
| 2012-11-30 | 9 | 0.3% |
| 2013-04-05 | 8 | 0.3% |
| Other values (1195) | 2685 |
Most occurring characters
| Value | Count | Frequency (%) |
| 0 | 6791 | |
| - | 5568 | |
| 1 | 5500 | |
| 2 | 5405 | |
| 3 | 1189 | 4.3% |
| 9 | 652 | 2.3% |
| 8 | 583 | 2.1% |
| 6 | 561 | 2.0% |
| 7 | 547 | 2.0% |
| 4 | 530 | 1.9% |
Most occurring categories
| Value | Count | Frequency (%) |
| Decimal Number | 22272 | |
| Dash Punctuation | 5568 | 20.0% |
Most frequent character per category
Decimal Number
| Value | Count | Frequency (%) |
| 0 | 6791 | |
| 1 | 5500 | |
| 2 | 5405 | |
| 3 | 1189 | 5.3% |
| 9 | 652 | 2.9% |
| 8 | 583 | 2.6% |
| 6 | 561 | 2.5% |
| 7 | 547 | 2.5% |
| 4 | 530 | 2.4% |
| 5 | 514 | 2.3% |
Dash Punctuation
| Value | Count | Frequency (%) |
| - | 5568 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Common | 27840 |
Most frequent character per script
Common
| Value | Count | Frequency (%) |
| 0 | 6791 | |
| - | 5568 | |
| 1 | 5500 | |
| 2 | 5405 | |
| 3 | 1189 | 4.3% |
| 9 | 652 | 2.3% |
| 8 | 583 | 2.1% |
| 6 | 561 | 2.0% |
| 7 | 547 | 2.0% |
| 4 | 530 | 1.9% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 27840 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 0 | 6791 | |
| - | 5568 | |
| 1 | 5500 | |
| 2 | 5405 | |
| 3 | 1189 | 4.3% |
| 9 | 652 | 2.3% |
| 8 | 583 | 2.1% |
| 6 | 561 | 2.0% |
| 7 | 547 | 2.0% |
| 4 | 530 | 1.9% |
Publication Kind Code
Categorical
HIGH CORRELATION  IMBALANCE 
| Distinct | 2 |
|---|---|
| Distinct (%) | 0.1% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 160.5 KiB |
| B2 | |
|---|---|
| B1 | 230 |
Length
| Max length | 2 |
|---|---|
| Median length | 2 |
| Mean length | 2 |
| Min length | 2 |
Characters and Unicode
| Total characters | 5568 |
|---|---|
| Distinct characters | 3 |
| Distinct categories | 2 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 0 ? |
|---|---|
| Unique (%) | 0.0% |
Sample
| 1st row | B2 |
|---|---|
| 2nd row | B2 |
| 3rd row | B2 |
| 4th row | B2 |
| 5th row | B2 |
Common Values
| Value | Count | Frequency (%) |
| B2 | 2554 | |
| B1 | 230 | 8.3% |
Length
Common Values (Plot)
| Value | Count | Frequency (%) |
| b2 | 2554 | |
| b1 | 230 | 8.3% |
Most occurring characters
| Value | Count | Frequency (%) |
| B | 2784 | |
| 2 | 2554 | |
| 1 | 230 | 4.1% |
Most occurring categories
| Value | Count | Frequency (%) |
| Uppercase Letter | 2784 | |
| Decimal Number | 2784 |
Most frequent character per category
Decimal Number
| Value | Count | Frequency (%) |
| 2 | 2554 | |
| 1 | 230 | 8.3% |
Uppercase Letter
| Value | Count | Frequency (%) |
| B | 2784 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Latin | 2784 | |
| Common | 2784 |
Most frequent character per script
Common
| Value | Count | Frequency (%) |
| 2 | 2554 | |
| 1 | 230 | 8.3% |
Latin
| Value | Count | Frequency (%) |
| B | 2784 |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 5568 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| B | 2784 | |
| 2 | 2554 | |
| 1 | 230 | 4.1% |
Publication Date
Categorical
| Distinct | 1 |
|---|---|
| Distinct (%) | < 0.1% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 182.3 KiB |
| 2014-12-30 |
|---|
Length
| Max length | 10 |
|---|---|
| Median length | 10 |
| Mean length | 10 |
| Min length | 10 |
Characters and Unicode
| Total characters | 27840 |
|---|---|
| Distinct characters | 6 |
| Distinct categories | 2 ? |
| Distinct scripts | 1 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 0 ? |
|---|---|
| Unique (%) | 0.0% |
Sample
| 1st row | 2014-12-30 |
|---|---|
| 2nd row | 2014-12-30 |
| 3rd row | 2014-12-30 |
| 4th row | 2014-12-30 |
| 5th row | 2014-12-30 |
Common Values
| Value | Count | Frequency (%) |
| 2014-12-30 | 2784 |
Length
Common Values (Plot)
| Value | Count | Frequency (%) |
| 2014-12-30 | 2784 |
Most occurring characters
| Value | Count | Frequency (%) |
| 2 | 5568 | |
| 0 | 5568 | |
| 1 | 5568 | |
| - | 5568 | |
| 4 | 2784 | |
| 3 | 2784 |
Most occurring categories
| Value | Count | Frequency (%) |
| Decimal Number | 22272 | |
| Dash Punctuation | 5568 | 20.0% |
Most frequent character per category
Decimal Number
| Value | Count | Frequency (%) |
| 2 | 5568 | |
| 0 | 5568 | |
| 1 | 5568 | |
| 4 | 2784 | |
| 3 | 2784 |
Dash Punctuation
| Value | Count | Frequency (%) |
| - | 5568 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Common | 27840 |
Most frequent character per script
Common
| Value | Count | Frequency (%) |
| 2 | 5568 | |
| 0 | 5568 | |
| 1 | 5568 | |
| - | 5568 | |
| 4 | 2784 | |
| 3 | 2784 |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 27840 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 2 | 5568 | |
| 0 | 5568 | |
| 1 | 5568 | |
| - | 5568 | |
| 4 | 2784 | |
| 3 | 2784 |
Inventor - w/address
Categorical
HIGH CARDINALITY  UNIFORM 
| Distinct | 2768 |
|---|---|
| Distinct (%) | 99.4% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 399.2 KiB |
| Matsuda Yoshimoto|Kobe, JP | 3 |
|---|---|
| Forsell Peter|Bouveret, CH | 2 |
| Gao Hua|Fox Point, WI, US | 2 |
| Horstman John Bernard|Midland, MI, US | Swier Steven|Midland, MI, US | 2 |
| Moriwaki Hiroyuki|Osaka, JP | 2 |
| Other values (2763) |
Length
| Max length | 539 |
|---|---|
| Median length | 262 |
| Mean length | 88.874282 |
| Min length | 18 |
Characters and Unicode
| Total characters | 247426 |
|---|---|
| Distinct characters | 85 |
| Distinct categories | 9 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 2 ? |
Unique
| Unique | 2753 ? |
|---|---|
| Unique (%) | 98.9% |
Sample
| 1st row | Breit Oliver Rudolph|Mid Levels, HK |
|---|---|
| 2nd row | Welsh William A.|North Haven, CT, US |
| 3rd row | Staniforth John Nicholas|Bath, GB |
| 4th row | Waldmann Herman|Oxford, GB | Fairchild Paul J.|Oxford, GB | Gardner Richard|Oxford, GB | Brook Frances|Oxford, GB |
| 5th row | Ishiguro Ryuji|Tokyo, JP | Osawa Yoshitomo|Kanagawa, JP | Osakabe Yoshio|Kanagawa, JP | Sato Makoto|Tokyo, JP | Shima Hisato|Tokyo, JP | Asano Tomoyuki|Kanagawa, JP |
Common Values
| Value | Count | Frequency (%) |
| Matsuda Yoshimoto|Kobe, JP | 3 | 0.1% |
| Forsell Peter|Bouveret, CH | 2 | 0.1% |
| Gao Hua|Fox Point, WI, US | 2 | 0.1% |
| Horstman John Bernard|Midland, MI, US | Swier Steven|Midland, MI, US | 2 | 0.1% |
| Moriwaki Hiroyuki|Osaka, JP | 2 | 0.1% |
| Cleverdon Robert Fletcher|Walnut Creek, CA, US | Phillips Christine Marie|Pleasant Hill, CA, US | Timken Hye Kyung Cho|Albany, CA, US | 2 | 0.1% |
| Visenzi Giuseppe|Brescia, IT | 2 | 0.1% |
| Tovey Cameron John|Painted Post, NY, US | 2 | 0.1% |
| Goodno Gregory D.|Los Angeles, CA, US | Weber Mark E.|Hawthorne, CA, US | Weiss IV Stanley Benjamin|Redondo Beach, CA, US | 2 | 0.1% |
| Tsuchi Hiroshi|Kanagawa, JP | 2 | 0.1% |
| Other values (2758) | 2763 |
Length
| Value | Count | Frequency (%) |
| 4913 | 13.6% | |
| us | 3566 | 9.9% |
| jp | 1457 | 4.0% |
| ca | 1030 | 2.8% |
| kr | 573 | 1.6% |
| de | 545 | 1.5% |
| tx | 249 | 0.7% |
| il | 228 | 0.6% |
| tw | 215 | 0.6% |
| ny | 205 | 0.6% |
| Other values (13500) | 23165 |
Most occurring characters
| Value | Count | Frequency (%) |
| 33362 | 13.5% | |
| a | 18240 | 7.4% |
| e | 13468 | 5.4% |
| n | 12857 | 5.2% |
| | | 12608 | 5.1% |
| i | 12497 | 5.1% |
| o | 11581 | 4.7% |
| , | 11264 | 4.6% |
| r | 9075 | 3.7% |
| S | 6824 | 2.8% |
| Other values (75) | 105650 |
Most occurring categories
| Value | Count | Frequency (%) |
| Lowercase Letter | 136300 | |
| Uppercase Letter | 51011 | 20.6% |
| Space Separator | 33362 | 13.5% |
| Other Punctuation | 12949 | 5.2% |
| Math Symbol | 12608 | 5.1% |
| Dash Punctuation | 1180 | 0.5% |
| Open Punctuation | 7 | < 0.1% |
| Close Punctuation | 7 | < 0.1% |
| Control | 2 | < 0.1% |
Most frequent character per category
Lowercase Letter
| Value | Count | Frequency (%) |
| a | 18240 | |
| e | 13468 | |
| n | 12857 | 9.4% |
| i | 12497 | 9.2% |
| o | 11581 | 8.5% |
| r | 9075 | 6.7% |
| s | 6685 | 4.9% |
| l | 6350 | 4.7% |
| h | 6319 | 4.6% |
| t | 5983 | 4.4% |
| Other values (32) | 33245 |
Uppercase Letter
| Value | Count | Frequency (%) |
| S | 6824 | 13.4% |
| U | 3808 | 7.5% |
| C | 3341 | 6.5% |
| A | 3277 | 6.4% |
| J | 3187 | 6.2% |
| P | 2771 | 5.4% |
| M | 2706 | 5.3% |
| K | 2551 | 5.0% |
| T | 2341 | 4.6% |
| R | 2076 | 4.1% |
| Other values (19) | 18129 |
Other Punctuation
| Value | Count | Frequency (%) |
| , | 11264 | |
| . | 1636 | 12.6% |
| ' | 35 | 0.3% |
| / | 10 | 0.1% |
| ? | 4 | < 0.1% |
Open Punctuation
| Value | Count | Frequency (%) |
| ( | 6 | |
| { | 1 | 14.3% |
Close Punctuation
| Value | Count | Frequency (%) |
| ) | 6 | |
| } | 1 | 14.3% |
Control
| Value | Count | Frequency (%) |
| | 1 | |
| | 1 |
Space Separator
| Value | Count | Frequency (%) |
| 33362 |
Math Symbol
| Value | Count | Frequency (%) |
| | | 12608 |
Dash Punctuation
| Value | Count | Frequency (%) |
| - | 1180 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Latin | 187311 | |
| Common | 60115 | 24.3% |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| a | 18240 | 9.7% |
| e | 13468 | 7.2% |
| n | 12857 | 6.9% |
| i | 12497 | 6.7% |
| o | 11581 | 6.2% |
| r | 9075 | 4.8% |
| S | 6824 | 3.6% |
| s | 6685 | 3.6% |
| l | 6350 | 3.4% |
| h | 6319 | 3.4% |
| Other values (61) | 83415 |
Common
| Value | Count | Frequency (%) |
| 33362 | ||
| | | 12608 | 21.0% |
| , | 11264 | 18.7% |
| . | 1636 | 2.7% |
| - | 1180 | 2.0% |
| ' | 35 | 0.1% |
| / | 10 | < 0.1% |
| ( | 6 | < 0.1% |
| ) | 6 | < 0.1% |
| ? | 4 | < 0.1% |
| Other values (4) | 4 | < 0.1% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 247237 | |
| None | 189 | 0.1% |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 33362 | 13.5% | |
| a | 18240 | 7.4% |
| e | 13468 | 5.4% |
| n | 12857 | 5.2% |
| | | 12608 | 5.1% |
| i | 12497 | 5.1% |
| o | 11581 | 4.7% |
| , | 11264 | 4.6% |
| r | 9075 | 3.7% |
| S | 6824 | 2.8% |
| Other values (54) | 105461 |
None
| Value | Count | Frequency (%) |
| ü | 57 | |
| é | 34 | |
| ö | 32 | |
| ä | 23 | |
| ø | 10 | 5.3% |
| å | 8 | 4.2% |
| ç | 7 | 3.7% |
| è | 3 | 1.6% |
| á | 2 | 1.1% |
| æ | 2 | 1.1% |
| Other values (11) | 11 | 5.8% |
Assignee/Applicant
Categorical
HIGH CARDINALITY  UNIFORM 
| Distinct | 2704 |
|---|---|
| Distinct (%) | 97.1% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 466.2 KiB |
| Canon Kabushiki Kaisha,Tokyo,JP | 8 |
|---|---|
| Sony Corporation,Tokyo,JP | 6 |
| International Business Machines Corporation,Armonk,NY,US | 6 |
| Seagate Technology LLC,Cupertino,CA,US | 5 |
| Samsung Electronics Co. Ltd.,Suwon-si,KR | 4 |
| Other values (2699) |
Length
| Max length | 547 |
|---|---|
| Median length | 264 |
| Mean length | 113.43068 |
| Min length | 19 |
Characters and Unicode
| Total characters | 315791 |
|---|---|
| Distinct characters | 97 |
| Distinct categories | 10 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 2 ? |
Unique
| Unique | 2651 ? |
|---|---|
| Unique (%) | 95.2% |
Sample
| 1st row | Euro-Pro Operating LLC,Newton,MA,US |
|---|---|
| 2nd row | Sikorsky Aircraft Corporation,Stratford,CT,US |
| 3rd row | Vectura Limited,Chippenham, Wiltshire,GB | Staniforth John Nicholas,Bath,GB |
| 4th row | ISIS Innovation Limited,Oxford,GB | Waldmann Herman,Oxford,GB | Fairchild Paul J.,Oxford,GB | Gardner Richard,Oxford,GB | Brook Frances,Oxford,GB |
| 5th row | Sony Corporation,Tokyo,JP |
Common Values
| Value | Count | Frequency (%) |
| Canon Kabushiki Kaisha,Tokyo,JP | 8 | 0.3% |
| Sony Corporation,Tokyo,JP | 6 | 0.2% |
| International Business Machines Corporation,Armonk,NY,US | 6 | 0.2% |
| Seagate Technology LLC,Cupertino,CA,US | 5 | 0.2% |
| Samsung Electronics Co. Ltd.,Suwon-si,KR | 4 | 0.1% |
| Xilinx Inc.,San Jose,CA,US | 3 | 0.1% |
| LG Electronics Inc.,Seoul,KR | 3 | 0.1% |
| QUALCOMM Incorporated,San Diego,CA,US | 3 | 0.1% |
| Seiko Epson Corporation,Tokyo,JP | 3 | 0.1% |
| Fujitsu Limited,Kawasaki,JP | Fujitsu Limited,Kawasaki-shi,JP | 3 | 0.1% |
| Other values (2694) | 2740 |
Length
| Value | Count | Frequency (%) |
| 6566 | 19.5% | |
| co | 356 | 1.1% |
| of | 171 | 0.5% |
| diego,ca,us | 130 | 0.4% |
| the | 129 | 0.4% |
| kabushiki | 122 | 0.4% |
| technology | 118 | 0.4% |
| kim | 111 | 0.3% |
| electronics | 110 | 0.3% |
| jose,ca,us | 107 | 0.3% |
| Other values (14864) | 25779 |
Most occurring characters
| Value | Count | Frequency (%) |
| 30915 | 9.8% | |
| , | 22833 | 7.2% |
| a | 21574 | 6.8% |
| o | 17833 | 5.6% |
| e | 17720 | 5.6% |
| n | 17598 | 5.6% |
| i | 16653 | 5.3% |
| r | 12380 | 3.9% |
| t | 10101 | 3.2% |
| s | 9336 | 3.0% |
| Other values (87) | 138848 |
Most occurring categories
| Value | Count | Frequency (%) |
| Lowercase Letter | 184534 | |
| Uppercase Letter | 66018 | 20.9% |
| Space Separator | 30915 | 9.8% |
| Other Punctuation | 26204 | 8.3% |
| Math Symbol | 6490 | 2.1% |
| Dash Punctuation | 1447 | 0.5% |
| Open Punctuation | 66 | < 0.1% |
| Close Punctuation | 66 | < 0.1% |
| Decimal Number | 38 | < 0.1% |
| Control | 13 | < 0.1% |
Most frequent character per category
Lowercase Letter
| Value | Count | Frequency (%) |
| a | 21574 | |
| o | 17833 | 9.7% |
| e | 17720 | 9.6% |
| n | 17598 | 9.5% |
| i | 16653 | 9.0% |
| r | 12380 | 6.7% |
| t | 10101 | 5.5% |
| s | 9336 | 5.1% |
| l | 8390 | 4.5% |
| h | 7434 | 4.0% |
| Other values (31) | 45515 |
Uppercase Letter
| Value | Count | Frequency (%) |
| S | 8621 | 13.1% |
| C | 5350 | 8.1% |
| U | 4732 | 7.2% |
| A | 4174 | 6.3% |
| P | 3564 | 5.4% |
| J | 3427 | 5.2% |
| M | 3380 | 5.1% |
| T | 3308 | 5.0% |
| L | 2997 | 4.5% |
| K | 2880 | 4.4% |
| Other values (19) | 23585 |
Decimal Number
| Value | Count | Frequency (%) |
| 3 | 13 | |
| 4 | 8 | |
| 5 | 5 | 13.2% |
| 2 | 4 | 10.5% |
| 6 | 2 | 5.3% |
| 0 | 2 | 5.3% |
| 1 | 2 | 5.3% |
| 8 | 1 | 2.6% |
| 9 | 1 | 2.6% |
Other Punctuation
| Value | Count | Frequency (%) |
| , | 22833 | |
| . | 3195 | 12.2% |
| & | 98 | 0.4% |
| ' | 46 | 0.2% |
| / | 23 | 0.1% |
| ? | 6 | < 0.1% |
| ! | 3 | < 0.1% |
Control
| Value | Count | Frequency (%) |
| | 7 | |
| | 3 | |
| | 3 |
Math Symbol
| Value | Count | Frequency (%) |
| | | 6486 | |
| + | 4 | 0.1% |
Open Punctuation
| Value | Count | Frequency (%) |
| ( | 65 | |
| { | 1 | 1.5% |
Close Punctuation
| Value | Count | Frequency (%) |
| ) | 65 | |
| } | 1 | 1.5% |
Space Separator
| Value | Count | Frequency (%) |
| 30915 |
Dash Punctuation
| Value | Count | Frequency (%) |
| - | 1447 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Latin | 250552 | |
| Common | 65239 | 20.7% |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| a | 21574 | 8.6% |
| o | 17833 | 7.1% |
| e | 17720 | 7.1% |
| n | 17598 | 7.0% |
| i | 16653 | 6.6% |
| r | 12380 | 4.9% |
| t | 10101 | 4.0% |
| s | 9336 | 3.7% |
| S | 8621 | 3.4% |
| l | 8390 | 3.3% |
| Other values (60) | 110346 |
Common
| Value | Count | Frequency (%) |
| 30915 | ||
| , | 22833 | |
| | | 6486 | 9.9% |
| . | 3195 | 4.9% |
| - | 1447 | 2.2% |
| & | 98 | 0.2% |
| ( | 65 | 0.1% |
| ) | 65 | 0.1% |
| ' | 46 | 0.1% |
| / | 23 | < 0.1% |
| Other values (17) | 66 | 0.1% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 315580 | |
| None | 211 | 0.1% |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 30915 | 9.8% | |
| , | 22833 | 7.2% |
| a | 21574 | 6.8% |
| o | 17833 | 5.7% |
| e | 17720 | 5.6% |
| n | 17598 | 5.6% |
| i | 16653 | 5.3% |
| r | 12380 | 3.9% |
| t | 10101 | 3.2% |
| s | 9336 | 3.0% |
| Other values (66) | 138637 |
None
| Value | Count | Frequency (%) |
| ü | 64 | |
| é | 32 | |
| ö | 32 | |
| ä | 31 | |
| å | 8 | 3.8% |
| ø | 7 | 3.3% |
| | 7 | 3.3% |
| ç | 7 | 3.3% |
| è | 5 | 2.4% |
| | 3 | 1.4% |
| Other values (11) | 15 | 7.1% |
Assignee - Current US
Categorical
| Distinct | 1731 |
|---|---|
| Distinct (%) | 62.2% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 241.5 KiB |
| SAMSUNG ELECTRONICS CO. LTD. | 42 |
|---|---|
| QUALCOMM INCORPORATED | 35 |
| CANON KABUSHIKI KAISHA | 25 |
| MICROSOFT TECHNOLOGY LICENSING LLC | 20 |
| LG ELECTRONICS INC. | 20 |
| Other values (1726) |
Length
| Max length | 787 |
|---|---|
| Median length | 158 |
| Mean length | 31.791307 |
| Min length | 4 |
Characters and Unicode
| Total characters | 88507 |
|---|---|
| Distinct characters | 50 |
| Distinct categories | 8 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 1421 ? |
|---|---|
| Unique (%) | 51.0% |
Sample
| 1st row | GLOBAL APPLIANCE INC. | SHARKNINJA OPERATING LLC | SHARKNINJA MANAGEMENT COMPANY | SHARKNINJA SALES COMPANY | EURO-PRO HOLDCO LLC | GLOBAL APPLIANCE UK HOLDCO LIMITED | COMPASS CAYMAN SPV LTD. | COMPASS CAYMAN SPV 2 LIMITED | EP MIDCO LLC |
|---|---|
| 2nd row | SIKORSKY AIRCRAFT CORP |
| 3rd row | VECTURA LTD | STANIFORTH JOHN NICHOLAS |
| 4th row | OXFORD UNIVERSITY INNOVATION LIMITED |
| 5th row | REDWOOD TECHNOLOGIES LLC |
Common Values
| Value | Count | Frequency (%) |
| SAMSUNG ELECTRONICS CO. LTD. | 42 | 1.5% |
| QUALCOMM INCORPORATED | 35 | 1.3% |
| CANON KABUSHIKI KAISHA | 25 | 0.9% |
| MICROSOFT TECHNOLOGY LICENSING LLC | 20 | 0.7% |
| LG ELECTRONICS INC. | 20 | 0.7% |
| INTERNATIONAL BUSINESS MACHINES CORPORATION | 19 | 0.7% |
| SHARP KABUSHIKI KAISHA | 19 | 0.7% |
| NEC CORPORATION | 19 | 0.7% |
| GM GLOBAL TECHNOLOGY OPERATIONS LLC | 19 | 0.7% |
| FUJITSU LIMITED | 18 | 0.6% |
| Other values (1721) | 2548 |
Length
| Value | Count | Frequency (%) |
| 718 | 5.6% | |
| inc | 710 | 5.5% |
| ltd | 452 | 3.5% |
| corporation | 416 | 3.2% |
| llc | 390 | 3.0% |
| co | 329 | 2.6% |
| of | 193 | 1.5% |
| technology | 166 | 1.3% |
| company | 158 | 1.2% |
| technologies | 146 | 1.1% |
| Other values (2906) | 9203 |
Most occurring characters
| Value | Count | Frequency (%) |
| 10097 | 11.4% | |
| I | 6775 | 7.7% |
| O | 6700 | 7.6% |
| E | 6478 | 7.3% |
| N | 6309 | 7.1% |
| A | 5776 | 6.5% |
| T | 5498 | 6.2% |
| C | 5276 | 6.0% |
| S | 4735 | 5.3% |
| L | 4624 | 5.2% |
| Other values (40) | 26239 |
Most occurring categories
| Value | Count | Frequency (%) |
| Uppercase Letter | 75005 | |
| Space Separator | 10097 | 11.4% |
| Other Punctuation | 2152 | 2.4% |
| Math Symbol | 648 | 0.7% |
| Dash Punctuation | 239 | 0.3% |
| Open Punctuation | 139 | 0.2% |
| Close Punctuation | 139 | 0.2% |
| Decimal Number | 88 | 0.1% |
Most frequent character per category
Uppercase Letter
| Value | Count | Frequency (%) |
| I | 6775 | 9.0% |
| O | 6700 | 8.9% |
| E | 6478 | 8.6% |
| N | 6309 | 8.4% |
| A | 5776 | 7.7% |
| T | 5498 | 7.3% |
| C | 5276 | 7.0% |
| S | 4735 | 6.3% |
| L | 4624 | 6.2% |
| R | 4586 | 6.1% |
| Other values (16) | 18248 |
Other Punctuation
| Value | Count | Frequency (%) |
| . | 2002 | |
| & | 90 | 4.2% |
| / | 33 | 1.5% |
| ' | 11 | 0.5% |
| ; | 6 | 0.3% |
| " | 6 | 0.3% |
| % | 2 | 0.1% |
| ! | 1 | < 0.1% |
| # | 1 | < 0.1% |
Decimal Number
| Value | Count | Frequency (%) |
| 1 | 25 | |
| 0 | 16 | |
| 3 | 15 | |
| 5 | 15 | |
| 2 | 8 | 9.1% |
| 9 | 3 | 3.4% |
| 6 | 3 | 3.4% |
| 8 | 2 | 2.3% |
| 4 | 1 | 1.1% |
Math Symbol
| Value | Count | Frequency (%) |
| | | 640 | |
| + | 8 | 1.2% |
Space Separator
| Value | Count | Frequency (%) |
| 10097 |
Dash Punctuation
| Value | Count | Frequency (%) |
| - | 239 |
Open Punctuation
| Value | Count | Frequency (%) |
| ( | 139 |
Close Punctuation
| Value | Count | Frequency (%) |
| ) | 139 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Latin | 75005 | |
| Common | 13502 | 15.3% |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| I | 6775 | 9.0% |
| O | 6700 | 8.9% |
| E | 6478 | 8.6% |
| N | 6309 | 8.4% |
| A | 5776 | 7.7% |
| T | 5498 | 7.3% |
| C | 5276 | 7.0% |
| S | 4735 | 6.3% |
| L | 4624 | 6.2% |
| R | 4586 | 6.1% |
| Other values (16) | 18248 |
Common
| Value | Count | Frequency (%) |
| 10097 | ||
| . | 2002 | 14.8% |
| | | 640 | 4.7% |
| - | 239 | 1.8% |
| ( | 139 | 1.0% |
| ) | 139 | 1.0% |
| & | 90 | 0.7% |
| / | 33 | 0.2% |
| 1 | 25 | 0.2% |
| 0 | 16 | 0.1% |
| Other values (14) | 82 | 0.6% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 88507 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 10097 | 11.4% | |
| I | 6775 | 7.7% |
| O | 6700 | 7.6% |
| E | 6478 | 7.3% |
| N | 6309 | 7.1% |
| A | 5776 | 6.5% |
| T | 5498 | 6.2% |
| C | 5276 | 6.0% |
| S | 4735 | 5.3% |
| L | 4624 | 5.2% |
| Other values (40) | 26239 |
DWPI Class
Categorical
| Distinct | 1484 |
|---|---|
| Distinct (%) | 53.3% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 206.5 KiB |
| T01 E | 150 |
|---|---|
| T01 E | W01 E | 135 |
| W01 E | W02 E | 54 |
| W01 E | 51 |
| B04 C | D16 C | 37 |
| Other values (1479) |
Length
| Max length | 122 |
|---|---|
| Median length | 113 |
| Mean length | 18.900862 |
| Min length | 5 |
Characters and Unicode
| Total characters | 52620 |
|---|---|
| Distinct characters | 33 |
| Distinct categories | 4 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 1197 ? |
|---|---|
| Unique (%) | 43.0% |
Sample
| 1st row | P43 N |
|---|---|
| 2nd row | W06 E | X11 E | X13 E |
| 3rd row | B07 C | P32 N | P34 N |
| 4th row | B04 C | D16 C | S03 E |
| 5th row | T01 E | T03 E |
Common Values
| Value | Count | Frequency (%) |
| T01 E | 150 | 5.4% |
| T01 E | W01 E | 135 | 4.8% |
| W01 E | W02 E | 54 | 1.9% |
| W01 E | 51 | 1.8% |
| B04 C | D16 C | 37 | 1.3% |
| T01 E | W01 E | W02 E | 32 | 1.1% |
| P31 N | 31 | 1.1% |
| X22 E | 25 | 0.9% |
| L03 C | U11 E | 20 | 0.7% |
| T01 E | T04 E | 19 | 0.7% |
| Other values (1474) | 2230 |
Length
| Value | Count | Frequency (%) |
| 4300 | ||
| e | 3719 | |
| c | 1918 | 10.4% |
| n | 1447 | 7.8% |
| t01 | 797 | 4.3% |
| w01 | 440 | 2.4% |
| l03 | 217 | 1.2% |
| u11 | 201 | 1.1% |
| w02 | 177 | 1.0% |
| b04 | 149 | 0.8% |
| Other values (254) | 5103 |
Most occurring characters
| Value | Count | Frequency (%) |
| 19984 | ||
| | | 4300 | 8.2% |
| E | 3842 | 7.3% |
| 0 | 3371 | 6.4% |
| 1 | 3206 | 6.1% |
| C | 1946 | 3.7% |
| 2 | 1756 | 3.3% |
| N | 1447 | 2.7% |
| 3 | 1304 | 2.5% |
| 4 | 1192 | 2.3% |
| Other values (23) | 10272 |
Most occurring categories
| Value | Count | Frequency (%) |
| Space Separator | 19984 | |
| Uppercase Letter | 14168 | |
| Decimal Number | 14168 | |
| Math Symbol | 4300 | 8.2% |
Most frequent character per category
Uppercase Letter
| Value | Count | Frequency (%) |
| E | 3842 | |
| C | 1946 | |
| N | 1447 | 10.2% |
| T | 1000 | 7.1% |
| W | 865 | 6.1% |
| P | 847 | 6.0% |
| A | 667 | 4.7% |
| Q | 600 | 4.2% |
| U | 590 | 4.2% |
| X | 576 | 4.1% |
| Other values (11) | 1788 |
Decimal Number
| Value | Count | Frequency (%) |
| 0 | 3371 | |
| 1 | 3206 | |
| 2 | 1756 | |
| 3 | 1304 | 9.2% |
| 4 | 1192 | 8.4% |
| 6 | 972 | 6.9% |
| 5 | 898 | 6.3% |
| 8 | 593 | 4.2% |
| 7 | 527 | 3.7% |
| 9 | 349 | 2.5% |
Space Separator
| Value | Count | Frequency (%) |
| 19984 |
Math Symbol
| Value | Count | Frequency (%) |
| | | 4300 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Common | 38452 | |
| Latin | 14168 | 26.9% |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| E | 3842 | |
| C | 1946 | |
| N | 1447 | 10.2% |
| T | 1000 | 7.1% |
| W | 865 | 6.1% |
| P | 847 | 6.0% |
| A | 667 | 4.7% |
| Q | 600 | 4.2% |
| U | 590 | 4.2% |
| X | 576 | 4.1% |
| Other values (11) | 1788 |
Common
| Value | Count | Frequency (%) |
| 19984 | ||
| | | 4300 | 11.2% |
| 0 | 3371 | 8.8% |
| 1 | 3206 | 8.3% |
| 2 | 1756 | 4.6% |
| 3 | 1304 | 3.4% |
| 4 | 1192 | 3.1% |
| 6 | 972 | 2.5% |
| 5 | 898 | 2.3% |
| 8 | 593 | 1.5% |
| Other values (2) | 876 | 2.3% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 52620 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 19984 | ||
| | | 4300 | 8.2% |
| E | 3842 | 7.3% |
| 0 | 3371 | 6.4% |
| 1 | 3206 | 6.1% |
| C | 1946 | 3.7% |
| 2 | 1756 | 3.3% |
| N | 1447 | 2.7% |
| 3 | 1304 | 2.5% |
| 4 | 1192 | 2.3% |
| Other values (23) | 10272 |
DWPI Manual Codes
Categorical
HIGH CARDINALITY  MISSING  UNIFORM 
| Distinct | 2482 |
|---|---|
| Distinct (%) | 97.6% |
| Missing | 242 |
| Missing (%) | 8.7% |
| Memory size | 305.2 KiB |
| W01-A06C4 | 5 |
|---|---|
| Q35-B | 4 |
| T01-G11A | T01-L01 | 4 |
| T01-E01A | 4 |
| Q38-B | 3 |
| Other values (2477) |
Length
| Max length | 855 |
|---|---|
| Median length | 270 |
| Mean length | 62.859953 |
| Min length | 5 |
Characters and Unicode
| Total characters | 159790 |
|---|---|
| Distinct characters | 38 |
| Distinct categories | 5 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 2438 ? |
|---|---|
| Unique (%) | 95.9% |
Sample
| 1st row | W06-B01 | W06-B15B | X11-A01A2 | X11-A01C | X11-A10B | X11-J05X | X11-U04 | X13-F03X | X13-G | X13-U03 |
|---|---|
| 2nd row | B01-B03 | B04-B01B | B04-C01 | B04-D01 | B05-B01P | B10-B02B | B10-B03B | B12-M01B | B12-M11G | B14-D01 |
| 3rd row | B04-B04C | B04-E01 | B04-F02 | B04-H02C | B04-H04C | B14-G02C | B14-G02D | B14-H01 | B14-S11 | D05-H08 | D05-H09 | D05-H14B2 | D05-H17 | S03-E14A1 | S03-E14H |
| 4th row | T01-C01 | T01-H | T01-X | T03-P |
| 5th row | T04-K01B | T04-K03D | W01-C01D3C | W01-C01P6G | W02-F08 | W04-M01D3 | W04-N05 |
Common Values
| Value | Count | Frequency (%) |
| W01-A06C4 | 5 | 0.2% |
| Q35-B | 4 | 0.1% |
| T01-G11A | T01-L01 | 4 | 0.1% |
| T01-E01A | 4 | 0.1% |
| Q38-B | 3 | 0.1% |
| S05-B03 | 3 | 0.1% |
| U11-F02A1 | 3 | 0.1% |
| Q22-B02 | 3 | 0.1% |
| T01-J04E | 3 | 0.1% |
| A12-V03D | 3 | 0.1% |
| Other values (2472) | 2507 | |
| (Missing) | 242 | 8.7% |
Length
| Value | Count | Frequency (%) |
| 12810 | ||
| t01-s03 | 258 | 0.9% |
| w01-c01d3c | 189 | 0.7% |
| w01-a06c4 | 116 | 0.4% |
| t01-c03c | 60 | 0.2% |
| t01-m06a1 | 59 | 0.2% |
| t01-j07d1 | 57 | 0.2% |
| w01-a03b | 57 | 0.2% |
| w01-a06g2 | 56 | 0.2% |
| w01-c01p2 | 55 | 0.2% |
| Other values (5219) | 14445 |
Most occurring characters
| Value | Count | Frequency (%) |
| 25620 | ||
| 0 | 23572 | |
| 1 | 16379 | |
| - | 15335 | |
| | | 12810 | 8.0% |
| A | 6952 | 4.4% |
| 2 | 6739 | 4.2% |
| 4 | 5238 | 3.3% |
| B | 5191 | 3.2% |
| 3 | 4569 | 2.9% |
| Other values (28) | 37385 |
Most occurring categories
| Value | Count | Frequency (%) |
| Decimal Number | 64317 | |
| Uppercase Letter | 41708 | |
| Space Separator | 25620 | 16.0% |
| Dash Punctuation | 15335 | 9.6% |
| Math Symbol | 12810 | 8.0% |
Most frequent character per category
Uppercase Letter
| Value | Count | Frequency (%) |
| A | 6952 | |
| B | 5191 | |
| C | 4526 | |
| T | 3204 | 7.7% |
| E | 2762 | 6.6% |
| D | 2337 | 5.6% |
| W | 2018 | 4.8% |
| J | 1538 | 3.7% |
| F | 1456 | 3.5% |
| X | 1358 | 3.3% |
| Other values (15) | 10366 |
Decimal Number
| Value | Count | Frequency (%) |
| 0 | 23572 | |
| 1 | 16379 | |
| 2 | 6739 | 10.5% |
| 4 | 5238 | 8.1% |
| 3 | 4569 | 7.1% |
| 5 | 2593 | 4.0% |
| 6 | 2429 | 3.8% |
| 7 | 1230 | 1.9% |
| 8 | 885 | 1.4% |
| 9 | 683 | 1.1% |
Space Separator
| Value | Count | Frequency (%) |
| 25620 |
Dash Punctuation
| Value | Count | Frequency (%) |
| - | 15335 |
Math Symbol
| Value | Count | Frequency (%) |
| | | 12810 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Common | 118082 | |
| Latin | 41708 | 26.1% |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| A | 6952 | |
| B | 5191 | |
| C | 4526 | |
| T | 3204 | 7.7% |
| E | 2762 | 6.6% |
| D | 2337 | 5.6% |
| W | 2018 | 4.8% |
| J | 1538 | 3.7% |
| F | 1456 | 3.5% |
| X | 1358 | 3.3% |
| Other values (15) | 10366 |
Common
| Value | Count | Frequency (%) |
| 25620 | ||
| 0 | 23572 | |
| 1 | 16379 | |
| - | 15335 | |
| | | 12810 | |
| 2 | 6739 | 5.7% |
| 4 | 5238 | 4.4% |
| 3 | 4569 | 3.9% |
| 5 | 2593 | 2.2% |
| 6 | 2429 | 2.1% |
| Other values (3) | 2798 | 2.4% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 159790 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 25620 | ||
| 0 | 23572 | |
| 1 | 16379 | |
| - | 15335 | |
| | | 12810 | 8.0% |
| A | 6952 | 4.4% |
| 2 | 6739 | 4.2% |
| 4 | 5238 | 3.3% |
| B | 5191 | 3.2% |
| 3 | 4569 | 2.9% |
| Other values (28) | 37385 |
IPC - Current
Categorical
HIGH CARDINALITY  UNIFORM 
| Distinct | 2729 |
|---|---|
| Distinct (%) | 98.0% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 311.5 KiB |
| G06K000900 | 7 |
|---|---|
| G06F001730 | 5 |
| H04N000718 | 4 |
| G06F001200 | 4 |
| G06F0015173 | 4 |
| Other values (2724) |
Length
| Max length | 391 |
|---|---|
| Median length | 272 |
| Mean length | 57.544899 |
| Min length | 10 |
Characters and Unicode
| Total characters | 160205 |
|---|---|
| Distinct characters | 34 |
| Distinct categories | 4 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 2693 ? |
|---|---|
| Unique (%) | 96.7% |
Sample
| 1st row | B08B000300 | A47L001140 |
|---|---|
| 2nd row | B64C002700 | F01D000502 | F16F000710 | F16F001522 | G01M000136 | H02K000714 | H02K0041025 | H02P000552 | H02K000704 | H02K001602 |
| 3rd row | A61K000914 | A61K000900 | A61K000912 | A61K000916 | A61K000972 | A61K0031195 | A61K00317012 | A61P001100 |
| 4th row | C12N000500 | C12N0005073 | C12N00050784 |
| 5th row | H04L000900 | H04L000908 | G06F000100 | G06F002100 | G06F002110 | G06F002144 | G06F002162 | G06F002172 | G06F002173 | G06F002185 | G09C000100 | G11B002000 | H04L000932 |
Common Values
| Value | Count | Frequency (%) |
| G06K000900 | 7 | 0.3% |
| G06F001730 | 5 | 0.2% |
| H04N000718 | 4 | 0.1% |
| G06F001200 | 4 | 0.1% |
| G06F0015173 | 4 | 0.1% |
| A61F000244 | 3 | 0.1% |
| G09G000336 | 3 | 0.1% |
| G06F001516 | H04L001258 | 3 | 0.1% |
| G06F001100 | 3 | 0.1% |
| H04L002906 | 3 | 0.1% |
| Other values (2719) | 2745 |
Length
| Value | Count | Frequency (%) |
| 10023 | ||
| h04l002906 | 80 | 0.4% |
| h04w000400 | 47 | 0.2% |
| g06f001516 | 44 | 0.2% |
| a61b000500 | 43 | 0.2% |
| g06k000900 | 40 | 0.2% |
| h04l002908 | 35 | 0.2% |
| g06f001900 | 35 | 0.2% |
| a61b001700 | 33 | 0.1% |
| g06f001730 | 31 | 0.1% |
| Other values (6659) | 12419 |
Most occurring characters
| Value | Count | Frequency (%) |
| 0 | 50770 | |
| 20046 | 12.5% | |
| 1 | 13850 | 8.6% |
| | | 10023 | 6.3% |
| 2 | 8384 | 5.2% |
| 6 | 6241 | 3.9% |
| 4 | 6211 | 3.9% |
| 3 | 5976 | 3.7% |
| 5 | 4322 | 2.7% |
| H | 4295 | 2.7% |
| Other values (24) | 30087 |
Most occurring categories
| Value | Count | Frequency (%) |
| Decimal Number | 104522 | |
| Uppercase Letter | 25614 | 16.0% |
| Space Separator | 20046 | 12.5% |
| Math Symbol | 10023 | 6.3% |
Most frequent character per category
Uppercase Letter
| Value | Count | Frequency (%) |
| H | 4295 | |
| B | 3773 | |
| G | 2967 | |
| F | 2610 | |
| C | 2326 | |
| L | 1738 | |
| A | 1729 | |
| K | 1190 | 4.6% |
| D | 944 | 3.7% |
| M | 844 | 3.3% |
| Other values (12) | 3198 |
Decimal Number
| Value | Count | Frequency (%) |
| 0 | 50770 | |
| 1 | 13850 | 13.3% |
| 2 | 8384 | 8.0% |
| 6 | 6241 | 6.0% |
| 4 | 6211 | 5.9% |
| 3 | 5976 | 5.7% |
| 5 | 4322 | 4.1% |
| 7 | 3197 | 3.1% |
| 8 | 3049 | 2.9% |
| 9 | 2522 | 2.4% |
Space Separator
| Value | Count | Frequency (%) |
| 20046 |
Math Symbol
| Value | Count | Frequency (%) |
| | | 10023 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Common | 134591 | |
| Latin | 25614 | 16.0% |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| H | 4295 | |
| B | 3773 | |
| G | 2967 | |
| F | 2610 | |
| C | 2326 | |
| L | 1738 | |
| A | 1729 | |
| K | 1190 | 4.6% |
| D | 944 | 3.7% |
| M | 844 | 3.3% |
| Other values (12) | 3198 |
Common
| Value | Count | Frequency (%) |
| 0 | 50770 | |
| 20046 | 14.9% | |
| 1 | 13850 | 10.3% |
| | | 10023 | 7.4% |
| 2 | 8384 | 6.2% |
| 6 | 6241 | 4.6% |
| 4 | 6211 | 4.6% |
| 3 | 5976 | 4.4% |
| 5 | 4322 | 3.2% |
| 7 | 3197 | 2.4% |
| Other values (2) | 5571 | 4.1% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 160205 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 0 | 50770 | |
| 20046 | 12.5% | |
| 1 | 13850 | 8.6% |
| | | 10023 | 6.3% |
| 2 | 8384 | 5.2% |
| 6 | 6241 | 3.9% |
| 4 | 6211 | 3.9% |
| 3 | 5976 | 3.7% |
| 5 | 4322 | 2.7% |
| H | 4295 | 2.7% |
| Other values (24) | 30087 |
CPC - Current
Categorical
HIGH CARDINALITY  UNIFORM 
| Distinct | 2783 |
|---|---|
| Distinct (%) | > 99.9% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 486.8 KiB |
| A45F0005021 | A45F000502 | A45F2005026 | A45F22000583 | 2 |
|---|---|
| B08B000300 | A47L00114086 | B08B223001 | 1 |
| H05K00033436 | H01L0021563 | H01L002475 | H01L002481 | H01L002483 | H05K000328 | H05K000334 | H01L0023564 | H01L222416225 | H01L222473104 | H01L222475272 | H01L222475281 | H01L222481191 | H01L222481192 | H01L222481815 | H01L222483191 | H01L222483192 | H01L22248388 | H01L222483951 | H01L22249211 | H01L292401005 | H01L292401006 | H01L292401033 | H01L292401082 | H01L2924014 | H01L2924351 | H05K0003303 | H05K22010129 | H05K220110674 | H05K220110977 | H05K2203167 | Y02P007050 | Y10T01561304 | 1 |
| B01D00539409 | B01D00539431 | B01D00539468 | B01D00539477 | B01J0023464 | B01J002906 | B01J0029061 | B01J0029082 | B01J0029088 | B01J0029126 | B01J0029146 | B01J0029166 | B01J0029405 | B01J002944 | B01J002946 | B01J0029505 | B01J002954 | B01J002956 | B01J00297007 | B01J00297057 | B01J00297215 | B01J00297415 | B01J00297615 | B01J00297815 | B01J0035023 | B01J003504 | B01J003510 | B01J00351076 | B01J00370036 | B01J00370217 | B01J00370246 | F01N0003035 | F01N00032066 | B01D00539418 | B01D00539422 | B01D22552065 | B01D225520738 | B01D225520761 | B01D225550 | B01D22559155 | B01D225592 | B01D22559202 | B01D2258012 | B01D2258014 | B01D227530 | B01D227930 | F01N00030842 | F01N231006 | F01N251006 | Y02T001012 | Y10S005530 | 1 |
| A61F000501 | A61H0001006 | A61H22011284 | A61H22011623 | A61H22011635 | A61H22011664 | A61H22030431 | A61H2205081 | 1 |
| Other values (2778) |
Length
| Max length | 1077 |
|---|---|
| Median length | 416 |
| Mean length | 121.98994 |
| Min length | 10 |
Characters and Unicode
| Total characters | 339620 |
|---|---|
| Distinct characters | 35 |
| Distinct categories | 4 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 2782 ? |
|---|---|
| Unique (%) | 99.9% |
Sample
| 1st row | B08B000300 | A47L00114086 | B08B223001 |
|---|---|
| 2nd row | B64C0027001 | F01D000502 | F16F00071011 | F16F0015223 | G01M000136 | H02K000714 | H02K0041025 | H02P000556 | B64C2027003 | H02K000704 | H02K001602 | Y10T00742121 | Y10T00742127 |
| 3rd row | A61K00090075 | A61K000900 | A61K000912 | A61K0009145 | A61K00317012 | A61P001100 | A61P001106 | A61P001108 |
| 4th row | C12N00050639 | A61P003700 | C12N00050603 | C12N0005064 | A61K20395154 | A61K20395156 | C12N2501052 | C12N250122 | C12N250123 | C12N250302 | C12N250602 | C12N251000 |
| 5th row | H04L00090891 | G06F001700 | G06F002110 | G06F0021445 | G06F00216209 | G06F0021725 | G06F002173 | G06F002185 | G11B002000086 | G11B00200021 | G11B002000246 | G11B002000492 | G11B002000521 | H04L0009008 | H04L00090861 | H04L00090869 | G06F2211007 | G06F22212107 | G11B22202525 | G11B22202562 | H04L2209603 | H04L2209605 |
Common Values
| Value | Count | Frequency (%) |
| A45F0005021 | A45F000502 | A45F2005026 | A45F22000583 | 2 | 0.1% |
| B08B000300 | A47L00114086 | B08B223001 | 1 | < 0.1% |
| H05K00033436 | H01L0021563 | H01L002475 | H01L002481 | H01L002483 | H05K000328 | H05K000334 | H01L0023564 | H01L222416225 | H01L222473104 | H01L222475272 | H01L222475281 | H01L222481191 | H01L222481192 | H01L222481815 | H01L222483191 | H01L222483192 | H01L22248388 | H01L222483951 | H01L22249211 | H01L292401005 | H01L292401006 | H01L292401033 | H01L292401082 | H01L2924014 | H01L2924351 | H05K0003303 | H05K22010129 | H05K220110674 | H05K220110977 | H05K2203167 | Y02P007050 | Y10T01561304 | 1 | < 0.1% |
| B01D00539409 | B01D00539431 | B01D00539468 | B01D00539477 | B01J0023464 | B01J002906 | B01J0029061 | B01J0029082 | B01J0029088 | B01J0029126 | B01J0029146 | B01J0029166 | B01J0029405 | B01J002944 | B01J002946 | B01J0029505 | B01J002954 | B01J002956 | B01J00297007 | B01J00297057 | B01J00297215 | B01J00297415 | B01J00297615 | B01J00297815 | B01J0035023 | B01J003504 | B01J003510 | B01J00351076 | B01J00370036 | B01J00370217 | B01J00370246 | F01N0003035 | F01N00032066 | B01D00539418 | B01D00539422 | B01D22552065 | B01D225520738 | B01D225520761 | B01D225550 | B01D22559155 | B01D225592 | B01D22559202 | B01D2258012 | B01D2258014 | B01D227530 | B01D227930 | F01N00030842 | F01N231006 | F01N251006 | Y02T001012 | Y10S005530 | 1 | < 0.1% |
| A61F000501 | A61H0001006 | A61H22011284 | A61H22011623 | A61H22011635 | A61H22011664 | A61H22030431 | A61H2205081 | 1 | < 0.1% |
| G01B000730 | G01B002122 | G01D001800 | G01D220522 | G01D2205776 | 1 | < 0.1% |
| H04L000108 | H03M001309 | H04L00010089 | H04L00011614 | H04L00011628 | H04L00011809 | H04L00011812 | H04L0001187 | H04L00011887 | H04L004725 | H04W002404 | H04L004729 | H04L20010098 | 1 | < 0.1% |
| H01M0050562 | H01M0050147 | H01M0050176 | H01M0050543 | H01M005055 | H01M0050553 | H01M0050566 | Y02E006010 | Y10T002949117 | 1 | < 0.1% |
| H02H0009045 | H05K00071481 | H05K00090067 | G01R0031318513 | H01L002362 | H01L292414 | Y10T002949002 | 1 | < 0.1% |
| H04W0008085 | H04W002404 | H04W008004 | 1 | < 0.1% |
| Other values (2773) | 2773 |
Length
| Value | Count | Frequency (%) |
| 21770 | ||
| y02e006010 | 50 | 0.1% |
| y10t002949826 | 43 | 0.1% |
| h01l29240002 | 42 | 0.1% |
| a61p003500 | 36 | 0.1% |
| y02e006050 | 34 | 0.1% |
| y02p007050 | 32 | 0.1% |
| y02d001000 | 30 | 0.1% |
| y02t001070 | 28 | 0.1% |
| y02t001012 | 27 | 0.1% |
| Other values (16629) | 24232 |
Most occurring characters
| Value | Count | Frequency (%) |
| 0 | 84869 | |
| 43540 | ||
| 1 | 30904 | 9.1% |
| 2 | 28815 | 8.5% |
| | | 21770 | 6.4% |
| 4 | 15668 | 4.6% |
| 6 | 15319 | 4.5% |
| 3 | 14647 | 4.3% |
| 5 | 11909 | 3.5% |
| 7 | 8141 | 2.4% |
| Other values (25) | 64038 |
Most occurring categories
| Value | Count | Frequency (%) |
| Decimal Number | 225202 | |
| Uppercase Letter | 49108 | 14.5% |
| Space Separator | 43540 | 12.8% |
| Math Symbol | 21770 | 6.4% |
Most frequent character per category
Uppercase Letter
| Value | Count | Frequency (%) |
| H | 7734 | |
| B | 6619 | |
| G | 4778 | |
| F | 4406 | |
| L | 4143 | |
| A | 3860 | |
| C | 3794 | |
| Y | 1982 | 4.0% |
| K | 1729 | 3.5% |
| T | 1469 | 3.0% |
| Other values (13) | 8594 |
Decimal Number
| Value | Count | Frequency (%) |
| 0 | 84869 | |
| 1 | 30904 | 13.7% |
| 2 | 28815 | 12.8% |
| 4 | 15668 | 7.0% |
| 6 | 15319 | 6.8% |
| 3 | 14647 | 6.5% |
| 5 | 11909 | 5.3% |
| 7 | 8141 | 3.6% |
| 8 | 7786 | 3.5% |
| 9 | 7144 | 3.2% |
Space Separator
| Value | Count | Frequency (%) |
| 43540 |
Math Symbol
| Value | Count | Frequency (%) |
| | | 21770 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Common | 290512 | |
| Latin | 49108 | 14.5% |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| H | 7734 | |
| B | 6619 | |
| G | 4778 | |
| F | 4406 | |
| L | 4143 | |
| A | 3860 | |
| C | 3794 | |
| Y | 1982 | 4.0% |
| K | 1729 | 3.5% |
| T | 1469 | 3.0% |
| Other values (13) | 8594 |
Common
| Value | Count | Frequency (%) |
| 0 | 84869 | |
| 43540 | ||
| 1 | 30904 | 10.6% |
| 2 | 28815 | 9.9% |
| | | 21770 | 7.5% |
| 4 | 15668 | 5.4% |
| 6 | 15319 | 5.3% |
| 3 | 14647 | 5.0% |
| 5 | 11909 | 4.1% |
| 7 | 8141 | 2.8% |
| Other values (2) | 14930 | 5.1% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 339620 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 0 | 84869 | |
| 43540 | ||
| 1 | 30904 | 9.1% |
| 2 | 28815 | 8.5% |
| | | 21770 | 6.4% |
| 4 | 15668 | 4.6% |
| 6 | 15319 | 4.5% |
| 3 | 14647 | 4.3% |
| 5 | 11909 | 3.5% |
| 7 | 8141 | 2.4% |
| Other values (25) | 64038 |
US Class
Categorical
HIGH CARDINALITY  UNIFORM 
| Distinct | 2697 |
|---|---|
| Distinct (%) | 96.9% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 242.2 KiB |
| 370329 | 7 |
|---|---|
| 382128 | 7 |
| 370328 | 5 |
| 370392 | 3 |
| 525477 | 3 |
| Other values (2692) |
Length
| Max length | 573 |
|---|---|
| Median length | 265 |
| Mean length | 32.037356 |
| Min length | 6 |
Characters and Unicode
| Total characters | 89192 |
|---|---|
| Distinct characters | 32 |
| Distinct categories | 4 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 2634 ? |
|---|---|
| Unique (%) | 94.6% |
Sample
| 1st row | 134105 |
|---|---|
| 2nd row | 416145 | 0745741 | 310081 |
| 3rd row | 424046 | 424489 | 424490 | 424493 | 424499 | 514951 |
| 4th row | 435325 | 435375 |
| 5th row | 380044 | 713189 |
Common Values
| Value | Count | Frequency (%) |
| 370329 | 7 | 0.3% |
| 382128 | 7 | 0.3% |
| 370328 | 5 | 0.2% |
| 370392 | 3 | 0.1% |
| 525477 | 3 | 0.1% |
| 377064 | 377068 | 377079 | 3 | 0.1% |
| 345173 | 3 | 0.1% |
| 290044 | 290055 | 3 | 0.1% |
| 382103 | 3 | 0.1% |
| 310071 | 3 | 0.1% |
| Other values (2687) | 2744 |
Length
| Value | Count | Frequency (%) |
| 7663 | ||
| 370329 | 36 | 0.2% |
| 370328 | 31 | 0.2% |
| 370338 | 23 | 0.1% |
| 370252 | 20 | 0.1% |
| 709224 | 20 | 0.1% |
| 709203 | 19 | 0.1% |
| 370331 | 16 | 0.1% |
| 345173 | 15 | 0.1% |
| 370401 | 15 | 0.1% |
| Other values (7443) | 10252 |
Most occurring characters
| Value | Count | Frequency (%) |
| 15326 | ||
| 0 | 9737 | |
| 2 | 9010 | |
| 1 | 8222 | |
| 3 | 7830 | |
| | | 7663 | |
| 4 | 7204 | |
| 5 | 6790 | |
| 7 | 5602 | 6.3% |
| 6 | 4514 | 5.1% |
| Other values (22) | 7294 |
Most occurring categories
| Value | Count | Frequency (%) |
| Decimal Number | 65886 | |
| Space Separator | 15326 | 17.2% |
| Math Symbol | 7663 | 8.6% |
| Uppercase Letter | 317 | 0.4% |
Most frequent character per category
Uppercase Letter
| Value | Count | Frequency (%) |
| E | 132 | |
| R | 67 | |
| A | 28 | 8.8% |
| B | 14 | 4.4% |
| D | 13 | 4.1% |
| G | 11 | 3.5% |
| I | 9 | 2.8% |
| C | 9 | 2.8% |
| S | 6 | 1.9% |
| P | 5 | 1.6% |
| Other values (10) | 23 | 7.3% |
Decimal Number
| Value | Count | Frequency (%) |
| 0 | 9737 | |
| 2 | 9010 | |
| 1 | 8222 | |
| 3 | 7830 | |
| 4 | 7204 | |
| 5 | 6790 | |
| 7 | 5602 | |
| 6 | 4514 | |
| 8 | 3707 | 5.6% |
| 9 | 3270 | 5.0% |
Space Separator
| Value | Count | Frequency (%) |
| 15326 |
Math Symbol
| Value | Count | Frequency (%) |
| | | 7663 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Common | 88875 | |
| Latin | 317 | 0.4% |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| E | 132 | |
| R | 67 | |
| A | 28 | 8.8% |
| B | 14 | 4.4% |
| D | 13 | 4.1% |
| G | 11 | 3.5% |
| I | 9 | 2.8% |
| C | 9 | 2.8% |
| S | 6 | 1.9% |
| P | 5 | 1.6% |
| Other values (10) | 23 | 7.3% |
Common
| Value | Count | Frequency (%) |
| 15326 | ||
| 0 | 9737 | |
| 2 | 9010 | |
| 1 | 8222 | |
| 3 | 7830 | |
| | | 7663 | |
| 4 | 7204 | |
| 5 | 6790 | |
| 7 | 5602 | 6.3% |
| 6 | 4514 | 5.1% |
| Other values (2) | 6977 |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 89192 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 15326 | ||
| 0 | 9737 | |
| 2 | 9010 | |
| 1 | 8222 | |
| 3 | 7830 | |
| | | 7663 | |
| 4 | 7204 | |
| 5 | 6790 | |
| 7 | 5602 | 6.3% |
| 6 | 4514 | 5.1% |
| Other values (22) | 7294 |
ECLA
Unsupported
MISSING  REJECTED  UNSUPPORTED 
| Missing | 2784 |
|---|---|
| Missing (%) | 100.0% |
| Memory size | 21.9 KiB |
Abstract
Categorical
HIGH CARDINALITY  UNIFORM  UNIQUE 
| Distinct | 2784 |
|---|---|
| Distinct (%) | 100.0% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 2.7 MiB |
| A steam appliance includes a steam applicator which is connectable to the steam appliance, but the steam applicator is permitted to rotate without loosening or disengaging the connection of the steam applicator to the steam appliance. Embodiments may be particularly suitable for use with a portable, handheld steam appliance that employs steam pocket technology. | 1 |
|---|---|
| Solder bumps are formed on a plurality of electrode parts of a printed substrate and a semiconductor chip is loaded on the printed substrate via the plurality of solder bumps. In this case, a thermoplastic film is prepared as an underfill that covers a surface of the printed substrate on which the solder bumps are formed. In the film, parts corresponding to the solder bumps are removed and a peripheral edge of a part on which the semiconductor chip will be loaded has a protruded form. After the printed substrate has been covered with the film, the film is bonded onto the board and the semiconductor chip is loaded on the printed substrate and carried into a reflow furnace. In the reflow furnace, heat and pressure are applied to fuse the solder bumps. | 1 |
| A filter for filtering particulate matter (PM) from exhaust gas emitted from a positive ignition engine or a compression ignition engine, which filter comprising a porous substrate having inlet surfaces and outlet surfaces, wherein the inlet surfaces are separated from the outlet surfaces by a porous structure containing pores of a first mean pore size, wherein the porous substrate is coated with a washcoat comprising a plurality of solid particles wherein the porous structure of the washcoated porous substrate contains pores of a second mean pore size, and wherein the second mean pore size is less than the first mean pore size. | 1 |
| The invention provides a lumbago treatment instrument which manipulates the pelvis safely and properly by pressing the coccyx utilizing the patient's own body weight. A coccyx contact treatment member is disposed inside a cylindrical casing so as to be movable in the vertical direction via an elastic member. A coccyx contact buffering member made of sponge or the like is provided on the upper end of the coccyx contact treatment member. The patient straddles the coccyx contacting buffering member, assuming a sitting posture, and places the coccyx on the coccyx contact buffering member. In this posture, both feet are slightly lifted from the floor to apply the body weight on the coccyx contact buffering member so that the coccyx is pushed up from below. When doing so, the patient continues to maintain an upright posture while pressing the upper body against a posture holding member and gripping a handle with both hands. | L'invention a pour but de manipuler le bassin d'une manière sûre et correcte par compression du coccyx par utilisation du propre poids corporel du patient. A cet effet, selon l'invention, une partie thérapeutique (9a) de contact avec le coccyx est disposée à l'intérieur d'un boîtier cylindrique (7) de façon à pouvoir se déplacer dans la direction verticale par l'intermédiaire d'un corps élastique (10). L'extrémité supérieure de celle-ci comporte un coussin (11) de contact avec le coccyx, configuré à partir d'une éponge, etc. Le patient chevauche le coussin (11) de contact avec le coccyx, adoptant une posture comme s'il était assis sur celui-ci, et place le coccyx sur le coussin (11) de contact avec le coccyx. Dans ladite posture, les deux pieds sont légèrement soulevés du sol pour appliquer le poids corporel sur le coussin (11) de contact avec le coccyx et comprimer le coccyx vers le haut à partir du dessous. En effectuant ceci, le patient continue à maintenir une posture verticale par compression de la moitié supérieure du corps contre une structure (2) de maintien de posture et saisie des poignées avec les deux mains. | 1 |
| A fail detecting device for a rotation angle sensor, for detecting a fail of the rotation angle sensor even if the number of rotation angle sensors is one. A cam is configured to be driven to rotate in one direction by an electric motor to reciprocate a push rod. An output voltage of an angle sensor is set so that the region equal to or lower than a first predetermined voltage and the region equal to or higher than a second predetermined voltage higher than the first predetermined voltage are recognized as a dead zone. The elapsed time after the transition to the dead zone is measured by a timer and it is determined that the angle sensor is in the fail state if the output voltage corresponding to the dead zone is detected although the estimated time of the passage through the dead zone has elapsed. | 1 |
| Other values (2779) |
Length
| Max length | 8390 |
|---|---|
| Median length | 1700 |
| Mean length | 955.95618 |
| Min length | 45 |
Characters and Unicode
| Total characters | 2661382 |
|---|---|
| Distinct characters | 130 |
| Distinct categories | 15 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 2 ? |
Unique
| Unique | 2784 ? |
|---|---|
| Unique (%) | 100.0% |
Sample
| 1st row | A steam appliance includes a steam applicator which is connectable to the steam appliance, but the steam applicator is permitted to rotate without loosening or disengaging the connection of the steam applicator to the steam appliance. Embodiments may be particularly suitable for use with a portable, handheld steam appliance that employs steam pocket technology. |
|---|---|
| 2nd row | A vibration suppressor system includes an annular electric motor system which independently controls rotation of at least two masses about the axis of rotation to reduce in-plane vibration of the rotating system. A method of reducing vibrations in a rotary-wing aircraft includes independently controlling a relative angular position of a multiple of independently rotatable masses to reduce vibrations of a main rotor system. |
| 3rd row | A powder for use in a dry powder inhaler includes active particles and carrier particles for carrying the active particles. The powder further includes additive material on the surfaces of the carrier particles to promote the release of the active particles from the carrier particles on actuation of the inhaler. The powder is such that the active particles are not liable to be released from the carrier particles before actuation of the inhaler. The inclusion of additive material in the powder has been found to give an increased respirable fraction of the active material. |
| 4th row | Disclosed are embryonic stem cell-derived dendritic cells, genetically modified immature dendritic cells capable of maturation, as well as methods for the production of such cells. In one embodiment, the cells made be produced by a method comprising the steps of providing a population of embryonic stem cells; culturing the embryonic stem cells in the presence of a cytokine or combination of cytokines which brings about differentiation of the embryonic stem cells into dendritic cells; and recovering the dendritic cells from the culture. In a further embodiment, the cells may be genetically modified. |
| 5th row | The invention provides an enciphering apparatus and method, a deciphering apparatus and method and an information processing apparatus and method by which illegal copying can be prevented with certainty. Data enciphered by a 1394 interface of a DVD player is transmitted to a personal computer and a magneto-optical disk apparatus through a 1394 bus. In the magneto-optical disk apparatus with which a change to a function is open to a user, the received data is deciphered by a 1394 interface. In contrast, in the personal computer with which a change to a function is open to a user, the enciphered data is deciphered using a time variable key by a 1394 interface, and a result of the decipherment is further deciphered using a session key by an application section. |
Common Values
| Value | Count | Frequency (%) |
| A steam appliance includes a steam applicator which is connectable to the steam appliance, but the steam applicator is permitted to rotate without loosening or disengaging the connection of the steam applicator to the steam appliance. Embodiments may be particularly suitable for use with a portable, handheld steam appliance that employs steam pocket technology. | 1 | < 0.1% |
| Solder bumps are formed on a plurality of electrode parts of a printed substrate and a semiconductor chip is loaded on the printed substrate via the plurality of solder bumps. In this case, a thermoplastic film is prepared as an underfill that covers a surface of the printed substrate on which the solder bumps are formed. In the film, parts corresponding to the solder bumps are removed and a peripheral edge of a part on which the semiconductor chip will be loaded has a protruded form. After the printed substrate has been covered with the film, the film is bonded onto the board and the semiconductor chip is loaded on the printed substrate and carried into a reflow furnace. In the reflow furnace, heat and pressure are applied to fuse the solder bumps. | 1 | < 0.1% |
| A filter for filtering particulate matter (PM) from exhaust gas emitted from a positive ignition engine or a compression ignition engine, which filter comprising a porous substrate having inlet surfaces and outlet surfaces, wherein the inlet surfaces are separated from the outlet surfaces by a porous structure containing pores of a first mean pore size, wherein the porous substrate is coated with a washcoat comprising a plurality of solid particles wherein the porous structure of the washcoated porous substrate contains pores of a second mean pore size, and wherein the second mean pore size is less than the first mean pore size. | 1 | < 0.1% |
| The invention provides a lumbago treatment instrument which manipulates the pelvis safely and properly by pressing the coccyx utilizing the patient's own body weight. A coccyx contact treatment member is disposed inside a cylindrical casing so as to be movable in the vertical direction via an elastic member. A coccyx contact buffering member made of sponge or the like is provided on the upper end of the coccyx contact treatment member. The patient straddles the coccyx contacting buffering member, assuming a sitting posture, and places the coccyx on the coccyx contact buffering member. In this posture, both feet are slightly lifted from the floor to apply the body weight on the coccyx contact buffering member so that the coccyx is pushed up from below. When doing so, the patient continues to maintain an upright posture while pressing the upper body against a posture holding member and gripping a handle with both hands. | L'invention a pour but de manipuler le bassin d'une manière sûre et correcte par compression du coccyx par utilisation du propre poids corporel du patient. A cet effet, selon l'invention, une partie thérapeutique (9a) de contact avec le coccyx est disposée à l'intérieur d'un boîtier cylindrique (7) de façon à pouvoir se déplacer dans la direction verticale par l'intermédiaire d'un corps élastique (10). L'extrémité supérieure de celle-ci comporte un coussin (11) de contact avec le coccyx, configuré à partir d'une éponge, etc. Le patient chevauche le coussin (11) de contact avec le coccyx, adoptant une posture comme s'il était assis sur celui-ci, et place le coccyx sur le coussin (11) de contact avec le coccyx. Dans ladite posture, les deux pieds sont légèrement soulevés du sol pour appliquer le poids corporel sur le coussin (11) de contact avec le coccyx et comprimer le coccyx vers le haut à partir du dessous. En effectuant ceci, le patient continue à maintenir une posture verticale par compression de la moitié supérieure du corps contre une structure (2) de maintien de posture et saisie des poignées avec les deux mains. | 1 | < 0.1% |
| A fail detecting device for a rotation angle sensor, for detecting a fail of the rotation angle sensor even if the number of rotation angle sensors is one. A cam is configured to be driven to rotate in one direction by an electric motor to reciprocate a push rod. An output voltage of an angle sensor is set so that the region equal to or lower than a first predetermined voltage and the region equal to or higher than a second predetermined voltage higher than the first predetermined voltage are recognized as a dead zone. The elapsed time after the transition to the dead zone is measured by a timer and it is determined that the angle sensor is in the fail state if the output voltage corresponding to the dead zone is detected although the estimated time of the passage through the dead zone has elapsed. | 1 | < 0.1% |
| In general, the subject matter described in this specification can be embodied in methods, systems, and program products for adaptive data unit transmission. A sliding window is filled with data units and designates a sliding window start position and a sliding window end position. A value for each of the data units in the sliding window is stored, the value representing a maximum number of times that each data unit is to be transmitted. The stored value is different among at least two of the data units. Data units are selected from the sliding window to be assembled into a packet. An assembled packet is transmitted to a receiving computerized device. A determination that the data unit positioned at the sliding window start position has been transmitted a maximum number of time is performed, and in response a different data unit is positioned at the sliding window start position. | 1 | < 0.1% |
| There is provided an electric storage element and a production method thereof. The electric storage element has excellent air tightness at a portion connected with an external terminal and realizes high assembling performance, even in a simple configuration. The electric storage element includes casings, an external terminal that has a surface exposed outward from one of the casings, a current collector that is provided inside the casings and is connected to the external terminal, and an electrode assembly that is provided inside the casings and is connected to the current collector. The casings are provided with a through hole. The external terminal includes a flange in contact with an outer surface of one of the casings, and a first shaft that extends from the flange to be inserted into the through hole in one of the casings and be welded over the entire periphery. | 1 | < 0.1% |
| What is disclosed is a modular visualization display panel. The modular visualization display panel includes a first module having at least one surface and a connection to electrical ground. The modular visualization display panel also includes a second module having at least one surface with a plurality of raised contact nodes arranged on the one surface of the second module such that when in contact with the one surface of the first module electrostatic discharge energy is directed over at least one of the raised contact nodes to the one surface of the first module. | 1 | < 0.1% |
| A method for guaranteeing with a high level of reliability the continuity of the communications operated from a fourth-generation mobile terminal linked to a level-3 interconnection network, in the terminology defined by the OSI, uses gateways to maintain location information about the mobile terminals. The method applies notably to the mobility of mobile terminals in a context which is highly intolerant to faults, for example for networks used by military forces, public bodies, or civil agents such as the police, fire brigade or civil security. In particular, it may be implemented in networks liable to experience breaks in communication links in the interconnection network. | 1 | < 0.1% |
| A control device includes: a search request receiving unit that receives a request to search for a first operation screen registered in a second image forming apparatus connected to a first image forming apparatus; a search unit that searches for the first operation screen among operation screens registered in the second image forming apparatus; a display control unit that controls to display the first operation screen on a display device provided in the first image forming apparatus; a receiver that receives an instruction for the second image forming apparatus having the first operation screen registered therein from a user through the first operation screen displayed on the display device; and a transmitter that transmits the instruction received from the user through the first operation screen to the second image forming apparatus having the first operation screen registered therein. | 1 | < 0.1% |
| Other values (2774) | 2774 |
Length
| Value | Count | Frequency (%) |
| the | 25954 | 6.2% |
| a | 20207 | 4.8% |
| of | 10918 | 2.6% |
| and | 9415 | 2.2% |
| de | 8651 | 2.1% |
| to | 7906 | 1.9% |
| is | 4911 | 1.2% |
| in | 4587 | 1.1% |
| an | 4497 | 1.1% |
| un | 3417 | 0.8% |
| Other values (22764) | 318434 |
Most occurring characters
| Value | Count | Frequency (%) |
| 416957 | ||
| e | 279145 | 10.5% |
| t | 187596 | 7.0% |
| n | 172833 | 6.5% |
| a | 167460 | 6.3% |
| i | 167193 | 6.3% |
| o | 150090 | 5.6% |
| r | 143196 | 5.4% |
| s | 128495 | 4.8% |
| d | 93847 | 3.5% |
| Other values (120) | 754570 |
Most occurring categories
| Value | Count | Frequency (%) |
| Lowercase Letter | 2134625 | |
| Space Separator | 416961 | 15.7% |
| Other Punctuation | 38625 | 1.5% |
| Uppercase Letter | 27951 | 1.1% |
| Decimal Number | 19218 | 0.7% |
| Close Punctuation | 7965 | 0.3% |
| Open Punctuation | 7786 | 0.3% |
| Dash Punctuation | 4607 | 0.2% |
| Control | 2224 | 0.1% |
| Math Symbol | 1189 | < 0.1% |
| Other values (5) | 231 | < 0.1% |
Most frequent character per category
Lowercase Letter
| Value | Count | Frequency (%) |
| e | 279145 | |
| t | 187596 | 8.8% |
| n | 172833 | 8.1% |
| a | 167460 | 7.8% |
| i | 167193 | 7.8% |
| o | 150090 | 7.0% |
| r | 143196 | 6.7% |
| s | 128495 | 6.0% |
| d | 93847 | 4.4% |
| c | 90389 | 4.2% |
| Other values (36) | 554381 |
Uppercase Letter
| Value | Count | Frequency (%) |
| T | 4878 | |
| A | 4356 | |
| L | 2302 | 8.2% |
| C | 1620 | 5.8% |
| S | 1599 | 5.7% |
| I | 1543 | 5.5% |
| D | 1536 | 5.5% |
| P | 1233 | 4.4% |
| M | 1057 | 3.8% |
| E | 1043 | 3.7% |
| Other values (20) | 6784 |
Other Punctuation
| Value | Count | Frequency (%) |
| , | 15372 | |
| . | 12817 | |
| ' | 6511 | |
| ; | 1661 | 4.3% |
| / | 859 | 2.2% |
| : | 542 | 1.4% |
| ? | 465 | 1.2% |
| % | 364 | 0.9% |
| * | 14 | < 0.1% |
| · | 8 | < 0.1% |
| Other values (3) | 12 | < 0.1% |
Decimal Number
| Value | Count | Frequency (%) |
| 1 | 4750 | |
| 0 | 3828 | |
| 2 | 3617 | |
| 3 | 1623 | 8.4% |
| 4 | 1547 | 8.0% |
| 5 | 1358 | 7.1% |
| 6 | 1034 | 5.4% |
| 8 | 564 | 2.9% |
| 7 | 546 | 2.8% |
| 9 | 351 | 1.8% |
Control
| Value | Count | Frequency (%) |
| 1691 | ||
| | 309 | 13.9% |
| | 91 | 4.1% |
| | 43 | 1.9% |
| | 43 | 1.9% |
| | 42 | 1.9% |
| | 2 | 0.1% |
| | 2 | 0.1% |
| | 1 | < 0.1% |
Math Symbol
| Value | Count | Frequency (%) |
| | | 838 | |
| < | 109 | 9.2% |
| + | 79 | 6.6% |
| > | 73 | 6.1% |
| = | 55 | 4.6% |
| × | 32 | 2.7% |
| ± | 3 | 0.3% |
Close Punctuation
| Value | Count | Frequency (%) |
| ) | 7888 | |
| ] | 74 | 0.9% |
| } | 3 | < 0.1% |
Open Punctuation
| Value | Count | Frequency (%) |
| ( | 7709 | |
| [ | 74 | 1.0% |
| { | 3 | < 0.1% |
Space Separator
| Value | Count | Frequency (%) |
| 416957 | ||
| 4 | < 0.1% |
Other Number
| Value | Count | Frequency (%) |
| ¼ | 5 | |
| ½ | 3 |
Dash Punctuation
| Value | Count | Frequency (%) |
| - | 4607 |
Other Symbol
| Value | Count | Frequency (%) |
| ° | 184 |
Final Punctuation
| Value | Count | Frequency (%) |
| » | 16 |
Initial Punctuation
| Value | Count | Frequency (%) |
| « | 16 |
Connector Punctuation
| Value | Count | Frequency (%) |
| _ | 7 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Latin | 2162542 | |
| Common | 498840 | 18.7% |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| e | 279145 | |
| t | 187596 | 8.7% |
| n | 172833 | 8.0% |
| a | 167460 | 7.7% |
| i | 167193 | 7.7% |
| o | 150090 | 6.9% |
| r | 143196 | 6.6% |
| s | 128495 | 5.9% |
| d | 93847 | 4.3% |
| c | 90389 | 4.2% |
| Other values (65) | 582298 |
Common
| Value | Count | Frequency (%) |
| 416957 | ||
| , | 15372 | 3.1% |
| . | 12817 | 2.6% |
| ) | 7888 | 1.6% |
| ( | 7709 | 1.5% |
| ' | 6511 | 1.3% |
| 1 | 4750 | 1.0% |
| - | 4607 | 0.9% |
| 0 | 3828 | 0.8% |
| 2 | 3617 | 0.7% |
| Other values (45) | 14784 | 3.0% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 2636878 | |
| None | 24504 | 0.9% |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 416957 | ||
| e | 279145 | 10.6% |
| t | 187596 | 7.1% |
| n | 172833 | 6.6% |
| a | 167460 | 6.4% |
| i | 167193 | 6.3% |
| o | 150090 | 5.7% |
| r | 143196 | 5.4% |
| s | 128495 | 4.9% |
| d | 93847 | 3.6% |
| Other values (78) | 730066 |
None
| Value | Count | Frequency (%) |
| é | 16624 | |
| à | 2768 | 11.3% |
| è | 1967 | 8.0% |
| ê | 560 | 2.3% |
| ä | 336 | 1.4% |
| | 309 | 1.3% |
| ç | 250 | 1.0% |
| ü | 236 | 1.0% |
| î | 203 | 0.8% |
| ô | 188 | 0.8% |
| Other values (32) | 1063 | 4.3% |
Title (Original language)
Categorical
HIGH CARDINALITY  UNIFORM 
| Distinct | 2756 |
|---|---|
| Distinct (%) | 99.0% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 319.0 KiB |
| Semiconductor device | 7 |
|---|---|
| Light emitting device | 4 |
| Display device | 3 |
| User interface system | 3 |
| Liquid crystal display device | 3 |
| Other values (2751) |
Length
| Max length | 244 |
|---|---|
| Median length | 143 |
| Mean length | 60.275144 |
| Min length | 4 |
Characters and Unicode
| Total characters | 167806 |
|---|---|
| Distinct characters | 72 |
| Distinct categories | 9 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 2 ? |
Unique
| Unique | 2738 ? |
|---|---|
| Unique (%) | 98.3% |
Sample
| 1st row | Steam appliance |
|---|---|
| 2nd row | Dual frequency hub mounted vibration suppressor system |
| 3rd row | Carrier particles for use in dry powder inhalers |
| 4th row | Method for producing dendritic cells |
| 5th row | Enciphering apparatus and method, deciphering apparatus and method as well as information processing apparatus and method |
Common Values
| Value | Count | Frequency (%) |
| Semiconductor device | 7 | 0.3% |
| Light emitting device | 4 | 0.1% |
| Display device | 3 | 0.1% |
| User interface system | 3 | 0.1% |
| Liquid crystal display device | 3 | 0.1% |
| Inhaler | 2 | 0.1% |
| Semiconductor device and semiconductor device manufacturing method | 2 | 0.1% |
| Conversion of HF alkylation units for ionic liquid catalyzed alkylation processes | 2 | 0.1% |
| Semiconductor device and manufacturing method thereof | 2 | 0.1% |
| Semiconductor package | 2 | 0.1% |
| Other values (2746) | 2754 |
Length
| Value | Count | Frequency (%) |
| and | 1473 | 6.4% |
| for | 1135 | 5.0% |
| method | 848 | 3.7% |
| of | 629 | 2.8% |
| a | 575 | 2.5% |
| device | 488 | 2.1% |
| system | 480 | 2.1% |
| apparatus | 386 | 1.7% |
| with | 290 | 1.3% |
| the | 277 | 1.2% |
| Other values (4587) | 16269 |
Most occurring characters
| Value | Count | Frequency (%) |
| 20066 | ||
| e | 15264 | 9.1% |
| i | 12091 | 7.2% |
| a | 11983 | 7.1% |
| t | 11851 | 7.1% |
| o | 11420 | 6.8% |
| n | 11264 | 6.7% |
| r | 10051 | 6.0% |
| s | 8350 | 5.0% |
| c | 6774 | 4.0% |
| Other values (62) | 48692 |
Most occurring categories
| Value | Count | Frequency (%) |
| Lowercase Letter | 142960 | |
| Space Separator | 20066 | 12.0% |
| Uppercase Letter | 3449 | 2.1% |
| Dash Punctuation | 608 | 0.4% |
| Other Punctuation | 572 | 0.3% |
| Decimal Number | 86 | 0.1% |
| Close Punctuation | 32 | < 0.1% |
| Open Punctuation | 32 | < 0.1% |
| Control | 1 | < 0.1% |
Most frequent character per category
Lowercase Letter
| Value | Count | Frequency (%) |
| e | 15264 | |
| i | 12091 | 8.5% |
| a | 11983 | 8.4% |
| t | 11851 | 8.3% |
| o | 11420 | 8.0% |
| n | 11264 | 7.9% |
| r | 10051 | 7.0% |
| s | 8350 | 5.8% |
| c | 6774 | 4.7% |
| d | 6411 | 4.5% |
| Other values (16) | 37501 |
Uppercase Letter
| Value | Count | Frequency (%) |
| M | 561 | |
| S | 425 | |
| C | 273 | 7.9% |
| D | 257 | 7.5% |
| P | 238 | 6.9% |
| A | 211 | 6.1% |
| I | 175 | 5.1% |
| E | 165 | 4.8% |
| L | 152 | 4.4% |
| T | 143 | 4.1% |
| Other values (15) | 849 |
Decimal Number
| Value | Count | Frequency (%) |
| 3 | 23 | |
| 1 | 21 | |
| 2 | 16 | |
| 0 | 8 | 9.3% |
| 4 | 4 | 4.7% |
| 5 | 4 | 4.7% |
| 9 | 3 | 3.5% |
| 7 | 3 | 3.5% |
| 8 | 2 | 2.3% |
| 6 | 2 | 2.3% |
Other Punctuation
| Value | Count | Frequency (%) |
| , | 511 | |
| / | 48 | 8.4% |
| ' | 5 | 0.9% |
| . | 5 | 0.9% |
| ? | 2 | 0.3% |
| : | 1 | 0.2% |
Space Separator
| Value | Count | Frequency (%) |
| 20066 |
Dash Punctuation
| Value | Count | Frequency (%) |
| - | 608 |
Close Punctuation
| Value | Count | Frequency (%) |
| ) | 32 |
Open Punctuation
| Value | Count | Frequency (%) |
| ( | 32 |
Control
| Value | Count | Frequency (%) |
| | 1 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Latin | 146409 | |
| Common | 21397 | 12.8% |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| e | 15264 | 10.4% |
| i | 12091 | 8.3% |
| a | 11983 | 8.2% |
| t | 11851 | 8.1% |
| o | 11420 | 7.8% |
| n | 11264 | 7.7% |
| r | 10051 | 6.9% |
| s | 8350 | 5.7% |
| c | 6774 | 4.6% |
| d | 6411 | 4.4% |
| Other values (41) | 40950 |
Common
| Value | Count | Frequency (%) |
| 20066 | ||
| - | 608 | 2.8% |
| , | 511 | 2.4% |
| / | 48 | 0.2% |
| ) | 32 | 0.1% |
| ( | 32 | 0.1% |
| 3 | 23 | 0.1% |
| 1 | 21 | 0.1% |
| 2 | 16 | 0.1% |
| 0 | 8 | < 0.1% |
| Other values (11) | 32 | 0.1% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 167805 | |
| None | 1 | < 0.1% |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 20066 | ||
| e | 15264 | 9.1% |
| i | 12091 | 7.2% |
| a | 11983 | 7.1% |
| t | 11851 | 7.1% |
| o | 11420 | 6.8% |
| n | 11264 | 6.7% |
| r | 10051 | 6.0% |
| s | 8350 | 5.0% |
| c | 6774 | 4.0% |
| Other values (61) | 48691 |
None
| Value | Count | Frequency (%) |
| | 1 |
Claims
Categorical
HIGH CARDINALITY  UNIFORM  UNIQUE 
| Distinct | 2784 |
|---|---|
| Distinct (%) | 100.0% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 17.1 MiB |
| The invention claimed is: 1. A steam cleaning appliance, comprising: a steam generation unit; a steam cleaning applicator; and a flexible steam conduit configured to guide steam from the steam generation unit to a steam inlet for the steam cleaning applicator; wherein the steam cleaning applicator is connectable to the steam conduit; the steam cleaning applicator is rotatable relative to the steam conduit in either rotational direction without loosening the connection of the steam applicator to the steam conduit; the steam cleaning applicator has an end-to-end direction and the steam cleaning applicator is rotatable by at least 360 degrees relative to the steam conduit in either rotational direction about the end-to-end direction of the steam cleaning applicator, without loosening the connection of the steam cleaning applicator to the steam conduit. 2. A steam cleaning appliance as in claim 1, wherein the steam applicator is connectable to the steam conduit via a handle. 3. A steam cleaning appliance as in claim 2, wherein the handle has an end-to-end direction, and the handle is rotatable relative to the steam conduit about the end-to-end direction of the handle in either rotational direction without loosening the connection of the steam cleaning applicator to the steam conduit. 4. A steam cleaning appliance as in claim 1, wherein the steam cleaning applicator is repeatedly rotatable relative to the steam conduit in either rotational direction about an end-to-end direction of the steam cleaning applicator without loosening the connection of the steam cleaning applicator to the steam conduit. 5. A steam cleaning appliance as in claim 1, wherein the steam cleaning applicator is connectable to the steam conduit with a tool-free connection. 6. A steam cleaning appliance as in claim 5, wherein at least two distinct user actions are required to remove the steam cleaning applicator from the steam conduit. 7. A steam cleaning appliance as in claim 6, wherein the at least two distinct user actions comprise applying an end-to-end force on a handle relative to the steam conduit, and applying a twisting force on the handle relative to the steam conduit. 8. A steam cleaning appliance as in claim 5, further comprising a connector that is constructed and arranged to permit rotation of the steam cleaning applicator relative to the steam conduit about an end-to-end direction of the steam applicator in either rotational direction without loosening the connection of the steam cleaning applicator to the steam conduit. 9. A steam cleaning appliance as in claim 8, wherein the connector comprises a threaded connector having: (a) an external thread portion positioned on either the steam cleaning applicator or the steam conduit, and (b) an internal thread portion positioned on the other of the steam applicator and the steam conduit. 10. A steam cleaning appliance as in claim 9, wherein: the external thread portion is selectively rotatable relative to whichever of the steam cleaning applicator and the steam conduit that the external thread portion is positioned on, and/or the internal thread portion is selectively rotatable relative to whichever of the steam cleaning applicator and the steam conduit that the internal thread portion is positioned on. 11. A steam cleaning appliance as in claim 10, wherein when a user applies at least a threshold force in an end-to-end direction of a handle of the steam applicator, the selectively rotatable thread portion(s) is prevented from rotating more than 180 degrees in either rotational direction relative to whichever of the steam applicator and the steam conduit that the selectively rotatable thread portion(s) is positioned on, as long as the user continues to apply the at least a threshold force. 12. A steam cleaning appliance as in claim 11, wherein when the at least a threshold force is applied, the at least a threshold force overcomes a force provided by a resilient element. 13. A steam cleaning appliance as in claim 12, wherein the at least a threshold force is transferred to the thread portions of the connector. 14. A steam cleaning appliance as in claim 13, wherein the resilient element comprises a coil spring, and the at least a threshold force compresses the spring such that engagement elements on the selectively rotatable thread portion(s) engage with complementary engagement elements fixed to whichever of the steam cleaning applicator and the steam conduit that the selectively rotatable thread portion(s) is positioned on. 15. A steam cleaning appliance as in claim 14, wherein the internal thread portion is selectively rotatable relative to whichever of the steam cleaning applicator and the steam conduit that the internal thread portion is positioned on. 16. A steam cleaning appliance as in claim 15, wherein the internal thread portion is positioned on the handle of the steam cleaning applicator. 17. A steam cleaning appliance as in claim 1, wherein the steam conduit comprises a flexible hose. 18. A steam cleaning appliance as in claim 1, wherein the steam cleaning applicator includes a handle that is connected to the steam conduit. 19. A steam cleaning appliance as in claim 2, wherein the handle is detachably connectable to the steam applicator. | 1 |
|---|---|
| What is claimed is: 1. A printed substrate manufacturing method of forming solder bumps on a plurality of electrode parts of a printed substrate and mounting a semiconductor chip on the printed substrate via the plurality of solder bumps, comprising: preparing a thermoplastic film to be used as an underfill that covers a surface of the printed substrate on which the solder bumps are formed, wherein parts of the film corresponding to the solder bumps are removed and a peripheral edge of a part of the film on which the semiconductor chip will be mounted has a protruded form for preventing movement of the semiconductor chip on the printed substrate; covering the printed substrate with the film and thereafter bonding the film onto the printed substrate, wherein the parts of the film corresponding to the solder bumps are removed before covering the printed substrate with the film; mounting the semiconductor chip on the printed substrate and carrying the printed substrate into a reflow furnace; and bonding by applying heat and pressure to fuse the solder bumps in the reflow furnace. 2. A method of manufacturing a printed substrate comprising steps of: preparing an underfill film by forming a plurality of holes through the film and forming at least one protruded form on a peripheral edge of the film, wherein the at least one protruded form is disposed on a first surface of the film, and the at least one protruded form extends away from the first surface of the film; after preparing the film, covering a printed substrate with the film by aligning a plurality of solder bumps on the printed substrate with the plurality of holes through the film and thereafter bonding the film onto the printed substrate; placing a semiconductor chip on the printed substrate via the plurality of solder bumps and carrying the printed substrate into a reflow furnace; and applying heat and pressure in the reflow furnace to adhere the semiconductor chip to the printed substrate. 3. The method of manufacturing a printed substrate according to claim 2, wherein the step of preparing the film further comprises drawing the film from a film roll, cutting the film to a predetermined size, and drilling the plurality of holes through the film. 4. The printed substrate manufacturing method according to claim 2, wherein a second surface of the film faces the printed substrate after covering the printed substrate with the film, and the second surface of the film forms one side of the film and the first surface of the film forms an opposite side of the film. | 1 |
| The invention claimed is: 1. A system for filtering particulate matter from exhaust gas, said system comprising: a porous structure having substrate pores of a first mean pore size; a selective catalytic reduction (SCR) washcoat disposed on a surface of the porous structure or within the porous structure to define pores of a second mean pore size; and the second mean pore size is less than the first mean pore size; wherein said washcoat comprises a small pore zeolite promoted with at least one metal selected from the group consisting of Cr, Co, Cu, Fe, Hf, La, Ce, In, V, Mn, Ni, Zn, Ga, Ag, Au, Pt, Pd, and Rh; a NO xabsorber catalyst disposed upstream of the washcoat. 2. A system according to claim 1, wherein the washcoat is disposed within the porous structure. 3. A system according to claim 1, wherein the transition metal is selected from the group consisting of Cu, Fe, and Ce. 4. A system according to claim 1, wherein the zeolite has a CHA framework structure. 5. A system according to claim 4, wherein the transition metal consists of Cu. 6. A system according to claim 1, the porous structure is a ceramic wallflow filter. 7. A system according to claim 1, wherein: the porous structure has substrate pores; and the SCR washcoat is one or more layers substantially covering the substrate pores at the inlet surfaces. 8. A system according to claim 1, wherein: the washcoat is present on the inlet surfaces; and the NOxabsorber catalyst is disposed upstream of the porous structure. | 1 |
| The invention claimed is: 1. A low back pain treatment tool comprising: a cylindrical casing elongated in a longitudinal direction; a coccyx contact treatment member which is placed through an elastic member so as to be slidably movable in an axial direction of the cylindrical casing; a coccyx contact buffering member which is provided on an upper end of the coccyx contact treatment member; a posture holding member which has a posture holding surface in a longitudinal direction, which faces the cylindrical casing; and a handle fixed to which the posture holding member. 2. The low back pain treatment tool according to claim 1, wherein the cylindrical casing is fixed and supported on the posture holding member by fixing a horizontal seat plate vertically with respect to the posture holding surface and coupling a lower end of the cylindrical casing to an upper surface of the horizontal seat plate. 3. The low back pain treatment tool according to claim 1, wherein the cylindrical casing is fixed and supported on the posture holding member by fixing the posture holding member on a horizontal base plate, fixing a pair of left and right side plates orthogonally to a horizontal surface of the base plate and the posture holding surface, and attaching a horizontal seat plate between the side plates. 4. A low back pain treatment tool comprising: a cylindrical casing elongated in a longitudinal direction; a coccyx contact treatment member which is slidably placed through an elastic member in an axial direction of the cylindrical casing; a coccyx contact buffering member which is provided on an upper end of the coccyx contact treatment member; a posture holding member having a posture holding surface in a longitudinal direction, which faces the cylindrical casing; a handle fixed to the posture holding member; a horizontal seat plate which fixes and supports the cylindrical casing on the posture holding member by being fixed vertically with respect to the posture holding surface and coupling a lower end of the cylindrical casing to an upper surface of the horizontal seat plate; a horizontal base plate which fixes the posture holding member; a pair of left and right side plates which are fixed orthogonally to a horizontal surface of the base plate and the posture holding surface, and which support left and right sides of the horizontal base plate respectively; corner portions formed by an outer surface of either of the side plates, the posture holding surface, and a horizontal surface of the base plate; and rectangular parallelepiped foot rest blocks which are detachably placed at the corner portions. | 1 |
| What is claimed is: 1. A fail detecting device for a rotation angle sensor, comprising: a cam with a continuously formed cam surface having an actuating surface for reciprocating a push rod and a non-actuating surface that does not reciprocate the push rod, an angle sensor formed of an endless rotary potentiometer for detecting a rotation angle of the cam and having an output voltage increasing in proportion to the rotational angle in a range of 360 degrees, and a controller for detecting a fail state of the angle sensor, said cam is configured to be driven to rotate in one direction by an electric motor controlled by the controller and to reciprocate the push rod; the output voltage of the angle sensor detects: a first region equal to or lower than a first predetermined voltage from 0 degrees to an angle ? 1, and a second region equal to or higher than a second predetermined voltage higher than the first predetermined voltage from 360 degrees to an angle ? 2, said first and second regions being recognized as a dead zone; the controller is configured to drive the rotation of the cam to a predetermined position in the non-actuating surface at a constant speed in transition of the cam surface of the cam abutting against the push rod from a side of the actuating surface to a side of the non-actuating surface; and the angle sensor is configured wherein the dead zone is disposed at a position in the non-actuating surface of the cam and in an area in front of the predetermined position. 2. The fail detecting device for a rotation angle sensor according to claim 1, wherein the controller measures an elapsed time from transition of the cam surface to the dead zone by a timer and determines that the rotation angle sensor is in a fail state if the dead zone is detected although an estimated time of passage through the dead zone has elapsed. 3. The fail detecting device for a rotation angle sensor according to claim 2, wherein the controller stores the output voltage of timing to transition to the dead zone as a saved value and determines that the rotation angle sensor is in the fail state if the output voltage is the same as the saved value although an estimated time of passage through the dead zone has elapsed and a predetermined time has elapsed in this state. 4. The fail detecting device for a rotation angle sensor according to claim 2, wherein the controller determines that the rotation angle sensor is in the fail state if the output voltage is outside a range between upper and lower limits set in advance although an estimated time of passage through the dead zone has elapsed and a predetermined time has elapsed in this state. 5. The fail detecting device for a rotation angle sensor according to claim 2, wherein the controller stores a sensor value of timing to transition to the dead zone as a saved value and determines that the rotation angle sensor is in the fail state if the output voltage is not a value corresponding to the predetermined position in the non-actuating surface although an estimated time of passage through the dead zone has elapsed. 6. The fail detecting device for a rotation angle sensor according to claim 1, wherein the controller measures an elapsed time from transition of the cam surface from the actuating surface to the non-actuating surface by a timer and determines that the rotation angle sensor is in a fail state if the dead zone is detected although an estimated time of passage through the dead zone has elapsed. 7. The fail detecting device for a rotation angle sensor according to claim 6, wherein the controller stores the output voltage of timing to transition to the dead zone as a saved value and determines that the rotation angle sensor is in the fail state if the output voltage is the same as the saved value although an estimated time of passage through the dead zone has elapsed and a predetermined time has elapsed in this state. 8. The fail detecting device for a rotation angle sensor according to claim 6, wherein the controller determines that the rotation angle sensor is in the fail state if the output voltage is outside a range between upper and lower limits set in advance although an estimated time of passage through the dead zone has elapsed and a predetermined time has elapsed in this state. 9. The fail detecting device for a rotation angle sensor according to claim 6, wherein the controller stores a sensor value of timing to transition to the dead zone as a saved value and determines that the rotation angle sensor is in the fail state if the output voltage is not a value corresponding to the predetermined position in the non-actuating surface although an estimated time of passage through the dead zone has elapsed. 10. The fail detecting device for a rotation angle sensor according to claim 1, wherein the dead zone is positioned corresponding to 0 degrees as the angle of rotation with a range of ?1 to-?2 defining the dead zone and with the area ?1 to 90 degrees defining a standby area and with the area ?2 to 270 degrees defining a bridge area. 11. A fail detecting device for a rotation angle sensor comprising: a cam having a continuously formed cam surface with an actuating surface for imparting motion to reciprocates a push rod and a non-actuating surface that does not impart motion to reciprocate the push rod; an angle sensor formed of an endless rotary potentiometer for detecting an angle of rotation of the cam and having an output voltage increasing in proportion to the rotational angle in a range of 360 degrees; a controller for detecting a fail state of the angle sensor; said cam being configured to be driven to rotate in one direction by a motor controlled by the controller to reciprocate the push rod; and the output voltage of the angle sensor detects: a first region equal to or lower than a first predetermined voltage from 0 degrees to an angle ? 1, and a second region equal to or higher than a second predetermined voltage higher than the first predetermined voltage from 360 degrees to an angle ? 2, said dead zone is defined by the first and second regions; said controller being configured to drive the rotation of the cam to a predetermined position relative to the non-actuating surface at a constant speed in transition of the cam surface of the cam abutting against the push rod from a side of the actuating surface to a side of the non-actuating surface; said angle sensor being configured wherein the dead zone is disposed at a position in the non-actuating surface of the cam and in an area in front of the predetermined position. 12. The fail detecting device for a rotation angle sensor according to claim 11, wherein the controller measures an elapsed time from transition of the cam surface to the dead zone by a timer and determines that the rotation angle sensor is in a fail state if the dead zone is detected although an estimated time of passage through the dead zone has elapsed. 13. The fail detecting device for a rotation angle sensor according to claim 12, wherein the controller stores the output voltage of timing to transition to the dead zone as a saved value and determines that the rotation angle sensor is in the fail state if the output voltage is the same as the saved value although an estimated time of passage through the dead zone has elapsed and a predetermined time has elapsed in this state. 14. The fail detecting device for a rotation angle sensor according to claim 12, wherein the controller determines that the rotation angle sensor is in the fail state if the output voltage is outside a range between upper and lower limits set in advance although an estimated time of passage through the dead zone has elapsed and a predetermined time has elapsed in this state. 15. The fail detecting device for a rotation angle sensor according to claim 12, wherein the controller stores a sensor value of timing to transition to the dead zone as a saved value and determines that the rotation angle sensor is in the fail state if the output voltage is not a value corresponding to the predetermined position in the non-actuating surface although an estimated time of passage through the dead zone has elapsed. 16. The fail detecting device for a rotation angle sensor according to claim 11, wherein the controller measures an elapsed time from transition of the cam surface from the actuating surface to the non-actuating surface by a timer and determines that the rotation angle sensor is in a fail state if the dead zone is detected although an estimated time of passage through the dead zone has elapsed. 17. The fail detecting device for a rotation angle sensor according to claim 16, wherein the controller stores the output voltage of timing to transition to the dead zone as a saved value and determines that the rotation angle sensor is in the fail state if the output voltage is the same as the saved value although an estimated time of passage through the dead zone has elapsed and a predetermined time has elapsed in this state. 18. The fail detecting device for a rotation angle sensor according to claim 16, wherein the controller determines that the rotation angle sensor is in the fail state if the output voltage is outside a range between upper and lower limits set in advance although an estimated time of passage through the dead zone has elapsed and a predetermined time has elapsed in this state. 19. The fail detecting device for a rotation angle sensor according to claim 16, wherein the controller stores a sensor value of timing to transition to the dead zone as a saved value and determines that the rotation angle sensor is in the fail state if the output voltage is not a value corresponding to the predetermined position in the non-actuating surface although an estimated time of passage through the dead zone has elapsed. 20. The fail detecting device for a rotation angle sensor according to claim 11, wherein the dead zone is positioned corresponding to 0 degrees as the angle of rotation with a range of ?1 to-?2 defining the dead zone and with the area ?1 to 90 degrees defining a standby area and with the area ?2 to 270 degrees defining a bridge area. | 1 |
| Other values (2779) |
Length
| Max length | 31652 |
|---|---|
| Median length | 6370 |
| Mean length | 6371.2399 |
| Min length | 334 |
Characters and Unicode
| Total characters | 17737532 |
|---|---|
| Distinct characters | 110 |
| Distinct categories | 14 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 2 ? |
Unique
| Unique | 2784 ? |
|---|---|
| Unique (%) | 100.0% |
Sample
| 1st row | The invention claimed is: 1. A steam cleaning appliance, comprising: a steam generation unit; a steam cleaning applicator; and a flexible steam conduit configured to guide steam from the steam generation unit to a steam inlet for the steam cleaning applicator; wherein the steam cleaning applicator is connectable to the steam conduit; the steam cleaning applicator is rotatable relative to the steam conduit in either rotational direction without loosening the connection of the steam applicator to the steam conduit; the steam cleaning applicator has an end-to-end direction and the steam cleaning applicator is rotatable by at least 360 degrees relative to the steam conduit in either rotational direction about the end-to-end direction of the steam cleaning applicator, without loosening the connection of the steam cleaning applicator to the steam conduit. 2. A steam cleaning appliance as in claim 1, wherein the steam applicator is connectable to the steam conduit via a handle. 3. A steam cleaning appliance as in claim 2, wherein the handle has an end-to-end direction, and the handle is rotatable relative to the steam conduit about the end-to-end direction of the handle in either rotational direction without loosening the connection of the steam cleaning applicator to the steam conduit. 4. A steam cleaning appliance as in claim 1, wherein the steam cleaning applicator is repeatedly rotatable relative to the steam conduit in either rotational direction about an end-to-end direction of the steam cleaning applicator without loosening the connection of the steam cleaning applicator to the steam conduit. 5. A steam cleaning appliance as in claim 1, wherein the steam cleaning applicator is connectable to the steam conduit with a tool-free connection. 6. A steam cleaning appliance as in claim 5, wherein at least two distinct user actions are required to remove the steam cleaning applicator from the steam conduit. 7. A steam cleaning appliance as in claim 6, wherein the at least two distinct user actions comprise applying an end-to-end force on a handle relative to the steam conduit, and applying a twisting force on the handle relative to the steam conduit. 8. A steam cleaning appliance as in claim 5, further comprising a connector that is constructed and arranged to permit rotation of the steam cleaning applicator relative to the steam conduit about an end-to-end direction of the steam applicator in either rotational direction without loosening the connection of the steam cleaning applicator to the steam conduit. 9. A steam cleaning appliance as in claim 8, wherein the connector comprises a threaded connector having: (a) an external thread portion positioned on either the steam cleaning applicator or the steam conduit, and (b) an internal thread portion positioned on the other of the steam applicator and the steam conduit. 10. A steam cleaning appliance as in claim 9, wherein: the external thread portion is selectively rotatable relative to whichever of the steam cleaning applicator and the steam conduit that the external thread portion is positioned on, and/or the internal thread portion is selectively rotatable relative to whichever of the steam cleaning applicator and the steam conduit that the internal thread portion is positioned on. 11. A steam cleaning appliance as in claim 10, wherein when a user applies at least a threshold force in an end-to-end direction of a handle of the steam applicator, the selectively rotatable thread portion(s) is prevented from rotating more than 180 degrees in either rotational direction relative to whichever of the steam applicator and the steam conduit that the selectively rotatable thread portion(s) is positioned on, as long as the user continues to apply the at least a threshold force. 12. A steam cleaning appliance as in claim 11, wherein when the at least a threshold force is applied, the at least a threshold force overcomes a force provided by a resilient element. 13. A steam cleaning appliance as in claim 12, wherein the at least a threshold force is transferred to the thread portions of the connector. 14. A steam cleaning appliance as in claim 13, wherein the resilient element comprises a coil spring, and the at least a threshold force compresses the spring such that engagement elements on the selectively rotatable thread portion(s) engage with complementary engagement elements fixed to whichever of the steam cleaning applicator and the steam conduit that the selectively rotatable thread portion(s) is positioned on. 15. A steam cleaning appliance as in claim 14, wherein the internal thread portion is selectively rotatable relative to whichever of the steam cleaning applicator and the steam conduit that the internal thread portion is positioned on. 16. A steam cleaning appliance as in claim 15, wherein the internal thread portion is positioned on the handle of the steam cleaning applicator. 17. A steam cleaning appliance as in claim 1, wherein the steam conduit comprises a flexible hose. 18. A steam cleaning appliance as in claim 1, wherein the steam cleaning applicator includes a handle that is connected to the steam conduit. 19. A steam cleaning appliance as in claim 2, wherein the handle is detachably connectable to the steam applicator. |
|---|---|
| 2nd row | What is claimed is: 1. A vibration suppressor system for reducing vibrations in a rotating system, comprising: an annular electric motor system provided about an axis of rotation of the rotating system, said annular electric motor system including an annular bearing and a first mass supported within said annular bearing, said first mass guided about said axis of rotation by said annular bearing, wherein said first mass is eccentric, said first mass including a truck being at least partially conductive, said annular electric motor system further including a stator axially spaced-apart, relative to said axis of rotation, from said truck; a control system in communication with said annular electric motor system to control rotation of said first mass about said axis of rotation to reduce in-plane vibration of the rotating system; wherein a second mass is supported within said annular bearing, and wherein said second mass is eccentric; and wherein said control system independently controls rotation of said first and second masses about said axis of rotation. 2. The system as recited in claim 1, wherein said first and second masses each include an eccentric mass positioned between said annular bearing. 3. The system as recited in claim 1, wherein said first and second masses are configured to rotate about said axis of rotation, and wherein a majority of the mass of each of said first and second masses is radially disposed on one side of said axis of rotation. 4. The system as recited in claim 1, wherein said first and second masses each include trucks, and wherein said trucks are eccentric. 5. The system as recited in claim 1, further comprising: a rotor system having an N number of blades which rotates about an axis of rotation at a rotational speed of 1P, such that said rotor system produces NP vibrations; a sensor system which senses the NP vibrations; and wherein said control system is in communication with said sensor system, said control system operable to identify variations of the NP vibrations to control an angular velocity of each of said first mass and said second mass to reduce the NP in-plane rotor system vibrations. 6. The system as recited in claim 5, further comprising a generator driven by said rotor system. 7. The system as recited in claim 6, wherein a phase of the voltage from said generator provides a phase reference to said control system indicative of a rotational speed of said rotor system. 8. The system as recited in claim 1, wherein said axis of rotation intersects said first mass. 9. A vibration suppressor system for reducing vibrations in a rotating system, comprising: an annular electric motor system provided about an axis of rotation of the rotating system, said annular electric motor system including an annular bearing and a first mass supported within said annular bearing, said first mass guided about said axis of rotation by said annular bearing, wherein said first mass is eccentric, and wherein said axis of rotation intersects said first mass; and a control system in communication with said annular electric motor system to control rotation of said first mass about said axis of rotation to reduce in-plane vibration of the rotating system; wherein a second mass is supported within said annular bearing, wherein said second mass is eccentric, and wherein said axis of rotation intersects said second mass; and wherein said control system independently controls rotation of said first and second masses about said axis of rotation. 10. The system as recited in claim 9, wherein said first and second masses each include trucks, and wherein said trucks are eccentric. 11. The system as recited in claim 10, wherein said axis of rotation intersects said trucks. 12. A vibration suppressor system for reducing vibrations in a rotating system, comprising: an annular electric motor system provided about an axis of rotation of the rotating system, said annular electric motor system including an annular bearing and first and second masses supported within said annular bearing, said first and second masses guided about said axis of rotation by said annular bearing, wherein said first and second masses are eccentric, said first and second masses each including a truck which is at least partially conductive, said annular electric motor system further including at least one stator axially spaced-apart, relative to said axis of rotation, from said trucks; a control system in communication with said annular electric motor system to control rotation of said first and second masses about said axis of rotation to reduce in-plane vibration of the rotating system; and wherein said first and second masses are disk-shaped and each span substantially an entirety of an inner diameter of said annular bearing. |
| 3rd row | The invention claimed is: 1. A powder for use in a dry powder inhaler, the powder comprising active particles and carrier particles for carrying the active particles, the powder further including particles of additive material attached to the surfaces of the carrier particles, wherein particles of additive material adhere to the high energy sites on the surfaces of the carrier particles and wherein the powder comprises more than one additive material, wherein the additive material includes one or more surface active materials; wherein additive particles are also present as agglomerates and act as carriers of the active particles and are separate from or separable from the surfaces of the carrier particles with active particles attached to surfaces of the agglomerates. 2. A powder according to claim 1 wherein the powder includes not more than 5% by weight of additive material based on the weight of the powder. 3. A powder according to claim 2 wherein the powder includes not more than 2% by weight of additive material based on the weight of the powder. 4. A powder according to 1 wherein the carrier particles are comprised of one or more crystalline sugars. 5. A powder according to claim 4 wherein the carrier particles are particles of lactose. 6. A powder according to claim 1 wherein the additive material consists of physiologically acceptable material. 7. A powder according to claim 1, wherein the additive material is an anti-adherent material. 8. A powder according to claim 1, wherein the additive material is an anti-friction agent. 9. A powder according to claim 1, wherein the additive material includes magnesium stearate. 10. A powder according to claim 1, wherein the additive particles are angular or dendritic in shape. 11. A powder according to claim 1, wherein the additive particles are plate-like particles. 12. A powder according to claim 1, wherein the powder consists of not less than 0.1% by weight of additive particles based on the weight of the carrier particles. 13. A powder according to claim 1, wherein the additive material forms a discontinuous covering on the surfaces of the carrier particles. 14. A powder according to claim 1, wherein the active particles include a ?2-agonist. 15. A method of producing particles according to claim 1, the method including the step of mixing carrier particles of a size suitable for use in dry powder inhalers with additive material which becomes attached to the surfaces of the carrier particles. 16. A method according to claim 15 wherein the method further includes the step of treating the carrier particles to dislodge small grains from the surfaces of the carrier particles, without substantially changing the size of the carrier particles during the treatment. 17. A method according to claim 16 wherein the small grains become reattached to the surfaces of the carrier particles. 18. A powder for use in a dry powder inhaler, the powder including additive and carrier particles for carrying the additive particles, the powder further including active particles which adhere to the additive particles on the carrier particles, wherein the additive material is magnesium stearate, wherein the additive material is present in an amount of not more than 1% by weight based on the weight of the powder; wherein additive particles are also present as agglomerates and act as carriers of the active particles and are separate from or separable from the surfaces of the carrier particles with active particles attached to surfaces of the agglomerates. 19. A powder according to claim 1, wherein the more than one additive material comprises magnesium stearate. 20. A powder according to claim 1, wherein the additive particles are non-spherical. 21. A powder according to claim 20, wherein the particles are plate-like, angular or dendritic. 22. A powder according to claim 18, wherein the additive particles are non-spherical. 23. A powder according to claim 22, wherein the particles are plate-like, angular or dendritic. 24. A powder for use in a dry powder inhaler, the powder comprising: active particles; carrier particles for carrying the active particles; and particles of additive material attached to surfaces of the carrier particles; wherein the particles of additive material adhere to high energy sites on the surfaces of the carrier particles and provide a discontinuous covering for the carrier particles, wherein the powder comprises more than one additive material in the form of a powder, and wherein the additive material includes one or more surface active materials; wherein additive particles are also present as agglomerates and act as carriers of the active particles and are separate from or separable from the surfaces of the carrier particles with active particles attached to surfaces of the agglomerates. |
| 4th row | The invention claimed is: 1. A method of assessing the effect of a gene on a cultured dendritic cell, the method comprising: providing a genetically modified cultured es dendritic cell (esDC) expressing a heterologous gene, wherein the genetically modified cultured esDC is a dendritic cell that is obtained by culturing an embryonic stem cell in vitro; providing a cultured es dendritic cell (esDC), wherein the cultured esDC is a dendritic cell that is obtained by culturing an embryonic stem cell in vitro, wherein the cultured esDC is not genetically modified to express the heterologous gene; and assessing an effect of the heterologous gene on the genetically modified cultured esDC by comparing the genetically modified cultured esDC to the cultured esDC. 2. The method of claim 1, wherein the genetically modified cultured esDC and the cultured esDC are human esDC. 3. The method of claim 1, wherein genetically modified cultured esDC and the cultured esDC are mouse esDC. 4. The method of claim 1, wherein the heterologous gene encodes a protein which has an immunomodulatory effect. 5. The method of claim 1, wherein the heterologous gene encodes a cell surface receptor. 6. The method of claim 1, wherein the heterologous gene encodes Fas-ligand. 7. The method of claim 1, wherein the heterologous gene encodes a dominant negative form of an endogenous protein. 8. The method of claim 1, wherein the heterologous gene encodes an antigen target of the immune system. 9. The method of claim 8, wherein the antigen target of the immune system is an autoantigen. 10. The method of claim 8, wherein the antigen target of the immune system is a tumor antigen. 11. The method of claim 8, wherein the antigen target of the immune system is an antigen from an infectious agent. 12. The method of claim 8, wherein the antigen target of the immune system is a microbial antigen. 13. The method of claim 8, wherein the antigen target of the immune system is a viral antigen. 14. The method of claim 1, wherein the heterologous gene encodes an anti-apoptotic gene. 15. The method of claim 14, wherein the anti-apoptotic gene is FLIP or bcl-2. 16. The method of claim 1, wherein the heterologous gene encodes a fluorescent protein. 17. The method of claim 1, wherein the genetically modified cultured esDC co-expresses two or more heterologous genes. 18. The method of claim 1, wherein the genetically modified cultured esDC comprises one or more endogenous genes that have been inactivated. 19. The method of claim 18, wherein the endogenous gene that has been inactivated is selected from the group consisting of B7-1, IL-12, p35 subunit of IL-12, and the p40 subunit of IL-12. |
| 5th row | What is claimed is: 1. Apparatus for generating a cryptographic key, comprising: a memory storing computer executable instructions which, when executed by a processor, cause the processor to: provide a first key which is derived through an authentication procedure, the first key being based on information generated in another apparatus; provide a second key which is changed during a term that the first key is used; generate the cryptographic key based on the first and second keys, the cryptographic key being changed in accordance with the change of the second key; and a processor programmed to execute the stored instructions to output the cryptographic key. 2. The apparatus of claim 1, wherein said first key and said second key are secret. 3. The apparatus of claim 2, wherein the second key is based on information assigned to each apparatus. 4. The apparatus of claim 1, wherein the first key includes secret information shared with a deciphering apparatus, the second key is derived from a source, and the secret information is a disturbance key to disturb the source of the second key. 5. The apparatus of claim 1, wherein a source of the second key is changed in accordance with a packet. 6. The apparatus of claim 1, wherein the computer-executable instructions further cause the processor to encipher data with the cryptographic key. 7. The apparatus of claim 6, wherein the computer-executable instructions cause the processor to execute an exclusive-or operation of the data with the crytographic key. 8. The apparatus of claim 1, further comprising a sharing unit configured to share the first key using a public key system. 9. The apparatus of claim 8, wherein said sharing unit is configured to share said first key using a Diffie-Hellman key agreement procedure. 10. The apparatus of claim 9, further comprising a first-in-first-out unit used in cryptographic processing. 11. The apparatus of claim 10, further comprising a pseudo-random number generator. 12. The apparatus of claim 11, wherein the pseudo-random number generator includes a linear feedback shift register. 13. Apparatus for generating a cryptographic key, comprising: circuitry configured to generate a cryptographic key based on first and second keys; and a memory storing computer executable instructions which, when executed by a processor, cause the processor to: provide the first key which is derived through an authentication procedure, the first key being based on information generated in another apparatus; and provide the second key which is changed during a term that the first key is used. 14. The apparatus of claim 13, wherein said first key and said second key are secret. 15. The apparatus of claim 14, wherein the second key is based on information assigned to each apparatus. 16. The apparatus of claim 13, wherein the first key includes secret information shared with a deciphering apparatus, the second key is derived from a source, and the secret information is a disturbance key to disturb the source of the second key. 17. The apparatus of claim 13, wherein a source of the second key is changed in accordance with a packet. 18. The apparatus of claim 13, wherein the computer-executable instructions further cause the processor to encipher data with the cryptographic key. 19. The apparatus of claim 18, wherein the computer-executable instructions cause the processor to execute an exclusive-or operation of the data with the crytographic key. 20. The apparatus of claim 13, further comprising a sharing unit configured to share the first key using a public key system. 21. The apparatus of claim 20, wherein said sharing unit is configured to share said first key using a Diffic-Hellman key agreement procedure. 22. The apparatus of claim 21, further comprising a first-in-first-out unit used in cryptographic processing. 23. The apparatus of claim 22, further comprising a pseudo-random number generator. 24. The apparatus of claim 23, wherein the pseudo-random number generator includes a linear feedback shift register. 25. An information processing system comprising: a memory storing computer executable instructions which, when executed by an information processing apparatus, cause the information processing apparatus to: provide a first key which is derived through an authentication procedure, the first key being based on information generated in another apparatus; provide a second key which is changed during a term that the first key is used; and generate the cryptographic key based on the first and second keys, the cryptographic key being changed in accordance with the change of the second key. |
Common Values
| Value | Count | Frequency (%) |
| The invention claimed is: 1. A steam cleaning appliance, comprising: a steam generation unit; a steam cleaning applicator; and a flexible steam conduit configured to guide steam from the steam generation unit to a steam inlet for the steam cleaning applicator; wherein the steam cleaning applicator is connectable to the steam conduit; the steam cleaning applicator is rotatable relative to the steam conduit in either rotational direction without loosening the connection of the steam applicator to the steam conduit; the steam cleaning applicator has an end-to-end direction and the steam cleaning applicator is rotatable by at least 360 degrees relative to the steam conduit in either rotational direction about the end-to-end direction of the steam cleaning applicator, without loosening the connection of the steam cleaning applicator to the steam conduit. 2. A steam cleaning appliance as in claim 1, wherein the steam applicator is connectable to the steam conduit via a handle. 3. A steam cleaning appliance as in claim 2, wherein the handle has an end-to-end direction, and the handle is rotatable relative to the steam conduit about the end-to-end direction of the handle in either rotational direction without loosening the connection of the steam cleaning applicator to the steam conduit. 4. A steam cleaning appliance as in claim 1, wherein the steam cleaning applicator is repeatedly rotatable relative to the steam conduit in either rotational direction about an end-to-end direction of the steam cleaning applicator without loosening the connection of the steam cleaning applicator to the steam conduit. 5. A steam cleaning appliance as in claim 1, wherein the steam cleaning applicator is connectable to the steam conduit with a tool-free connection. 6. A steam cleaning appliance as in claim 5, wherein at least two distinct user actions are required to remove the steam cleaning applicator from the steam conduit. 7. A steam cleaning appliance as in claim 6, wherein the at least two distinct user actions comprise applying an end-to-end force on a handle relative to the steam conduit, and applying a twisting force on the handle relative to the steam conduit. 8. A steam cleaning appliance as in claim 5, further comprising a connector that is constructed and arranged to permit rotation of the steam cleaning applicator relative to the steam conduit about an end-to-end direction of the steam applicator in either rotational direction without loosening the connection of the steam cleaning applicator to the steam conduit. 9. A steam cleaning appliance as in claim 8, wherein the connector comprises a threaded connector having: (a) an external thread portion positioned on either the steam cleaning applicator or the steam conduit, and (b) an internal thread portion positioned on the other of the steam applicator and the steam conduit. 10. A steam cleaning appliance as in claim 9, wherein: the external thread portion is selectively rotatable relative to whichever of the steam cleaning applicator and the steam conduit that the external thread portion is positioned on, and/or the internal thread portion is selectively rotatable relative to whichever of the steam cleaning applicator and the steam conduit that the internal thread portion is positioned on. 11. A steam cleaning appliance as in claim 10, wherein when a user applies at least a threshold force in an end-to-end direction of a handle of the steam applicator, the selectively rotatable thread portion(s) is prevented from rotating more than 180 degrees in either rotational direction relative to whichever of the steam applicator and the steam conduit that the selectively rotatable thread portion(s) is positioned on, as long as the user continues to apply the at least a threshold force. 12. A steam cleaning appliance as in claim 11, wherein when the at least a threshold force is applied, the at least a threshold force overcomes a force provided by a resilient element. 13. A steam cleaning appliance as in claim 12, wherein the at least a threshold force is transferred to the thread portions of the connector. 14. A steam cleaning appliance as in claim 13, wherein the resilient element comprises a coil spring, and the at least a threshold force compresses the spring such that engagement elements on the selectively rotatable thread portion(s) engage with complementary engagement elements fixed to whichever of the steam cleaning applicator and the steam conduit that the selectively rotatable thread portion(s) is positioned on. 15. A steam cleaning appliance as in claim 14, wherein the internal thread portion is selectively rotatable relative to whichever of the steam cleaning applicator and the steam conduit that the internal thread portion is positioned on. 16. A steam cleaning appliance as in claim 15, wherein the internal thread portion is positioned on the handle of the steam cleaning applicator. 17. A steam cleaning appliance as in claim 1, wherein the steam conduit comprises a flexible hose. 18. A steam cleaning appliance as in claim 1, wherein the steam cleaning applicator includes a handle that is connected to the steam conduit. 19. A steam cleaning appliance as in claim 2, wherein the handle is detachably connectable to the steam applicator. | 1 | < 0.1% |
| What is claimed is: 1. A printed substrate manufacturing method of forming solder bumps on a plurality of electrode parts of a printed substrate and mounting a semiconductor chip on the printed substrate via the plurality of solder bumps, comprising: preparing a thermoplastic film to be used as an underfill that covers a surface of the printed substrate on which the solder bumps are formed, wherein parts of the film corresponding to the solder bumps are removed and a peripheral edge of a part of the film on which the semiconductor chip will be mounted has a protruded form for preventing movement of the semiconductor chip on the printed substrate; covering the printed substrate with the film and thereafter bonding the film onto the printed substrate, wherein the parts of the film corresponding to the solder bumps are removed before covering the printed substrate with the film; mounting the semiconductor chip on the printed substrate and carrying the printed substrate into a reflow furnace; and bonding by applying heat and pressure to fuse the solder bumps in the reflow furnace. 2. A method of manufacturing a printed substrate comprising steps of: preparing an underfill film by forming a plurality of holes through the film and forming at least one protruded form on a peripheral edge of the film, wherein the at least one protruded form is disposed on a first surface of the film, and the at least one protruded form extends away from the first surface of the film; after preparing the film, covering a printed substrate with the film by aligning a plurality of solder bumps on the printed substrate with the plurality of holes through the film and thereafter bonding the film onto the printed substrate; placing a semiconductor chip on the printed substrate via the plurality of solder bumps and carrying the printed substrate into a reflow furnace; and applying heat and pressure in the reflow furnace to adhere the semiconductor chip to the printed substrate. 3. The method of manufacturing a printed substrate according to claim 2, wherein the step of preparing the film further comprises drawing the film from a film roll, cutting the film to a predetermined size, and drilling the plurality of holes through the film. 4. The printed substrate manufacturing method according to claim 2, wherein a second surface of the film faces the printed substrate after covering the printed substrate with the film, and the second surface of the film forms one side of the film and the first surface of the film forms an opposite side of the film. | 1 | < 0.1% |
| The invention claimed is: 1. A system for filtering particulate matter from exhaust gas, said system comprising: a porous structure having substrate pores of a first mean pore size; a selective catalytic reduction (SCR) washcoat disposed on a surface of the porous structure or within the porous structure to define pores of a second mean pore size; and the second mean pore size is less than the first mean pore size; wherein said washcoat comprises a small pore zeolite promoted with at least one metal selected from the group consisting of Cr, Co, Cu, Fe, Hf, La, Ce, In, V, Mn, Ni, Zn, Ga, Ag, Au, Pt, Pd, and Rh; a NO xabsorber catalyst disposed upstream of the washcoat. 2. A system according to claim 1, wherein the washcoat is disposed within the porous structure. 3. A system according to claim 1, wherein the transition metal is selected from the group consisting of Cu, Fe, and Ce. 4. A system according to claim 1, wherein the zeolite has a CHA framework structure. 5. A system according to claim 4, wherein the transition metal consists of Cu. 6. A system according to claim 1, the porous structure is a ceramic wallflow filter. 7. A system according to claim 1, wherein: the porous structure has substrate pores; and the SCR washcoat is one or more layers substantially covering the substrate pores at the inlet surfaces. 8. A system according to claim 1, wherein: the washcoat is present on the inlet surfaces; and the NOxabsorber catalyst is disposed upstream of the porous structure. | 1 | < 0.1% |
| The invention claimed is: 1. A low back pain treatment tool comprising: a cylindrical casing elongated in a longitudinal direction; a coccyx contact treatment member which is placed through an elastic member so as to be slidably movable in an axial direction of the cylindrical casing; a coccyx contact buffering member which is provided on an upper end of the coccyx contact treatment member; a posture holding member which has a posture holding surface in a longitudinal direction, which faces the cylindrical casing; and a handle fixed to which the posture holding member. 2. The low back pain treatment tool according to claim 1, wherein the cylindrical casing is fixed and supported on the posture holding member by fixing a horizontal seat plate vertically with respect to the posture holding surface and coupling a lower end of the cylindrical casing to an upper surface of the horizontal seat plate. 3. The low back pain treatment tool according to claim 1, wherein the cylindrical casing is fixed and supported on the posture holding member by fixing the posture holding member on a horizontal base plate, fixing a pair of left and right side plates orthogonally to a horizontal surface of the base plate and the posture holding surface, and attaching a horizontal seat plate between the side plates. 4. A low back pain treatment tool comprising: a cylindrical casing elongated in a longitudinal direction; a coccyx contact treatment member which is slidably placed through an elastic member in an axial direction of the cylindrical casing; a coccyx contact buffering member which is provided on an upper end of the coccyx contact treatment member; a posture holding member having a posture holding surface in a longitudinal direction, which faces the cylindrical casing; a handle fixed to the posture holding member; a horizontal seat plate which fixes and supports the cylindrical casing on the posture holding member by being fixed vertically with respect to the posture holding surface and coupling a lower end of the cylindrical casing to an upper surface of the horizontal seat plate; a horizontal base plate which fixes the posture holding member; a pair of left and right side plates which are fixed orthogonally to a horizontal surface of the base plate and the posture holding surface, and which support left and right sides of the horizontal base plate respectively; corner portions formed by an outer surface of either of the side plates, the posture holding surface, and a horizontal surface of the base plate; and rectangular parallelepiped foot rest blocks which are detachably placed at the corner portions. | 1 | < 0.1% |
| What is claimed is: 1. A fail detecting device for a rotation angle sensor, comprising: a cam with a continuously formed cam surface having an actuating surface for reciprocating a push rod and a non-actuating surface that does not reciprocate the push rod, an angle sensor formed of an endless rotary potentiometer for detecting a rotation angle of the cam and having an output voltage increasing in proportion to the rotational angle in a range of 360 degrees, and a controller for detecting a fail state of the angle sensor, said cam is configured to be driven to rotate in one direction by an electric motor controlled by the controller and to reciprocate the push rod; the output voltage of the angle sensor detects: a first region equal to or lower than a first predetermined voltage from 0 degrees to an angle ? 1, and a second region equal to or higher than a second predetermined voltage higher than the first predetermined voltage from 360 degrees to an angle ? 2, said first and second regions being recognized as a dead zone; the controller is configured to drive the rotation of the cam to a predetermined position in the non-actuating surface at a constant speed in transition of the cam surface of the cam abutting against the push rod from a side of the actuating surface to a side of the non-actuating surface; and the angle sensor is configured wherein the dead zone is disposed at a position in the non-actuating surface of the cam and in an area in front of the predetermined position. 2. The fail detecting device for a rotation angle sensor according to claim 1, wherein the controller measures an elapsed time from transition of the cam surface to the dead zone by a timer and determines that the rotation angle sensor is in a fail state if the dead zone is detected although an estimated time of passage through the dead zone has elapsed. 3. The fail detecting device for a rotation angle sensor according to claim 2, wherein the controller stores the output voltage of timing to transition to the dead zone as a saved value and determines that the rotation angle sensor is in the fail state if the output voltage is the same as the saved value although an estimated time of passage through the dead zone has elapsed and a predetermined time has elapsed in this state. 4. The fail detecting device for a rotation angle sensor according to claim 2, wherein the controller determines that the rotation angle sensor is in the fail state if the output voltage is outside a range between upper and lower limits set in advance although an estimated time of passage through the dead zone has elapsed and a predetermined time has elapsed in this state. 5. The fail detecting device for a rotation angle sensor according to claim 2, wherein the controller stores a sensor value of timing to transition to the dead zone as a saved value and determines that the rotation angle sensor is in the fail state if the output voltage is not a value corresponding to the predetermined position in the non-actuating surface although an estimated time of passage through the dead zone has elapsed. 6. The fail detecting device for a rotation angle sensor according to claim 1, wherein the controller measures an elapsed time from transition of the cam surface from the actuating surface to the non-actuating surface by a timer and determines that the rotation angle sensor is in a fail state if the dead zone is detected although an estimated time of passage through the dead zone has elapsed. 7. The fail detecting device for a rotation angle sensor according to claim 6, wherein the controller stores the output voltage of timing to transition to the dead zone as a saved value and determines that the rotation angle sensor is in the fail state if the output voltage is the same as the saved value although an estimated time of passage through the dead zone has elapsed and a predetermined time has elapsed in this state. 8. The fail detecting device for a rotation angle sensor according to claim 6, wherein the controller determines that the rotation angle sensor is in the fail state if the output voltage is outside a range between upper and lower limits set in advance although an estimated time of passage through the dead zone has elapsed and a predetermined time has elapsed in this state. 9. The fail detecting device for a rotation angle sensor according to claim 6, wherein the controller stores a sensor value of timing to transition to the dead zone as a saved value and determines that the rotation angle sensor is in the fail state if the output voltage is not a value corresponding to the predetermined position in the non-actuating surface although an estimated time of passage through the dead zone has elapsed. 10. The fail detecting device for a rotation angle sensor according to claim 1, wherein the dead zone is positioned corresponding to 0 degrees as the angle of rotation with a range of ?1 to-?2 defining the dead zone and with the area ?1 to 90 degrees defining a standby area and with the area ?2 to 270 degrees defining a bridge area. 11. A fail detecting device for a rotation angle sensor comprising: a cam having a continuously formed cam surface with an actuating surface for imparting motion to reciprocates a push rod and a non-actuating surface that does not impart motion to reciprocate the push rod; an angle sensor formed of an endless rotary potentiometer for detecting an angle of rotation of the cam and having an output voltage increasing in proportion to the rotational angle in a range of 360 degrees; a controller for detecting a fail state of the angle sensor; said cam being configured to be driven to rotate in one direction by a motor controlled by the controller to reciprocate the push rod; and the output voltage of the angle sensor detects: a first region equal to or lower than a first predetermined voltage from 0 degrees to an angle ? 1, and a second region equal to or higher than a second predetermined voltage higher than the first predetermined voltage from 360 degrees to an angle ? 2, said dead zone is defined by the first and second regions; said controller being configured to drive the rotation of the cam to a predetermined position relative to the non-actuating surface at a constant speed in transition of the cam surface of the cam abutting against the push rod from a side of the actuating surface to a side of the non-actuating surface; said angle sensor being configured wherein the dead zone is disposed at a position in the non-actuating surface of the cam and in an area in front of the predetermined position. 12. The fail detecting device for a rotation angle sensor according to claim 11, wherein the controller measures an elapsed time from transition of the cam surface to the dead zone by a timer and determines that the rotation angle sensor is in a fail state if the dead zone is detected although an estimated time of passage through the dead zone has elapsed. 13. The fail detecting device for a rotation angle sensor according to claim 12, wherein the controller stores the output voltage of timing to transition to the dead zone as a saved value and determines that the rotation angle sensor is in the fail state if the output voltage is the same as the saved value although an estimated time of passage through the dead zone has elapsed and a predetermined time has elapsed in this state. 14. The fail detecting device for a rotation angle sensor according to claim 12, wherein the controller determines that the rotation angle sensor is in the fail state if the output voltage is outside a range between upper and lower limits set in advance although an estimated time of passage through the dead zone has elapsed and a predetermined time has elapsed in this state. 15. The fail detecting device for a rotation angle sensor according to claim 12, wherein the controller stores a sensor value of timing to transition to the dead zone as a saved value and determines that the rotation angle sensor is in the fail state if the output voltage is not a value corresponding to the predetermined position in the non-actuating surface although an estimated time of passage through the dead zone has elapsed. 16. The fail detecting device for a rotation angle sensor according to claim 11, wherein the controller measures an elapsed time from transition of the cam surface from the actuating surface to the non-actuating surface by a timer and determines that the rotation angle sensor is in a fail state if the dead zone is detected although an estimated time of passage through the dead zone has elapsed. 17. The fail detecting device for a rotation angle sensor according to claim 16, wherein the controller stores the output voltage of timing to transition to the dead zone as a saved value and determines that the rotation angle sensor is in the fail state if the output voltage is the same as the saved value although an estimated time of passage through the dead zone has elapsed and a predetermined time has elapsed in this state. 18. The fail detecting device for a rotation angle sensor according to claim 16, wherein the controller determines that the rotation angle sensor is in the fail state if the output voltage is outside a range between upper and lower limits set in advance although an estimated time of passage through the dead zone has elapsed and a predetermined time has elapsed in this state. 19. The fail detecting device for a rotation angle sensor according to claim 16, wherein the controller stores a sensor value of timing to transition to the dead zone as a saved value and determines that the rotation angle sensor is in the fail state if the output voltage is not a value corresponding to the predetermined position in the non-actuating surface although an estimated time of passage through the dead zone has elapsed. 20. The fail detecting device for a rotation angle sensor according to claim 11, wherein the dead zone is positioned corresponding to 0 degrees as the angle of rotation with a range of ?1 to-?2 defining the dead zone and with the area ?1 to 90 degrees defining a standby area and with the area ?2 to 270 degrees defining a bridge area. | 1 | < 0.1% |
| What is claimed is: 1. A computer-implemented method, comprising: receiving, by a first computing device, data packets that were transmitted by a second computing device as part of a first data transmission of multiple data packets; identifying, by the first computing device, at least some of the received data packets as being data packets for which the first computing device should send, for receipt by the second computing device, an acknowledgement that the at least some of the received data packets were successfully received by the first computing device; and sending, by the first computing device and for receipt by the second computing device, a second data transmission that includes, as the acknowledgment that the at least some of the received data packets were successfully received by the first computing device: (i) a multi-bit identification of one of the multiple data packets in the first data transmission, and (ii) multiple bits, each of the multiple bits representing an acknowledgment or non-acknowledgment of a data packet in the first data transmission of multiple data packets, wherein the second data transmission includes, for each of the at least some of the received data packets, a bit that represents an acknowledgement of the respective data packet. 2. The computer-implemented method of claim 1, wherein: the received data packets are a subset of the multiple data packets that were received by the first computing device as part of the first data transmission; and the second data transmission includes, for each of the multiple data packets that is not one of the at least some of the received data packets, a bit that represents non-acknowledgement of the respective data packet. 3. The computer-implemented method of claim 1, further comprising: performing, by the first computing device, an error-checking operation; and identifying, by the first computing device, the at least some of the received data packets are being a subset of the received data packets that satisfy the error-checking algorithm. 4. The computer-implemented method of claim 3, wherein the error-checking operation includes a cyclic redundancy check error-checking algorithm. 5. The computer-implemented method of claim 3, wherein the second data transmission includes, for each of the received data packets that did not satisfy the error-checking operation, a bit that represents non-acknowledgment of the respective data packet. 6. The computer-implemented method of claim 1, wherein: the first data transmission includes a wireless transmission of the multiple data packets; the second data transmission includes a wireless transmission of the multi-bit identification and the multiple bits; and each of the multiple data units is a byte. 7. The computer-implemented method of claim 1, wherein each of the multiple bits represents an acknowledgment or a non-acknowledgment for each corresponding packet in group of sequential packets. 8. The computer-implemented method of claim 1, wherein the multiple bits represent acknowledgment or non-acknowledgment of multiple different packets using a single bit for each respective packet to indicate acknowledgment or non-acknowledgment of the respective packet. 9. The computer-implemented method of claim 1, wherein the multi-bit identification of the packet and the multiple bits are included in a single packet that the first computing device transmits for receipt by the second computing device as part of the second data transmission. 10. The computer-implemented method of claim 1, wherein the multi-bit identification of the one of the multiple data packets is a packet sequence identifier that the first computing device received in the one of the multiple data packets, wherein the packet sequence identifier distinguishes the one of the multiple data packets from other of the multiple data packets. 11. A computer-readable non-transitory medium including instructions that, when executed by one or more computer processors, cause performance of operations that comprise: receiving, by a first computing device, data packets that were transmitted by a second computing device as part of a first data transmission of multiple data packets; identifying, by the first computing device, at least some of the received data packets as being data packets for which the first computing device should send, for receipt by the second computing device, an acknowledgement that the at least some of the received data packets were successfully received by the first computing device; and sending, by the first computing device and for receipt by the second computing device, a second data transmission that includes, as the acknowledgment that the at least some of the received data packets were successfully received by the first computing device: (i) a multi-bit identification of one of the multiple data packets in the first data transmission, and (ii) multiple bits, each of the multiple bits representing an acknowledgment or non-acknowledgment of a data packet in the first data transmission of multiple data packets, wherein the second data transmission includes, for each of the at least some of the received data packets, a bit that represents an acknowledgement of the respective data packet. 12. The computer-readable non-transitory medium of claim 11, wherein: the received data packets are a subset of the multiple data packets that were received by the first computing device as part of the first data transmission; and the second data transmission includes, for each of the multiple data packets that is not one of the at least some of the received data packets, a bit that represents non-acknowledgement of the respective data packet. 13. The computer-readable non-transitory medium of claim 11, wherein the operations further comprise: performing, by the first computing device, an error-checking operation; and identifying, by the first computing device, the at least some of the received data packets are being a subset of the received data packets that satisfy the error-checking algorithm. 14. The computer-readable non-transitory medium of claim 13, wherein the error-checking operation includes a cyclic redundancy check error-checking algorithm. 15. The computer-readable non-transitory medium of claim 13, wherein the second data transmission includes, for each of the received data packets that did not satisfy the error-checking operation, a bit that represents non-acknowledgment of the respective data packet. 16. The computer-readable non-transitory medium of claim 11, wherein: the first data transmission includes a wireless transmission of the multiple data packets; the second data transmission includes a wireless transmission of the multi-bit identification and the multiple bits; and each of the multiple data units is a byte. 17. The computer-readable non-transitory medium of claim 11, wherein each of the multiple bits represents an acknowledgment or a non-acknowledgment for each corresponding packet in group of sequential packets. 18. The computer-readable non-transitory medium of claim 11, wherein the multiple bits represent acknowledgment or non-acknowledgment of multiple different packets using a single bit for each respective packet to indicate acknowledgment or non-acknowledgment of the respective packet. 19. The computer-readable non-transitory medium of claim 11, wherein the multi-bit identification of the packet and the multiple bits are included in a single packet that the first computing device transmits for receipt by the second computing device as part of the second data transmission. 20. The computer-readable non-transitory medium of claim 11, wherein the multi-bit identification of the one of the multiple data packets is a packet sequence identifier that the first computing device received in the one of the multiple data packets, wherein the packet sequence identifier distinguishes the one of the multiple data packets from other of the multiple data packets. | 1 | < 0.1% |
| What is claimed is: 1. An electric storage element, comprising: a casing; an external terminal comprising a surface exposed outward from the casing; a current collector provided inside the casing and connected to the external terminal; and an electrode assembly provided inside the casing and connected to the current collector, wherein the casing comprises a through hole, and wherein the external terminal includes: a flange in contact with an outer surface of the casing; and a first shaft extending from the flange to be inserted into the through hole in the casing and directly welded to the casing. 2. The electric storage element according to claim 1, wherein the external terminal further includes a second shaft that has a diameter smaller than a diameter of the first shaft, and extends from the first shaft to be fixed to the current collector. 3. The electric storage element according to claim 2, wherein the first shaft is inserted into the through hole in the casing, and, with the flange being in contact with the outer surface of the casing, a stepped portion from the second shaft has a height substantially flush with an inner surface of the casing. 4. The electric storage element according to claim 1, wherein the casing comprises a battery case comprising an open surface, and a cover closing the opening of the battery case, and wherein the through hole of the casing is provided in the cover. 5. The electric storage element according to claim 4, wherein the cover comprises an engagement receiver swelled outward, and the current collector comprises a fitting portion that is located in the engagement receiver and comprises a through hole into which the first shaft is inserted to be welded to the casing. 6. The electric storage element according to claim 4, wherein the external terminal comprises a positive external terminal and electrically connects the cover and the current collector when the current collector is fixed to the cover. 7. The electric storage element according to claim 1, wherein the first shaft is inserted into the through hole in the casing, and a contact portion there between is welded over an entire periphery. 8. The electric storage element according to claim 1, wherein the flange is in a direct contact with the outer surface of the casing. 9. The electric storage element according to claim 1, wherein the outer surface of the casing abuts the flange. 10. The electric storage element according to claim 1, wherein the flange is in an electrical contact with the outer surface of the casing. 11. The electric storage element according to claim 1, wherein the casing comprises a cover that comprises an engagement receiver swelled outward, and wherein an outer diameter of the first shaft is located in a hole of the engagement receiver provided on the cover without a gap being formed therein. 12. The electric storage element according to claim 1, wherein the external terminal further includes a second shaft, and wherein the first shaft has a height such that a stepped portion between the first shaft and the second shaft is flush with an inner surface of the cover. 13. The electric storage element according to claim 12, wherein the second shaft is inserted into a hole in the current collector. 14. The electric storage element according to claim 13, wherein the second shaft is caulked in a state where an inner surface of an engagement recess of an engagement receiver on the cover is in a surface contact with an upper surface of the current collector. | 1 | < 0.1% |
| What is claimed is: 1. A modular visualization display panel, comprising: a modular stackup arrangement of the modular visualization display panel comprising a logic module enclosure that physically couples to a communication module enclosure to form the modular stackup arrangement, the logic module enclosure having a connection to an electrical ground for at least discharging electrostatic discharge (ESD) energy of ESD events of the modular visualization display panel; the logic module enclosure configured to enclose first processing circuitry and comprising at least one generally flat surface to electrically couple to the communication module enclosure for at least receiving portions of the ESD energy received at the communication module enclosure; the communication module enclosure configured to enclose second processing circuitry and having at least one surface with a plurality of raised contact nodes arranged on the one surface of the communication module enclosure such that when in contact with the one generally flat surface of the logic module enclosure, at least the portions of the ESD energy is directed over ones of the raised contact nodes to the one generally flat surface of the logic module enclosure for discharging the portions of the ESD energy through the electrical ground of the logic module enclosure. 2. The modular visualization display panel of claim 1, wherein the plurality of raised contact nodes are disposed along a first edge of the one surface of the communication module enclosure. 3. The modular visualization display panel of claim 2, wherein the first edge comprises an edge with the largest gapping between the one surface of the communication module enclosure and the one generally flat surface of the logic module enclosure. 4. The modular visualization display panel of claim 1, wherein the one surface of the communication module enclosure and the plurality of raised contact nodes are formed from the same piece of material. 5. The modular visualization display panel of claim 1, wherein the plurality of raised contact nodes comprise contact nodes machined from the one surface of the communication module enclosure. 6. The modular visualization display panel of claim 1, wherein the one generally flat surface of the logic module enclosure is comprised of a first metal composition and the one surface of the communication module enclosure is comprised of a second metal composition, and wherein the plurality of raised contact nodes are comprised of a third metal composition different than that of the one generally flat surface of the logic module enclosure and the one surface of the communication module enclosure, the third metal composition selected to reduce galvanic corrosion due to contact between the first metal and the second metal. 7. The modular visualization display panel of claim 6, wherein the plurality of raised contact nodes are each adhered to the one surface of the communication module enclosure by a conductive weld. 8. The modular visualization display panel of claim 1, wherein the one generally flat surface of the first logic module enclosure comprises a non-conductive layer over a conductive layer, and wherein at least a penetrating portion of ones of the plurality of raised contact nodes is configured to penetrate the non-conductive layer of the one generally flat surface of the logic module enclosure to form a conductive bond between the conductive layer of the one generally flat surface of the logic module enclosure and the one surface of the second module through the raised contact nodes. 9. The modular visualization display panel of claim 1, wherein the portions of the ESD energy is directed over ones of the plurality of raised contact nodes to the one generally flat surface of the logic module enclosure instead of through the second processing circuitry. 10. The modular visualization display panel of claim 1, wherein the plurality of raised contact nodes deform the at least one generally flat surface of the logic module enclosure when the first logic module enclosure is mated to the communication module enclosure. | 1 | < 0.1% |
| The invention claimed is: 1. A method for guaranteeing continuity of communications operated from several fourth-generation mobile terminals connected to a radio network provided with several base stations with which each of said several fourth-generation mobile terminals is configured to communicate, wherein each said base station is connected to a controller from among several controllers linking said radio network to an interconnection network comprising routers operating at an IP layer level, wherein said controllers are connected to at least one gateway from among a plurality of gateways, wherein each of said plurality of gateways is connected to at least one of said routers, wherein each of said at least one gateway has at least two different IP addresses, of which a first IP address is known to the fourth-generation mobile terminals of the radio network and of which a second IP address is known to the routers of the interconnection network, wherein said first IP address is the same for all the plurality of gateways of the radio network, and wherein each fourth-generation mobile terminal is associated with at least one base station and with at least one gateway connected to the controller to which said at least one base station is connected, the method comprising: establishing, for each of said plurality of gateways, a match list between the IP address of each fourth-generation mobile terminal connected to the radio network and said second IP address of said associated gateway by: transmitting, when a particular fourth-generation mobile terminal connects to a particular base station connected to a first controller to which the particular fourth-generation mobile terminal was not affiliated previously, a level-2 message comprising at least the IP address of the particular fourth-generation mobile terminal, said transmitting being carried out by the first controller or said associated gateway; creating, at said associated gateway, an IP message comprising the IP address of said particular fourth-generation mobile terminal and the second IP address of said associated gateway in the interconnection network; and broadcasting said IP message by said associated gateway to destination gateways associated with other controllers, wherein each of said destination gateways stores a correspondence between the IP address of the particular fourth-generation mobile terminal and the second IP address of the associated gateway that is carrying out said broadcasting associated with the controller to which the particular fourth-generation mobile terminal is affiliated; and routing IP packets in the interconnection network by: transmitting systematically all the IP packets arising from the controller to said associated gateway; and encapsulating, by said associated gateway, each of said IP packets in respective IP packets of a higher level using said match list, wherein a destination IP address of each of said higher level IP packets is the second IP address corresponding to a destination gateway, and wherein each fourth-generation mobile terminal has an IP address that does not change when said fourth-generation mobile terminal passes from the first controller to another controller. 2. The method according to claim 1, wherein each controller is connected to a respective gateway of the plurality of gateways that is dedicated to said each controller. 3. The method according to claim 2, in which each respective gateway of the plurality of gateways is connected to each respective controller by way of at least one IP router included in the interconnection network, wherein said IP router is configured to systematically guide all the IP packets or level-2 messages to said each of the plurality of gateways prior to the encapsulation of the IP packets and the broadcasting of the encapsulated IP packets in the interconnection network. 4. The method according to claim 3, further comprising: transmitting, after the encapsulation of the IP packets, all the encapsulated IP packets arising from a first gateway connected to a first controller that travel via the interconnection network to a second gateway connected to a second controller; extracting, by the second gateway, IP packets from the higher level IP packets transmitted by the first gateway; and transmitting said extracted IP packets to the second controller. 5. The method according to claim 1, further comprising: receiving, from one of said routers in the interconnection network, an ARP request from an external router outside the interconnection network; rerouting said ARP request from the router in the interconnection network to a gateway in the plurality of gateways that has a level-2 address; transmitting, from said gateway, a response to said external router, the response comprising the level-2 address. 6. A system for guaranteeing continuity of communications operated from several fourth-generation mobile terminals, the system comprising: a radio network including a plurality of base stations with which said fourth-generation mobile terminals are configured to communicate; an interconnection network comprising routers operating at an IP layer level; a plurality of controllers, each of said base stations being connected to one of said plurality of controllers, said plurality of controllers linking said radio network to said interconnection network; and a plurality of gateways, wherein each of said controllers is connected to at least one gateway of said plurality of gateways, wherein each of said plurality of gateways receives IP packets arising from the radio network, wherein each of said plurality of gateways has at least two different IP addresses, of which a first IP address is known to the base stations of the radio network and of which a second IP address is known to the routers of the interconnection network, wherein said first IP address is the same for all gateways of said plurality of gateways of the radio network, wherein each fourth-generation mobile terminal is associated with at least one base station and with at least one gateway connected to the controller to which said at least one base station is connected, wherein each of said plurality of gateways establishes a match list between the IP address of each fourth-generation mobile terminal connected to the radio network and said second IP address of said associated gateway by: transmitting, when a particular fourth-generation mobile terminal connects to a particular base station connected to a first controller to which the particular fourth-generation mobile terminal was not affiliated previously, a level-2 message comprising at least the IP address of the particular fourth-generation mobile terminal, said transmitting being carried out by the first controller or said associated gateway; creating, at said associated gateway, an IP message comprising the IP address of said particular fourth-generation mobile terminal and the second IP address of said associated gateway in the interconnection network; and broadcasting said IP message by said associated gateway to destination gateways associated with other controllers, wherein each of said destination gateways stores a correspondence between the IP address of the particular fourth-generation mobile terminal and the second IP address of the associated gateway that is carrying out said broadcasting associated with the controller to which the particular fourth-generation mobile terminal is affiliated, and wherein the routers in the interconnection network route IP packets by: transmitting systematically all the IP packets arising from the controller to said associated gateway, wherein each of said plurality of gateways encapsulates each of said IP packets in respective IP packets of a higher level using said match list, wherein a destination IP address of each of said higher level IP packets is the second IP address corresponding to a destination gateway, wherein each fourth-generation mobile terminal has an IP address that does not change when said each fourth-generation mobile terminal passes from the first controller to another controller, and wherein each of said plurality of gateways broadcasts said IP packets of the higher level over the interconnection network. 7. The system according to claim 6, wherein said at least one gateway is connected via a data bus to the controller with which it is associated. 8. The system according to claim 6, wherein said at least one gateway is connected by way of at least one router to the controller with which it is associated. | 1 | < 0.1% |
| What is claimed is: 1. A control device comprising: a search request receiving unit that receives a request to search for a first operation screen registered in a second image forming apparatus connected to a first image forming apparatus; a search unit that searches for the first operation screen among operation screens registered in the second image forming apparatus; a display control unit that controls to display the first operation screen on a display device provided in the first image forming apparatus; a receiving unit that receives an instruction for the second image forming apparatus having the first operation screen registered therein from a user through the first operation screen displayed on the display device; and a transmitting unit that transmits the instruction received from the user through the first operation screen to the second image forming apparatus having the first operation screen registered therein, wherein the first operation screen is an execution screen for executing a function that is unavailable in the first image forming apparatus, and when the function that is unavailable in the first image forming apparatus is selected on a menu screen registered in the first image forming apparatus, the display control unit controls to display the first operation screen registered on a display device provided in the second image forming apparatus. 2. The control device according to claim 1, wherein the first operation screen is a menu screen capable of selecting function that is included in the first image forming apparatus and is unavailable, or the execution screen for executing the function. 3. The control device according to claim 1, wherein the first operation screen is a menu screen capable of selecting any one of functions of the second image forming apparatus. 4. The control device according to claim 1, wherein the first operation screen is the execution screen for executing any one of functions of the second image forming apparatus. 5. A control method comprising: receiving a request to search for a first operation screen registered in a second image forming apparatus connected to a first image forming apparatus; searching for the first operation screen among operation screens registered in the second image forming apparatus; displaying the first operation screen on a display device provided in the first image forming apparatus; receiving an instruction for the second image forming apparatus having the first operation screen registered therein from a user through the first operation screen displayed on the display device; and transmitting the instruction received from the user through the first operation screen to the second image forming apparatus having the first operation screen registered therein, wherein the first operation screen is an execution screen for executing a function that is unavailable in the first image forming apparatus, and when the function that is unavailable in the first image forming apparatus is selected on a menu screen registered in the first image forming apparatus, displaying the first operation screen registered on a display device provided in the second image forming apparatus. 6. An image forming apparatus comprising: a display device that displays an operation screen; and a control device; wherein the control device includes: a search request receiving unit that receives a request to search for a first operation screen registered in a second image forming apparatus connected to the image forming apparatus through a communication unit; a search unit that searches for the first operation screen among operation screens registered in the second image forming apparatus; a display control unit that controls to display the first operation screen on the display device; a receiving unit that receives an instruction for the second image forming apparatus having the first operation screen registered therein from a user through the first operation screen displayed on the display device; and a transmitting unit that transmits the instruction received from the user through the first operation screen to the second image forming apparatus having the first operation screen registered therein, wherein the first operation screen is an execution screen for executing a function that is unavailable in the first image forming apparatus, and when the function that is unavailable in the first image forming apparatus is selected on a menu screen registered in the first image forming apparatus, the display control unit controls to display the first operation screen registered on a display device provided in the second image forming apparatus. 7. A non-transitory computer readable medium storing a program that causes a computer to perform: receiving a request to search for a first operation screen registered in a second image forming apparatus connected to a first image forming apparatus; searching for the first operation screen among operation screens registered in the second image forming apparatus; displaying the first operation screen on a display device provided in the first image forming apparatus; receiving an instruction for the second image forming apparatus having the first operation screen registered therein from a user through the first operation screen displayed on the display device; and transmitting the instruction received from the user through the first operation screen to the second image forming apparatus having the first operation screen registered therein, wherein the first operation screen is an execution screen for executing a function that is unavailable in the first image forming apparatus, and when the function that is unavailable in the first image forming apparatus is selected on a menu screen registered in the first image forming apparatus, displaying the first operation screen registered on a display device provided in the second image forming apparatus. | 1 | < 0.1% |
| Other values (2774) | 2774 |
Length
| Value | Count | Frequency (%) |
| the | 287868 | 10.1% |
| a | 137427 | 4.8% |
| of | 133785 | 4.7% |
| to | 78152 | 2.7% |
| and | 70412 | 2.5% |
| wherein | 46897 | 1.6% |
| is | 43950 | 1.5% |
| claim | 38749 | 1.4% |
| in | 35217 | 1.2% |
| first | 33434 | 1.2% |
| Other values (28736) | 1942488 |
Most occurring characters
| Value | Count | Frequency (%) |
| 2816255 | ||
| e | 1775283 | 10.0% |
| t | 1313519 | 7.4% |
| i | 1190879 | 6.7% |
| a | 1129810 | 6.4% |
| o | 1077086 | 6.1% |
| n | 1058083 | 6.0% |
| r | 958860 | 5.4% |
| s | 792350 | 4.5% |
| c | 648332 | 3.7% |
| Other values (100) | 4977075 |
Most occurring categories
| Value | Count | Frequency (%) |
| Lowercase Letter | 14136520 | |
| Space Separator | 2816270 | 15.9% |
| Other Punctuation | 282127 | 1.6% |
| Decimal Number | 176233 | 1.0% |
| Uppercase Letter | 150429 | 0.8% |
| Control | 104197 | 0.6% |
| Dash Punctuation | 35203 | 0.2% |
| Close Punctuation | 17067 | 0.1% |
| Open Punctuation | 15771 | 0.1% |
| Math Symbol | 2404 | < 0.1% |
| Other values (4) | 1311 | < 0.1% |
Most frequent character per category
Lowercase Letter
| Value | Count | Frequency (%) |
| e | 1775283 | |
| t | 1313519 | 9.3% |
| i | 1190879 | 8.4% |
| a | 1129810 | 8.0% |
| o | 1077086 | 7.6% |
| n | 1058083 | 7.5% |
| r | 958860 | 6.8% |
| s | 792350 | 5.6% |
| c | 648332 | 4.6% |
| h | 589729 | 4.2% |
| Other values (18) | 3602589 |
Uppercase Letter
| Value | Count | Frequency (%) |
| T | 40275 | |
| A | 15461 | 10.3% |
| C | 10901 | 7.2% |
| I | 7543 | 5.0% |
| S | 7458 | 5.0% |
| D | 7332 | 4.9% |
| P | 7083 | 4.7% |
| R | 6254 | 4.2% |
| M | 5125 | 3.4% |
| N | 4922 | 3.3% |
| Other values (18) | 38075 |
Other Punctuation
| Value | Count | Frequency (%) |
| , | 122252 | |
| . | 95515 | |
| ; | 32709 | 11.6% |
| : | 18965 | 6.7% |
| ? | 5532 | 2.0% |
| / | 3670 | 1.3% |
| % | 2239 | 0.8% |
| ' | 775 | 0.3% |
| * | 318 | 0.1% |
| · | 151 | 0.1% |
Control
| Value | Count | Frequency (%) |
| 102736 | ||
| | 1135 | 1.1% |
| | 112 | 0.1% |
| | 112 | 0.1% |
| | 35 | < 0.1% |
| | 35 | < 0.1% |
| | 14 | < 0.1% |
| | 6 | < 0.1% |
| 6 | < 0.1% | |
| | 4 | < 0.1% |
Decimal Number
| Value | Count | Frequency (%) |
| 1 | 61796 | |
| 2 | 24207 | 13.7% |
| 0 | 18084 | 10.3% |
| 3 | 14441 | 8.2% |
| 5 | 12240 | 6.9% |
| 4 | 11933 | 6.8% |
| 6 | 9620 | 5.5% |
| 7 | 8396 | 4.8% |
| 8 | 8180 | 4.6% |
| 9 | 7336 | 4.2% |
Math Symbol
| Value | Count | Frequency (%) |
| = | 801 | |
| + | 703 | |
| × | 246 | 10.2% |
| < | 217 | 9.0% |
| > | 203 | 8.4% |
| ± | 153 | 6.4% |
| | | 81 | 3.4% |
Close Punctuation
| Value | Count | Frequency (%) |
| ) | 16408 | |
| ] | 398 | 2.3% |
| } | 261 | 1.5% |
Open Punctuation
| Value | Count | Frequency (%) |
| ( | 15075 | |
| [ | 397 | 2.5% |
| { | 299 | 1.9% |
Space Separator
| Value | Count | Frequency (%) |
| 2816255 | ||
| 15 | < 0.1% |
Other Symbol
| Value | Count | Frequency (%) |
| ° | 1101 | |
| ® | 23 | 2.0% |
Other Number
| Value | Count | Frequency (%) |
| ¼ | 41 | |
| ½ | 13 | 24.1% |
Dash Punctuation
| Value | Count | Frequency (%) |
| - | 35203 |
Connector Punctuation
| Value | Count | Frequency (%) |
| _ | 106 |
Modifier Symbol
| Value | Count | Frequency (%) |
| ^ | 27 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Latin | 14286949 | |
| Common | 3450583 | 19.5% |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| e | 1775283 | |
| t | 1313519 | 9.2% |
| i | 1190879 | 8.3% |
| a | 1129810 | 7.9% |
| o | 1077086 | 7.5% |
| n | 1058083 | 7.4% |
| r | 958860 | 6.7% |
| s | 792350 | 5.5% |
| c | 648332 | 4.5% |
| h | 589729 | 4.1% |
| Other values (46) | 3753018 |
Common
| Value | Count | Frequency (%) |
| 2816255 | ||
| , | 122252 | 3.5% |
| 102736 | 3.0% | |
| . | 95515 | 2.8% |
| 1 | 61796 | 1.8% |
| - | 35203 | 1.0% |
| ; | 32709 | 0.9% |
| 2 | 24207 | 0.7% |
| : | 18965 | 0.5% |
| 0 | 18084 | 0.5% |
| Other values (44) | 122861 | 3.6% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 17734321 | |
| None | 3211 | < 0.1% |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 2816255 | ||
| e | 1775283 | 10.0% |
| t | 1313519 | 7.4% |
| i | 1190879 | 6.7% |
| a | 1129810 | 6.4% |
| o | 1077086 | 6.1% |
| n | 1058083 | 6.0% |
| r | 958860 | 5.4% |
| s | 792350 | 4.5% |
| c | 648332 | 3.7% |
| Other values (78) | 4973864 |
None
| Value | Count | Frequency (%) |
| | 1135 | |
| ° | 1101 | |
| × | 246 | 7.7% |
| ± | 153 | 4.8% |
| · | 151 | 4.7% |
| | 112 | 3.5% |
| | 112 | 3.5% |
| ¼ | 41 | 1.3% |
| | 35 | 1.1% |
| | 35 | 1.1% |
| Other values (12) | 90 | 2.8% |
Claims Count
Real number (ℝ)
| Distinct | 64 |
|---|---|
| Distinct (%) | 2.3% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Infinite | 0 |
| Infinite (%) | 0.0% |
| Mean | 16.423491 |
| Minimum | 1 |
|---|---|
| Maximum | 293 |
| Zeros | 0 |
| Zeros (%) | 0.0% |
| Negative | 0 |
| Negative (%) | 0.0% |
| Memory size | 21.9 KiB |
Quantile statistics
| Minimum | 1 |
|---|---|
| 5-th percentile | 4 |
| Q1 | 10 |
| median | 16 |
| Q3 | 20 |
| 95-th percentile | 32 |
| Maximum | 293 |
| Range | 292 |
| Interquartile range (IQR) | 10 |
Descriptive statistics
| Standard deviation | 10.579774 |
|---|---|
| Coefficient of variation (CV) | 0.64418545 |
| Kurtosis | 174.69581 |
| Mean | 16.423491 |
| Median Absolute Deviation (MAD) | 5 |
| Skewness | 7.8580819 |
| Sum | 45723 |
| Variance | 111.93162 |
| Monotonicity | Not monotonic |
| Value | Count | Frequency (%) |
| 20 | 328 | 11.8% |
| 18 | 184 | 6.6% |
| 16 | 136 | 4.9% |
| 19 | 133 | 4.8% |
| 10 | 133 | 4.8% |
| 12 | 124 | 4.5% |
| 15 | 124 | 4.5% |
| 14 | 123 | 4.4% |
| 13 | 118 | 4.2% |
| 8 | 116 | 4.2% |
| Other values (54) | 1265 |
| Value | Count | Frequency (%) |
| 1 | 19 | 0.7% |
| 2 | 36 | 1.3% |
| 3 | 29 | 1.0% |
| 4 | 68 | |
| 5 | 70 | |
| 6 | 80 | |
| 7 | 95 | |
| 8 | 116 | |
| 9 | 106 | |
| 10 | 133 |
| Value | Count | Frequency (%) |
| 293 | 1 | |
| 121 | 1 | |
| 94 | 1 | |
| 89 | 2 | |
| 86 | 1 | |
| 70 | 1 | |
| 69 | 1 | |
| 64 | 1 | |
| 61 | 1 | |
| 60 | 1 |
First Claim
Categorical
HIGH CARDINALITY  UNIFORM  UNIQUE 
| Distinct | 2784 |
|---|---|
| Distinct (%) | 100.0% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 3.4 MiB |
| 1. A steam cleaning appliance, comprising: a steam generation unit; a steam cleaning applicator; and a flexible steam conduit configured to guide steam from the steam generation unit to a steam inlet for the steam cleaning applicator; wherein the steam cleaning applicator is connectable to the steam conduit; the steam cleaning applicator is rotatable relative to the steam conduit in either rotational direction without loosening the connection of the steam applicator to the steam conduit; the steam cleaning applicator has an end-to-end direction and the steam cleaning applicator is rotatable by at least 360 degrees relative to the steam conduit in either rotational direction about the end-to-end direction of the steam cleaning applicator, without loosening the connection of the steam cleaning applicator to the steam conduit. | 1 |
|---|---|
| 1. A printed substrate manufacturing method of forming solder bumps on a plurality of electrode parts of a printed substrate and mounting a semiconductor chip on the printed substrate via the plurality of solder bumps, comprising: preparing a thermoplastic film to be used as an underfill that covers a surface of the printed substrate on which the solder bumps are formed, wherein parts of the film corresponding to the solder bumps are removed and a peripheral edge of a part of the film on which the semiconductor chip will be mounted has a protruded form for preventing movement of the semiconductor chip on the printed substrate; covering the printed substrate with the film and thereafter bonding the film onto the printed substrate, wherein the parts of the film corresponding to the solder bumps are removed before covering the printed substrate with the film; mounting the semiconductor chip on the printed substrate and carrying the printed substrate into a reflow furnace; and bonding by applying heat and pressure to fuse the solder bumps in the reflow furnace. | 1 |
| 1. A system for filtering particulate matter from exhaust gas, said system comprising: a porous structure having substrate pores of a first mean pore size; a selective catalytic reduction (SCR) washcoat disposed on a surface of the porous structure or within the porous structure to define pores of a second mean pore size; and the second mean pore size is less than the first mean pore size; wherein said washcoat comprises a small pore zeolite promoted with at least one metal selected from the group consisting of Cr, Co, Cu, Fe, Hf, La, Ce, In, V, Mn, Ni, Zn, Ga, Ag, Au, Pt, Pd, and Rh; a NO xabsorber catalyst disposed upstream of the washcoat. | 1 |
| 1. A low back pain treatment tool comprising: a cylindrical casing elongated in a longitudinal direction; a coccyx contact treatment member which is placed through an elastic member so as to be slidably movable in an axial direction of the cylindrical casing; a coccyx contact buffering member which is provided on an upper end of the coccyx contact treatment member; a posture holding member which has a posture holding surface in a longitudinal direction, which faces the cylindrical casing; and a handle fixed to which the posture holding member. | 1 |
| 1. A fail detecting device for a rotation angle sensor, comprising: a cam with a continuously formed cam surface having an actuating surface for reciprocating a push rod and a non-actuating surface that does not reciprocate the push rod, an angle sensor formed of an endless rotary potentiometer for detecting a rotation angle of the cam and having an output voltage increasing in proportion to the rotational angle in a range of 360 degrees, and a controller for detecting a fail state of the angle sensor, said cam is configured to be driven to rotate in one direction by an electric motor controlled by the controller and to reciprocate the push rod; the output voltage of the angle sensor detects: a first region equal to or lower than a first predetermined voltage from 0 degrees to an angle ? 1, and a second region equal to or higher than a second predetermined voltage higher than the first predetermined voltage from 360 degrees to an angle ? 2, said first and second regions being recognized as a dead zone; the controller is configured to drive the rotation of the cam to a predetermined position in the non-actuating surface at a constant speed in transition of the cam surface of the cam abutting against the push rod from a side of the actuating surface to a side of the non-actuating surface; and the angle sensor is configured wherein the dead zone is disposed at a position in the non-actuating surface of the cam and in an area in front of the predetermined position. | 1 |
| Other values (2779) |
Length
| Max length | 9754 |
|---|---|
| Median length | 1629.5 |
| Mean length | 1204.0654 |
| Min length | 84 |
Characters and Unicode
| Total characters | 3352118 |
|---|---|
| Distinct characters | 99 |
| Distinct categories | 14 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 2 ? |
Unique
| Unique | 2784 ? |
|---|---|
| Unique (%) | 100.0% |
Sample
| 1st row | 1. A steam cleaning appliance, comprising: a steam generation unit; a steam cleaning applicator; and a flexible steam conduit configured to guide steam from the steam generation unit to a steam inlet for the steam cleaning applicator; wherein the steam cleaning applicator is connectable to the steam conduit; the steam cleaning applicator is rotatable relative to the steam conduit in either rotational direction without loosening the connection of the steam applicator to the steam conduit; the steam cleaning applicator has an end-to-end direction and the steam cleaning applicator is rotatable by at least 360 degrees relative to the steam conduit in either rotational direction about the end-to-end direction of the steam cleaning applicator, without loosening the connection of the steam cleaning applicator to the steam conduit. |
|---|---|
| 2nd row | 1. A vibration suppressor system for reducing vibrations in a rotating system, comprising: an annular electric motor system provided about an axis of rotation of the rotating system, said annular electric motor system including an annular bearing and a first mass supported within said annular bearing, said first mass guided about said axis of rotation by said annular bearing, wherein said first mass is eccentric, said first mass including a truck being at least partially conductive, said annular electric motor system further including a stator axially spaced-apart, relative to said axis of rotation, from said truck; a control system in communication with said annular electric motor system to control rotation of said first mass about said axis of rotation to reduce in-plane vibration of the rotating system; wherein a second mass is supported within said annular bearing, and wherein said second mass is eccentric; and wherein said control system independently controls rotation of said first and second masses about said axis of rotation. |
| 3rd row | 1. A powder for use in a dry powder inhaler, the powder comprising active particles and carrier particles for carrying the active particles, the powder further including particles of additive material attached to the surfaces of the carrier particles, wherein particles of additive material adhere to the high energy sites on the surfaces of the carrier particles and wherein the powder comprises more than one additive material, wherein the additive material includes one or more surface active materials; wherein additive particles are also present as agglomerates and act as carriers of the active particles and are separate from or separable from the surfaces of the carrier particles with active particles attached to surfaces of the agglomerates. |
| 4th row | 1. A method of assessing the effect of a gene on a cultured dendritic cell, the method comprising: providing a genetically modified cultured es dendritic cell (esDC) expressing a heterologous gene, wherein the genetically modified cultured esDC is a dendritic cell that is obtained by culturing an embryonic stem cell in vitro; providing a cultured es dendritic cell (esDC), wherein the cultured esDC is a dendritic cell that is obtained by culturing an embryonic stem cell in vitro, wherein the cultured esDC is not genetically modified to express the heterologous gene; and assessing an effect of the heterologous gene on the genetically modified cultured esDC by comparing the genetically modified cultured esDC to the cultured esDC. |
| 5th row | 1. Apparatus for generating a cryptographic key, comprising: a memory storing computer executable instructions which, when executed by a processor, cause the processor to: provide a first key which is derived through an authentication procedure, the first key being based on information generated in another apparatus; provide a second key which is changed during a term that the first key is used; generate the cryptographic key based on the first and second keys, the cryptographic key being changed in accordance with the change of the second key; and a processor programmed to execute the stored instructions to output the cryptographic key. |
Common Values
| Value | Count | Frequency (%) |
| 1. A steam cleaning appliance, comprising: a steam generation unit; a steam cleaning applicator; and a flexible steam conduit configured to guide steam from the steam generation unit to a steam inlet for the steam cleaning applicator; wherein the steam cleaning applicator is connectable to the steam conduit; the steam cleaning applicator is rotatable relative to the steam conduit in either rotational direction without loosening the connection of the steam applicator to the steam conduit; the steam cleaning applicator has an end-to-end direction and the steam cleaning applicator is rotatable by at least 360 degrees relative to the steam conduit in either rotational direction about the end-to-end direction of the steam cleaning applicator, without loosening the connection of the steam cleaning applicator to the steam conduit. | 1 | < 0.1% |
| 1. A printed substrate manufacturing method of forming solder bumps on a plurality of electrode parts of a printed substrate and mounting a semiconductor chip on the printed substrate via the plurality of solder bumps, comprising: preparing a thermoplastic film to be used as an underfill that covers a surface of the printed substrate on which the solder bumps are formed, wherein parts of the film corresponding to the solder bumps are removed and a peripheral edge of a part of the film on which the semiconductor chip will be mounted has a protruded form for preventing movement of the semiconductor chip on the printed substrate; covering the printed substrate with the film and thereafter bonding the film onto the printed substrate, wherein the parts of the film corresponding to the solder bumps are removed before covering the printed substrate with the film; mounting the semiconductor chip on the printed substrate and carrying the printed substrate into a reflow furnace; and bonding by applying heat and pressure to fuse the solder bumps in the reflow furnace. | 1 | < 0.1% |
| 1. A system for filtering particulate matter from exhaust gas, said system comprising: a porous structure having substrate pores of a first mean pore size; a selective catalytic reduction (SCR) washcoat disposed on a surface of the porous structure or within the porous structure to define pores of a second mean pore size; and the second mean pore size is less than the first mean pore size; wherein said washcoat comprises a small pore zeolite promoted with at least one metal selected from the group consisting of Cr, Co, Cu, Fe, Hf, La, Ce, In, V, Mn, Ni, Zn, Ga, Ag, Au, Pt, Pd, and Rh; a NO xabsorber catalyst disposed upstream of the washcoat. | 1 | < 0.1% |
| 1. A low back pain treatment tool comprising: a cylindrical casing elongated in a longitudinal direction; a coccyx contact treatment member which is placed through an elastic member so as to be slidably movable in an axial direction of the cylindrical casing; a coccyx contact buffering member which is provided on an upper end of the coccyx contact treatment member; a posture holding member which has a posture holding surface in a longitudinal direction, which faces the cylindrical casing; and a handle fixed to which the posture holding member. | 1 | < 0.1% |
| 1. A fail detecting device for a rotation angle sensor, comprising: a cam with a continuously formed cam surface having an actuating surface for reciprocating a push rod and a non-actuating surface that does not reciprocate the push rod, an angle sensor formed of an endless rotary potentiometer for detecting a rotation angle of the cam and having an output voltage increasing in proportion to the rotational angle in a range of 360 degrees, and a controller for detecting a fail state of the angle sensor, said cam is configured to be driven to rotate in one direction by an electric motor controlled by the controller and to reciprocate the push rod; the output voltage of the angle sensor detects: a first region equal to or lower than a first predetermined voltage from 0 degrees to an angle ? 1, and a second region equal to or higher than a second predetermined voltage higher than the first predetermined voltage from 360 degrees to an angle ? 2, said first and second regions being recognized as a dead zone; the controller is configured to drive the rotation of the cam to a predetermined position in the non-actuating surface at a constant speed in transition of the cam surface of the cam abutting against the push rod from a side of the actuating surface to a side of the non-actuating surface; and the angle sensor is configured wherein the dead zone is disposed at a position in the non-actuating surface of the cam and in an area in front of the predetermined position. | 1 | < 0.1% |
| 1. A computer-implemented method, comprising: receiving, by a first computing device, data packets that were transmitted by a second computing device as part of a first data transmission of multiple data packets; identifying, by the first computing device, at least some of the received data packets as being data packets for which the first computing device should send, for receipt by the second computing device, an acknowledgement that the at least some of the received data packets were successfully received by the first computing device; and sending, by the first computing device and for receipt by the second computing device, a second data transmission that includes, as the acknowledgment that the at least some of the received data packets were successfully received by the first computing device: (i) a multi-bit identification of one of the multiple data packets in the first data transmission, and (ii) multiple bits, each of the multiple bits representing an acknowledgment or non-acknowledgment of a data packet in the first data transmission of multiple data packets, wherein the second data transmission includes, for each of the at least some of the received data packets, a bit that represents an acknowledgement of the respective data packet. | 1 | < 0.1% |
| 1. An electric storage element, comprising: a casing; an external terminal comprising a surface exposed outward from the casing; a current collector provided inside the casing and connected to the external terminal; and an electrode assembly provided inside the casing and connected to the current collector, wherein the casing comprises a through hole, and wherein the external terminal includes: a flange in contact with an outer surface of the casing; and a first shaft extending from the flange to be inserted into the through hole in the casing and directly welded to the casing. | 1 | < 0.1% |
| 1. A modular visualization display panel, comprising: a modular stackup arrangement of the modular visualization display panel comprising a logic module enclosure that physically couples to a communication module enclosure to form the modular stackup arrangement, the logic module enclosure having a connection to an electrical ground for at least discharging electrostatic discharge (ESD) energy of ESD events of the modular visualization display panel; the logic module enclosure configured to enclose first processing circuitry and comprising at least one generally flat surface to electrically couple to the communication module enclosure for at least receiving portions of the ESD energy received at the communication module enclosure; the communication module enclosure configured to enclose second processing circuitry and having at least one surface with a plurality of raised contact nodes arranged on the one surface of the communication module enclosure such that when in contact with the one generally flat surface of the logic module enclosure, at least the portions of the ESD energy is directed over ones of the raised contact nodes to the one generally flat surface of the logic module enclosure for discharging the portions of the ESD energy through the electrical ground of the logic module enclosure. | 1 | < 0.1% |
| 1. A method for guaranteeing continuity of communications operated from several fourth-generation mobile terminals connected to a radio network provided with several base stations with which each of said several fourth-generation mobile terminals is configured to communicate, wherein each said base station is connected to a controller from among several controllers linking said radio network to an interconnection network comprising routers operating at an IP layer level, wherein said controllers are connected to at least one gateway from among a plurality of gateways, wherein each of said plurality of gateways is connected to at least one of said routers, wherein each of said at least one gateway has at least two different IP addresses, of which a first IP address is known to the fourth-generation mobile terminals of the radio network and of which a second IP address is known to the routers of the interconnection network, wherein said first IP address is the same for all the plurality of gateways of the radio network, and wherein each fourth-generation mobile terminal is associated with at least one base station and with at least one gateway connected to the controller to which said at least one base station is connected, the method comprising: establishing, for each of said plurality of gateways, a match list between the IP address of each fourth-generation mobile terminal connected to the radio network and said second IP address of said associated gateway by: transmitting, when a particular fourth-generation mobile terminal connects to a particular base station connected to a first controller to which the particular fourth-generation mobile terminal was not affiliated previously, a level-2 message comprising at least the IP address of the particular fourth-generation mobile terminal, said transmitting being carried out by the first controller or said associated gateway; creating, at said associated gateway, an IP message comprising the IP address of said particular fourth-generation mobile terminal and the second IP address of said associated gateway in the interconnection network; and broadcasting said IP message by said associated gateway to destination gateways associated with other controllers, wherein each of said destination gateways stores a correspondence between the IP address of the particular fourth-generation mobile terminal and the second IP address of the associated gateway that is carrying out said broadcasting associated with the controller to which the particular fourth-generation mobile terminal is affiliated; and routing IP packets in the interconnection network by: transmitting systematically all the IP packets arising from the controller to said associated gateway; and encapsulating, by said associated gateway, each of said IP packets in respective IP packets of a higher level using said match list, wherein a destination IP address of each of said higher level IP packets is the second IP address corresponding to a destination gateway, and wherein each fourth-generation mobile terminal has an IP address that does not change when said fourth-generation mobile terminal passes from the first controller to another controller. | 1 | < 0.1% |
| 1. A control device comprising: a search request receiving unit that receives a request to search for a first operation screen registered in a second image forming apparatus connected to a first image forming apparatus; a search unit that searches for the first operation screen among operation screens registered in the second image forming apparatus; a display control unit that controls to display the first operation screen on a display device provided in the first image forming apparatus; a receiving unit that receives an instruction for the second image forming apparatus having the first operation screen registered therein from a user through the first operation screen displayed on the display device; and a transmitting unit that transmits the instruction received from the user through the first operation screen to the second image forming apparatus having the first operation screen registered therein, wherein the first operation screen is an execution screen for executing a function that is unavailable in the first image forming apparatus, and when the function that is unavailable in the first image forming apparatus is selected on a menu screen registered in the first image forming apparatus, the display control unit controls to display the first operation screen registered on a display device provided in the second image forming apparatus. | 1 | < 0.1% |
| Other values (2774) | 2774 |
Length
| Value | Count | Frequency (%) |
| the | 48175 | 9.0% |
| a | 32917 | 6.1% |
| of | 22408 | 4.2% |
| and | 16770 | 3.1% |
| to | 14347 | 2.7% |
| first | 7797 | 1.5% |
| an | 6812 | 1.3% |
| in | 6774 | 1.3% |
| said | 6277 | 1.2% |
| is | 6244 | 1.2% |
| Other values (15501) | 366949 |
Most occurring characters
| Value | Count | Frequency (%) |
| 532914 | ||
| e | 331452 | 9.9% |
| t | 257553 | 7.7% |
| a | 224263 | 6.7% |
| i | 223769 | 6.7% |
| n | 213514 | 6.4% |
| o | 207410 | 6.2% |
| r | 182536 | 5.4% |
| s | 152784 | 4.6% |
| c | 115454 | 3.4% |
| Other values (89) | 910469 |
Most occurring categories
| Value | Count | Frequency (%) |
| Lowercase Letter | 2709350 | |
| Space Separator | 532914 | 15.9% |
| Other Punctuation | 43619 | 1.3% |
| Uppercase Letter | 20998 | 0.6% |
| Control | 16461 | 0.5% |
| Decimal Number | 14435 | 0.4% |
| Dash Punctuation | 6246 | 0.2% |
| Close Punctuation | 3952 | 0.1% |
| Open Punctuation | 3556 | 0.1% |
| Math Symbol | 344 | < 0.1% |
| Other values (4) | 243 | < 0.1% |
Most frequent character per category
Lowercase Letter
| Value | Count | Frequency (%) |
| e | 331452 | |
| t | 257553 | 9.5% |
| a | 224263 | 8.3% |
| i | 223769 | 8.3% |
| n | 213514 | 7.9% |
| o | 207410 | 7.7% |
| r | 182536 | 6.7% |
| s | 152784 | 5.6% |
| c | 115454 | 4.3% |
| d | 113492 | 4.2% |
| Other values (16) | 687123 |
Uppercase Letter
| Value | Count | Frequency (%) |
| A | 3704 | |
| C | 2043 | 9.7% |
| R | 1367 | 6.5% |
| I | 1339 | 6.4% |
| P | 1236 | 5.9% |
| S | 1219 | 5.8% |
| D | 1209 | 5.8% |
| O | 935 | 4.5% |
| M | 927 | 4.4% |
| N | 856 | 4.1% |
| Other values (16) | 6163 |
Other Punctuation
| Value | Count | Frequency (%) |
| , | 21378 | |
| ; | 9975 | |
| . | 6577 | 15.1% |
| : | 3611 | 8.3% |
| ? | 811 | 1.9% |
| / | 616 | 1.4% |
| % | 452 | 1.0% |
| ' | 146 | 0.3% |
| * | 29 | 0.1% |
| · | 24 | 0.1% |
Decimal Number
| Value | Count | Frequency (%) |
| 1 | 5398 | |
| 0 | 2689 | |
| 2 | 1915 | 13.3% |
| 3 | 1075 | 7.4% |
| 5 | 924 | 6.4% |
| 4 | 789 | 5.5% |
| 6 | 574 | 4.0% |
| 8 | 429 | 3.0% |
| 7 | 326 | 2.3% |
| 9 | 316 | 2.2% |
Control
| Value | Count | Frequency (%) |
| 16029 | ||
| | 371 | 2.3% |
| | 28 | 0.2% |
| | 28 | 0.2% |
| | 3 | < 0.1% |
| | 1 | < 0.1% |
| | 1 | < 0.1% |
Math Symbol
| Value | Count | Frequency (%) |
| + | 112 | |
| = | 79 | |
| × | 52 | |
| < | 50 | |
| ± | 29 | 8.4% |
| > | 20 | 5.8% |
| | | 2 | 0.6% |
Close Punctuation
| Value | Count | Frequency (%) |
| ) | 3902 | |
| ] | 39 | 1.0% |
| } | 11 | 0.3% |
Open Punctuation
| Value | Count | Frequency (%) |
| ( | 3506 | |
| [ | 39 | 1.1% |
| { | 11 | 0.3% |
Other Number
| Value | Count | Frequency (%) |
| ¼ | 10 | |
| ½ | 5 |
Space Separator
| Value | Count | Frequency (%) |
| 532914 |
Dash Punctuation
| Value | Count | Frequency (%) |
| - | 6246 |
Other Symbol
| Value | Count | Frequency (%) |
| ° | 218 |
Connector Punctuation
| Value | Count | Frequency (%) |
| _ | 6 |
Modifier Symbol
| Value | Count | Frequency (%) |
| ^ | 4 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Latin | 2730348 | |
| Common | 621770 | 18.5% |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| e | 331452 | |
| t | 257553 | 9.4% |
| a | 224263 | 8.2% |
| i | 223769 | 8.2% |
| n | 213514 | 7.8% |
| o | 207410 | 7.6% |
| r | 182536 | 6.7% |
| s | 152784 | 5.6% |
| c | 115454 | 4.2% |
| d | 113492 | 4.2% |
| Other values (42) | 708121 |
Common
| Value | Count | Frequency (%) |
| 532914 | ||
| , | 21378 | 3.4% |
| 16029 | 2.6% | |
| ; | 9975 | 1.6% |
| . | 6577 | 1.1% |
| - | 6246 | 1.0% |
| 1 | 5398 | 0.9% |
| ) | 3902 | 0.6% |
| : | 3611 | 0.6% |
| ( | 3506 | 0.6% |
| Other values (37) | 12234 | 2.0% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 3351348 | |
| None | 770 | < 0.1% |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 532914 | ||
| e | 331452 | 9.9% |
| t | 257553 | 7.7% |
| a | 224263 | 6.7% |
| i | 223769 | 6.7% |
| n | 213514 | 6.4% |
| o | 207410 | 6.2% |
| r | 182536 | 5.4% |
| s | 152784 | 4.6% |
| c | 115454 | 3.4% |
| Other values (77) | 909699 |
None
| Value | Count | Frequency (%) |
| | 371 | |
| ° | 218 | |
| × | 52 | 6.8% |
| ± | 29 | 3.8% |
| | 28 | 3.6% |
| | 28 | 3.6% |
| · | 24 | 3.1% |
| ¼ | 10 | 1.3% |
| ½ | 5 | 0.6% |
| | 3 | 0.4% |
| Other values (2) | 2 | 0.3% |
Independent Claims
Categorical
HIGH CARDINALITY  UNIFORM  UNIQUE 
| Distinct | 2784 |
|---|---|
| Distinct (%) | 100.0% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 8.0 MiB |
| 1. A steam cleaning appliance, comprising: a steam generation unit; a steam cleaning applicator; and a flexible steam conduit configured to guide steam from the steam generation unit to a steam inlet for the steam cleaning applicator; wherein the steam cleaning applicator is connectable to the steam conduit; the steam cleaning applicator is rotatable relative to the steam conduit in either rotational direction without loosening the connection of the steam applicator to the steam conduit; the steam cleaning applicator has an end-to-end direction and the steam cleaning applicator is rotatable by at least 360 degrees relative to the steam conduit in either rotational direction about the end-to-end direction of the steam cleaning applicator, without loosening the connection of the steam cleaning applicator to the steam conduit. | 1 |
|---|---|
| 1. A printed substrate manufacturing method of forming solder bumps on a plurality of electrode parts of a printed substrate and mounting a semiconductor chip on the printed substrate via the plurality of solder bumps, comprising: preparing a thermoplastic film to be used as an underfill that covers a surface of the printed substrate on which the solder bumps are formed, wherein parts of the film corresponding to the solder bumps are removed and a peripheral edge of a part of the film on which the semiconductor chip will be mounted has a protruded form for preventing movement of the semiconductor chip on the printed substrate; covering the printed substrate with the film and thereafter bonding the film onto the printed substrate, wherein the parts of the film corresponding to the solder bumps are removed before covering the printed substrate with the film; mounting the semiconductor chip on the printed substrate and carrying the printed substrate into a reflow furnace; and bonding by applying heat and pressure to fuse the solder bumps in the reflow furnace. | 2. A method of manufacturing a printed substrate comprising steps of: preparing an underfill film by forming a plurality of holes through the film and forming at least one protruded form on a peripheral edge of the film, wherein the at least one protruded form is disposed on a first surface of the film, and the at least one protruded form extends away from the first surface of the film; after preparing the film, covering a printed substrate with the film by aligning a plurality of solder bumps on the printed substrate with the plurality of holes through the film and thereafter bonding the film onto the printed substrate; placing a semiconductor chip on the printed substrate via the plurality of solder bumps and carrying the printed substrate into a reflow furnace; and applying heat and pressure in the reflow furnace to adhere the semiconductor chip to the printed substrate. | 1 |
| 1. A system for filtering particulate matter from exhaust gas, said system comprising: a porous structure having substrate pores of a first mean pore size; a selective catalytic reduction (SCR) washcoat disposed on a surface of the porous structure or within the porous structure to define pores of a second mean pore size; and the second mean pore size is less than the first mean pore size; wherein said washcoat comprises a small pore zeolite promoted with at least one metal selected from the group consisting of Cr, Co, Cu, Fe, Hf, La, Ce, In, V, Mn, Ni, Zn, Ga, Ag, Au, Pt, Pd, and Rh; a NO x absorber catalyst disposed upstream of the washcoat. | 1 |
| 1. A low back pain treatment tool comprising: a cylindrical casing elongated in a longitudinal direction; a coccyx contact treatment member which is placed through an elastic member so as to be slidably movable in an axial direction of the cylindrical casing; a coccyx contact buffering member which is provided on an upper end of the coccyx contact treatment member; a posture holding member which has a posture holding surface in a longitudinal direction, which faces the cylindrical casing; and a handle fixed to which the posture holding member. | 4. A low back pain treatment tool comprising: a cylindrical casing elongated in a longitudinal direction; a coccyx contact treatment member which is slidably placed through an elastic member in an axial direction of the cylindrical casing; a coccyx contact buffering member which is provided on an upper end of the coccyx contact treatment member; a posture holding member having a posture holding surface in a longitudinal direction, which faces the cylindrical casing; a handle fixed to the posture holding member; a horizontal seat plate which fixes and supports the cylindrical casing on the posture holding member by being fixed vertically with respect to the posture holding surface and coupling a lower end of the cylindrical casing to an upper surface of the horizontal seat plate; a horizontal base plate which fixes the posture holding member; a pair of left and right side plates which are fixed orthogonally to a horizontal surface of the base plate and the posture holding surface, and which support left and right sides of the horizontal base plate respectively; corner portions formed by an outer surface of either of the side plates, the posture holding surface, and a horizontal surface of the base plate; and rectangular parallelepiped foot rest blocks which are detachably placed at the corner portions. | 1 |
| 1. A fail detecting device for a rotation angle sensor, comprising: a cam with a continuously formed cam surface having an actuating surface for reciprocating a push rod and a non-actuating surface that does not reciprocate the push rod, an angle sensor formed of an endless rotary potentiometer for detecting a rotation angle of the cam and having an output voltage increasing in proportion to the rotational angle in a range of 360 degrees, and a controller for detecting a fail state of the angle sensor, said cam is configured to be driven to rotate in one direction by an electric motor controlled by the controller and to reciprocate the push rod; the output voltage of the angle sensor detects: a first region equal to or lower than a first predetermined voltage from 0 degrees to an angle ? 1 , and a second region equal to or higher than a second predetermined voltage higher than the first predetermined voltage from 360 degrees to an angle ? 2 , said first and second regions being recognized as a dead zone; the controller is configured to drive the rotation of the cam to a predetermined position in the non-actuating surface at a constant speed in transition of the cam surface of the cam abutting against the push rod from a side of the actuating surface to a side of the non-actuating surface; and the angle sensor is configured wherein the dead zone is disposed at a position in the non-actuating surface of the cam and in an area in front of the predetermined position. | 11. A fail detecting device for a rotation angle sensor comprising: a cam having a continuously formed cam surface with an actuating surface for imparting motion to reciprocates a push rod and a non-actuating surface that does not impart motion to reciprocate the push rod; an angle sensor formed of an endless rotary potentiometer for detecting an angle of rotation of the cam and having an output voltage increasing in proportion to the rotational angle in a range of 360 degrees; a controller for detecting a fail state of the angle sensor; said cam being configured to be driven to rotate in one direction by a motor controlled by the controller to reciprocate the push rod; and the output voltage of the angle sensor detects: a first region equal to or lower than a first predetermined voltage from 0 degrees to an angle ? 1 , and a second region equal to or higher than a second predetermined voltage higher than the first predetermined voltage from 360 degrees to an angle ? 2 , said dead zone is defined by the first and second regions; said controller being configured to drive the rotation of the cam to a predetermined position relative to the non-actuating surface at a constant speed in transition of the cam surface of the cam abutting against the push rod from a side of the actuating surface to a side of the non-actuating surface; said angle sensor being configured wherein the dead zone is disposed at a position in the non-actuating surface of the cam and in an area in front of the predetermined position. | 1 |
| Other values (2779) |
Length
| Max length | 26949 |
|---|---|
| Median length | 3351 |
| Mean length | 2953.713 |
| Min length | 84 |
Characters and Unicode
| Total characters | 8223137 |
|---|---|
| Distinct characters | 102 |
| Distinct categories | 14 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 2 ? |
Unique
| Unique | 2784 ? |
|---|---|
| Unique (%) | 100.0% |
Sample
| 1st row | 1. A steam cleaning appliance, comprising: a steam generation unit; a steam cleaning applicator; and a flexible steam conduit configured to guide steam from the steam generation unit to a steam inlet for the steam cleaning applicator; wherein the steam cleaning applicator is connectable to the steam conduit; the steam cleaning applicator is rotatable relative to the steam conduit in either rotational direction without loosening the connection of the steam applicator to the steam conduit; the steam cleaning applicator has an end-to-end direction and the steam cleaning applicator is rotatable by at least 360 degrees relative to the steam conduit in either rotational direction about the end-to-end direction of the steam cleaning applicator, without loosening the connection of the steam cleaning applicator to the steam conduit. |
|---|---|
| 2nd row | 1. A vibration suppressor system for reducing vibrations in a rotating system, comprising: an annular electric motor system provided about an axis of rotation of the rotating system, said annular electric motor system including an annular bearing and a first mass supported within said annular bearing, said first mass guided about said axis of rotation by said annular bearing, wherein said first mass is eccentric, said first mass including a truck being at least partially conductive, said annular electric motor system further including a stator axially spaced-apart, relative to said axis of rotation, from said truck; a control system in communication with said annular electric motor system to control rotation of said first mass about said axis of rotation to reduce in-plane vibration of the rotating system; wherein a second mass is supported within said annular bearing, and wherein said second mass is eccentric; and wherein said control system independently controls rotation of said first and second masses about said axis of rotation. | 9. A vibration suppressor system for reducing vibrations in a rotating system, comprising: an annular electric motor system provided about an axis of rotation of the rotating system, said annular electric motor system including an annular bearing and a first mass supported within said annular bearing, said first mass guided about said axis of rotation by said annular bearing, wherein said first mass is eccentric, and wherein said axis of rotation intersects said first mass; and a control system in communication with said annular electric motor system to control rotation of said first mass about said axis of rotation to reduce in-plane vibration of the rotating system; wherein a second mass is supported within said annular bearing, wherein said second mass is eccentric, and wherein said axis of rotation intersects said second mass; and wherein said control system independently controls rotation of said first and second masses about said axis of rotation. | 12. A vibration suppressor system for reducing vibrations in a rotating system, comprising: an annular electric motor system provided about an axis of rotation of the rotating system, said annular electric motor system including an annular bearing and first and second masses supported within said annular bearing, said first and second masses guided about said axis of rotation by said annular bearing, wherein said first and second masses are eccentric, said first and second masses each including a truck which is at least partially conductive, said annular electric motor system further including at least one stator axially spaced-apart, relative to said axis of rotation, from said trucks; a control system in communication with said annular electric motor system to control rotation of said first and second masses about said axis of rotation to reduce in-plane vibration of the rotating system; and wherein said first and second masses are disk-shaped and each span substantially an entirety of an inner diameter of said annular bearing. |
| 3rd row | 1. A powder for use in a dry powder inhaler, the powder comprising active particles and carrier particles for carrying the active particles, the powder further including particles of additive material attached to the surfaces of the carrier particles, wherein particles of additive material adhere to the high energy sites on the surfaces of the carrier particles and wherein the powder comprises more than one additive material, wherein the additive material includes one or more surface active materials; wherein additive particles are also present as agglomerates and act as carriers of the active particles and are separate from or separable from the surfaces of the carrier particles with active particles attached to surfaces of the agglomerates. | 18. A powder for use in a dry powder inhaler, the powder including additive and carrier particles for carrying the additive particles, the powder further including active particles which adhere to the additive particles on the carrier particles, wherein the additive material is magnesium stearate, wherein the additive material is present in an amount of not more than 1% by weight based on the weight of the powder; wherein additive particles are also present as agglomerates and act as carriers of the active particles and are separate from or separable from the surfaces of the carrier particles with active particles attached to surfaces of the agglomerates. | 24. A powder for use in a dry powder inhaler, the powder comprising: active particles; carrier particles for carrying the active particles; and particles of additive material attached to surfaces of the carrier particles; wherein the particles of additive material adhere to high energy sites on the surfaces of the carrier particles and provide a discontinuous covering for the carrier particles, wherein the powder comprises more than one additive material in the form of a powder, and wherein the additive material includes one or more surface active materials; wherein additive particles are also present as agglomerates and act as carriers of the active particles and are separate from or separable from the surfaces of the carrier particles with active particles attached to surfaces of the agglomerates. |
| 4th row | 1. A method of assessing the effect of a gene on a cultured dendritic cell, the method comprising: providing a genetically modified cultured es dendritic cell (esDC) expressing a heterologous gene, wherein the genetically modified cultured esDC is a dendritic cell that is obtained by culturing an embryonic stem cell in vitro; providing a cultured es dendritic cell (esDC), wherein the cultured esDC is a dendritic cell that is obtained by culturing an embryonic stem cell in vitro, wherein the cultured esDC is not genetically modified to express the heterologous gene; and assessing an effect of the heterologous gene on the genetically modified cultured esDC by comparing the genetically modified cultured esDC to the cultured esDC. |
| 5th row | 1. Apparatus for generating a cryptographic key, comprising: a memory storing computer executable instructions which, when executed by a processor, cause the processor to: provide a first key which is derived through an authentication procedure, the first key being based on information generated in another apparatus; provide a second key which is changed during a term that the first key is used; generate the cryptographic key based on the first and second keys, the cryptographic key being changed in accordance with the change of the second key; and a processor programmed to execute the stored instructions to output the cryptographic key. | 13. Apparatus for generating a cryptographic key, comprising: circuitry configured to generate a cryptographic key based on first and second keys; and a memory storing computer executable instructions which, when executed by a processor, cause the processor to: provide the first key which is derived through an authentication procedure, the first key being based on information generated in another apparatus; and provide the second key which is changed during a term that the first key is used. | 25. An information processing system comprising: a memory storing computer executable instructions which, when executed by an information processing apparatus, cause the information processing apparatus to: provide a first key which is derived through an authentication procedure, the first key being based on information generated in another apparatus; provide a second key which is changed during a term that the first key is used; and generate the cryptographic key based on the first and second keys, the cryptographic key being changed in accordance with the change of the second key. |
Common Values
| Value | Count | Frequency (%) |
| 1. A steam cleaning appliance, comprising: a steam generation unit; a steam cleaning applicator; and a flexible steam conduit configured to guide steam from the steam generation unit to a steam inlet for the steam cleaning applicator; wherein the steam cleaning applicator is connectable to the steam conduit; the steam cleaning applicator is rotatable relative to the steam conduit in either rotational direction without loosening the connection of the steam applicator to the steam conduit; the steam cleaning applicator has an end-to-end direction and the steam cleaning applicator is rotatable by at least 360 degrees relative to the steam conduit in either rotational direction about the end-to-end direction of the steam cleaning applicator, without loosening the connection of the steam cleaning applicator to the steam conduit. | 1 | < 0.1% |
| 1. A printed substrate manufacturing method of forming solder bumps on a plurality of electrode parts of a printed substrate and mounting a semiconductor chip on the printed substrate via the plurality of solder bumps, comprising: preparing a thermoplastic film to be used as an underfill that covers a surface of the printed substrate on which the solder bumps are formed, wherein parts of the film corresponding to the solder bumps are removed and a peripheral edge of a part of the film on which the semiconductor chip will be mounted has a protruded form for preventing movement of the semiconductor chip on the printed substrate; covering the printed substrate with the film and thereafter bonding the film onto the printed substrate, wherein the parts of the film corresponding to the solder bumps are removed before covering the printed substrate with the film; mounting the semiconductor chip on the printed substrate and carrying the printed substrate into a reflow furnace; and bonding by applying heat and pressure to fuse the solder bumps in the reflow furnace. | 2. A method of manufacturing a printed substrate comprising steps of: preparing an underfill film by forming a plurality of holes through the film and forming at least one protruded form on a peripheral edge of the film, wherein the at least one protruded form is disposed on a first surface of the film, and the at least one protruded form extends away from the first surface of the film; after preparing the film, covering a printed substrate with the film by aligning a plurality of solder bumps on the printed substrate with the plurality of holes through the film and thereafter bonding the film onto the printed substrate; placing a semiconductor chip on the printed substrate via the plurality of solder bumps and carrying the printed substrate into a reflow furnace; and applying heat and pressure in the reflow furnace to adhere the semiconductor chip to the printed substrate. | 1 | < 0.1% |
| 1. A system for filtering particulate matter from exhaust gas, said system comprising: a porous structure having substrate pores of a first mean pore size; a selective catalytic reduction (SCR) washcoat disposed on a surface of the porous structure or within the porous structure to define pores of a second mean pore size; and the second mean pore size is less than the first mean pore size; wherein said washcoat comprises a small pore zeolite promoted with at least one metal selected from the group consisting of Cr, Co, Cu, Fe, Hf, La, Ce, In, V, Mn, Ni, Zn, Ga, Ag, Au, Pt, Pd, and Rh; a NO x absorber catalyst disposed upstream of the washcoat. | 1 | < 0.1% |
| 1. A low back pain treatment tool comprising: a cylindrical casing elongated in a longitudinal direction; a coccyx contact treatment member which is placed through an elastic member so as to be slidably movable in an axial direction of the cylindrical casing; a coccyx contact buffering member which is provided on an upper end of the coccyx contact treatment member; a posture holding member which has a posture holding surface in a longitudinal direction, which faces the cylindrical casing; and a handle fixed to which the posture holding member. | 4. A low back pain treatment tool comprising: a cylindrical casing elongated in a longitudinal direction; a coccyx contact treatment member which is slidably placed through an elastic member in an axial direction of the cylindrical casing; a coccyx contact buffering member which is provided on an upper end of the coccyx contact treatment member; a posture holding member having a posture holding surface in a longitudinal direction, which faces the cylindrical casing; a handle fixed to the posture holding member; a horizontal seat plate which fixes and supports the cylindrical casing on the posture holding member by being fixed vertically with respect to the posture holding surface and coupling a lower end of the cylindrical casing to an upper surface of the horizontal seat plate; a horizontal base plate which fixes the posture holding member; a pair of left and right side plates which are fixed orthogonally to a horizontal surface of the base plate and the posture holding surface, and which support left and right sides of the horizontal base plate respectively; corner portions formed by an outer surface of either of the side plates, the posture holding surface, and a horizontal surface of the base plate; and rectangular parallelepiped foot rest blocks which are detachably placed at the corner portions. | 1 | < 0.1% |
| 1. A fail detecting device for a rotation angle sensor, comprising: a cam with a continuously formed cam surface having an actuating surface for reciprocating a push rod and a non-actuating surface that does not reciprocate the push rod, an angle sensor formed of an endless rotary potentiometer for detecting a rotation angle of the cam and having an output voltage increasing in proportion to the rotational angle in a range of 360 degrees, and a controller for detecting a fail state of the angle sensor, said cam is configured to be driven to rotate in one direction by an electric motor controlled by the controller and to reciprocate the push rod; the output voltage of the angle sensor detects: a first region equal to or lower than a first predetermined voltage from 0 degrees to an angle ? 1 , and a second region equal to or higher than a second predetermined voltage higher than the first predetermined voltage from 360 degrees to an angle ? 2 , said first and second regions being recognized as a dead zone; the controller is configured to drive the rotation of the cam to a predetermined position in the non-actuating surface at a constant speed in transition of the cam surface of the cam abutting against the push rod from a side of the actuating surface to a side of the non-actuating surface; and the angle sensor is configured wherein the dead zone is disposed at a position in the non-actuating surface of the cam and in an area in front of the predetermined position. | 11. A fail detecting device for a rotation angle sensor comprising: a cam having a continuously formed cam surface with an actuating surface for imparting motion to reciprocates a push rod and a non-actuating surface that does not impart motion to reciprocate the push rod; an angle sensor formed of an endless rotary potentiometer for detecting an angle of rotation of the cam and having an output voltage increasing in proportion to the rotational angle in a range of 360 degrees; a controller for detecting a fail state of the angle sensor; said cam being configured to be driven to rotate in one direction by a motor controlled by the controller to reciprocate the push rod; and the output voltage of the angle sensor detects: a first region equal to or lower than a first predetermined voltage from 0 degrees to an angle ? 1 , and a second region equal to or higher than a second predetermined voltage higher than the first predetermined voltage from 360 degrees to an angle ? 2 , said dead zone is defined by the first and second regions; said controller being configured to drive the rotation of the cam to a predetermined position relative to the non-actuating surface at a constant speed in transition of the cam surface of the cam abutting against the push rod from a side of the actuating surface to a side of the non-actuating surface; said angle sensor being configured wherein the dead zone is disposed at a position in the non-actuating surface of the cam and in an area in front of the predetermined position. | 1 | < 0.1% |
| 1. A computer-implemented method, comprising: receiving, by a first computing device, data packets that were transmitted by a second computing device as part of a first data transmission of multiple data packets; identifying, by the first computing device, at least some of the received data packets as being data packets for which the first computing device should send, for receipt by the second computing device, an acknowledgement that the at least some of the received data packets were successfully received by the first computing device; and sending, by the first computing device and for receipt by the second computing device, a second data transmission that includes, as the acknowledgment that the at least some of the received data packets were successfully received by the first computing device: (i) a multi-bit identification of one of the multiple data packets in the first data transmission, and (ii) multiple bits, each of the multiple bits representing an acknowledgment or non-acknowledgment of a data packet in the first data transmission of multiple data packets, wherein the second data transmission includes, for each of the at least some of the received data packets, a bit that represents an acknowledgement of the respective data packet. | 11. A computer-readable non-transitory medium including instructions that, when executed by one or more computer processors, cause performance of operations that comprise: receiving, by a first computing device, data packets that were transmitted by a second computing device as part of a first data transmission of multiple data packets; identifying, by the first computing device, at least some of the received data packets as being data packets for which the first computing device should send, for receipt by the second computing device, an acknowledgement that the at least some of the received data packets were successfully received by the first computing device; and sending, by the first computing device and for receipt by the second computing device, a second data transmission that includes, as the acknowledgment that the at least some of the received data packets were successfully received by the first computing device: (i) a multi-bit identification of one of the multiple data packets in the first data transmission, and (ii) multiple bits, each of the multiple bits representing an acknowledgment or non-acknowledgment of a data packet in the first data transmission of multiple data packets, wherein the second data transmission includes, for each of the at least some of the received data packets, a bit that represents an acknowledgement of the respective data packet. | 1 | < 0.1% |
| 1. An electric storage element, comprising: a casing; an external terminal comprising a surface exposed outward from the casing; a current collector provided inside the casing and connected to the external terminal; and an electrode assembly provided inside the casing and connected to the current collector, wherein the casing comprises a through hole, and wherein the external terminal includes: a flange in contact with an outer surface of the casing; and a first shaft extending from the flange to be inserted into the through hole in the casing and directly welded to the casing. | 1 | < 0.1% |
| 1. A modular visualization display panel, comprising: a modular stackup arrangement of the modular visualization display panel comprising a logic module enclosure that physically couples to a communication module enclosure to form the modular stackup arrangement, the logic module enclosure having a connection to an electrical ground for at least discharging electrostatic discharge (ESD) energy of ESD events of the modular visualization display panel; the logic module enclosure configured to enclose first processing circuitry and comprising at least one generally flat surface to electrically couple to the communication module enclosure for at least receiving portions of the ESD energy received at the communication module enclosure; the communication module enclosure configured to enclose second processing circuitry and having at least one surface with a plurality of raised contact nodes arranged on the one surface of the communication module enclosure such that when in contact with the one generally flat surface of the logic module enclosure, at least the portions of the ESD energy is directed over ones of the raised contact nodes to the one generally flat surface of the logic module enclosure for discharging the portions of the ESD energy through the electrical ground of the logic module enclosure. | 1 | < 0.1% |
| 1. A method for guaranteeing continuity of communications operated from several fourth-generation mobile terminals connected to a radio network provided with several base stations with which each of said several fourth-generation mobile terminals is configured to communicate, wherein each said base station is connected to a controller from among several controllers linking said radio network to an interconnection network comprising routers operating at an IP layer level, wherein said controllers are connected to at least one gateway from among a plurality of gateways, wherein each of said plurality of gateways is connected to at least one of said routers, wherein each of said at least one gateway has at least two different IP addresses, of which a first IP address is known to the fourth-generation mobile terminals of the radio network and of which a second IP address is known to the routers of the interconnection network, wherein said first IP address is the same for all the plurality of gateways of the radio network, and wherein each fourth-generation mobile terminal is associated with at least one base station and with at least one gateway connected to the controller to which said at least one base station is connected, the method comprising: establishing, for each of said plurality of gateways, a match list between the IP address of each fourth-generation mobile terminal connected to the radio network and said second IP address of said associated gateway by: transmitting, when a particular fourth-generation mobile terminal connects to a particular base station connected to a first controller to which the particular fourth-generation mobile terminal was not affiliated previously, a level-2 message comprising at least the IP address of the particular fourth-generation mobile terminal, said transmitting being carried out by the first controller or said associated gateway; creating, at said associated gateway, an IP message comprising the IP address of said particular fourth-generation mobile terminal and the second IP address of said associated gateway in the interconnection network; and broadcasting said IP message by said associated gateway to destination gateways associated with other controllers, wherein each of said destination gateways stores a correspondence between the IP address of the particular fourth-generation mobile terminal and the second IP address of the associated gateway that is carrying out said broadcasting associated with the controller to which the particular fourth-generation mobile terminal is affiliated; and routing IP packets in the interconnection network by: transmitting systematically all the IP packets arising from the controller to said associated gateway; and encapsulating, by said associated gateway, each of said IP packets in respective IP packets of a higher level using said match list, wherein a destination IP address of each of said higher level IP packets is the second IP address corresponding to a destination gateway, and wherein each fourth-generation mobile terminal has an IP address that does not change when said fourth-generation mobile terminal passes from the first controller to another controller. | 6. A system for guaranteeing continuity of communications operated from several fourth-generation mobile terminals, the system comprising: a radio network including a plurality of base stations with which said fourth-generation mobile terminals are configured to communicate; an interconnection network comprising routers operating at an IP layer level; a plurality of controllers, each of said base stations being connected to one of said plurality of controllers, said plurality of controllers linking said radio network to said interconnection network; and a plurality of gateways, wherein each of said controllers is connected to at least one gateway of said plurality of gateways, wherein each of said plurality of gateways receives IP packets arising from the radio network, wherein each of said plurality of gateways has at least two different IP addresses, of which a first IP address is known to the base stations of the radio network and of which a second IP address is known to the routers of the interconnection network, wherein said first IP address is the same for all gateways of said plurality of gateways of the radio network, wherein each fourth-generation mobile terminal is associated with at least one base station and with at least one gateway connected to the controller to which said at least one base station is connected, wherein each of said plurality of gateways establishes a match list between the IP address of each fourth-generation mobile terminal connected to the radio network and said second IP address of said associated gateway by: transmitting, when a particular fourth-generation mobile terminal connects to a particular base station connected to a first controller to which the particular fourth-generation mobile terminal was not affiliated previously, a level-2 message comprising at least the IP address of the particular fourth-generation mobile terminal, said transmitting being carried out by the first controller or said associated gateway; creating, at said associated gateway, an IP message comprising the IP address of said particular fourth-generation mobile terminal and the second IP address of said associated gateway in the interconnection network; and broadcasting said IP message by said associated gateway to destination gateways associated with other controllers, wherein each of said destination gateways stores a correspondence between the IP address of the particular fourth-generation mobile terminal and the second IP address of the associated gateway that is carrying out said broadcasting associated with the controller to which the particular fourth-generation mobile terminal is affiliated, and wherein the routers in the interconnection network route IP packets by: transmitting systematically all the IP packets arising from the controller to said associated gateway, wherein each of said plurality of gateways encapsulates each of said IP packets in respective IP packets of a higher level using said match list, wherein a destination IP address of each of said higher level IP packets is the second IP address corresponding to a destination gateway, wherein each fourth-generation mobile terminal has an IP address that does not change when said each fourth-generation mobile terminal passes from the first controller to another controller, and wherein each of said plurality of gateways broadcasts said IP packets of the higher level over the interconnection network. | 1 | < 0.1% |
| 1. A control device comprising: a search request receiving unit that receives a request to search for a first operation screen registered in a second image forming apparatus connected to a first image forming apparatus; a search unit that searches for the first operation screen among operation screens registered in the second image forming apparatus; a display control unit that controls to display the first operation screen on a display device provided in the first image forming apparatus; a receiving unit that receives an instruction for the second image forming apparatus having the first operation screen registered therein from a user through the first operation screen displayed on the display device; and a transmitting unit that transmits the instruction received from the user through the first operation screen to the second image forming apparatus having the first operation screen registered therein, wherein the first operation screen is an execution screen for executing a function that is unavailable in the first image forming apparatus, and when the function that is unavailable in the first image forming apparatus is selected on a menu screen registered in the first image forming apparatus, the display control unit controls to display the first operation screen registered on a display device provided in the second image forming apparatus. | 5. A control method comprising: receiving a request to search for a first operation screen registered in a second image forming apparatus connected to a first image forming apparatus; searching for the first operation screen among operation screens registered in the second image forming apparatus; displaying the first operation screen on a display device provided in the first image forming apparatus; receiving an instruction for the second image forming apparatus having the first operation screen registered therein from a user through the first operation screen displayed on the display device; and transmitting the instruction received from the user through the first operation screen to the second image forming apparatus having the first operation screen registered therein, wherein the first operation screen is an execution screen for executing a function that is unavailable in the first image forming apparatus, and when the function that is unavailable in the first image forming apparatus is selected on a menu screen registered in the first image forming apparatus, displaying the first operation screen registered on a display device provided in the second image forming apparatus. | 6. An image forming apparatus comprising: a display device that displays an operation screen; and a control device; wherein the control device includes: a search request receiving unit that receives a request to search for a first operation screen registered in a second image forming apparatus connected to the image forming apparatus through a communication unit; a search unit that searches for the first operation screen among operation screens registered in the second image forming apparatus; a display control unit that controls to display the first operation screen on the display device; a receiving unit that receives an instruction for the second image forming apparatus having the first operation screen registered therein from a user through the first operation screen displayed on the display device; and a transmitting unit that transmits the instruction received from the user through the first operation screen to the second image forming apparatus having the first operation screen registered therein, wherein the first operation screen is an execution screen for executing a function that is unavailable in the first image forming apparatus, and when the function that is unavailable in the first image forming apparatus is selected on a menu screen registered in the first image forming apparatus, the display control unit controls to display the first operation screen registered on a display device provided in the second image forming apparatus. | 7. A non-transitory computer readable medium storing a program that causes a computer to perform: receiving a request to search for a first operation screen registered in a second image forming apparatus connected to a first image forming apparatus; searching for the first operation screen among operation screens registered in the second image forming apparatus; displaying the first operation screen on a display device provided in the first image forming apparatus; receiving an instruction for the second image forming apparatus having the first operation screen registered therein from a user through the first operation screen displayed on the display device; and transmitting the instruction received from the user through the first operation screen to the second image forming apparatus having the first operation screen registered therein, wherein the first operation screen is an execution screen for executing a function that is unavailable in the first image forming apparatus, and when the function that is unavailable in the first image forming apparatus is selected on a menu screen registered in the first image forming apparatus, displaying the first operation screen registered on a display device provided in the second image forming apparatus. | 1 | < 0.1% |
| Other values (2774) | 2774 |
Length
| Value | Count | Frequency (%) |
| the | 119070 | 9.0% |
| a | 81936 | 6.2% |
| of | 54852 | 4.1% |
| and | 39505 | 3.0% |
| to | 36175 | 2.7% |
| first | 19086 | 1.4% |
| in | 16612 | 1.3% |
| an | 16199 | 1.2% |
| second | 14896 | 1.1% |
| is | 14633 | 1.1% |
| Other values (17184) | 909636 |
Most occurring characters
| Value | Count | Frequency (%) |
| 1330486 | ||
| e | 818343 | 10.0% |
| t | 635689 | 7.7% |
| i | 551913 | 6.7% |
| a | 549610 | 6.7% |
| n | 523392 | 6.4% |
| o | 511601 | 6.2% |
| r | 452635 | 5.5% |
| s | 378133 | 4.6% |
| c | 288766 | 3.5% |
| Other values (92) | 2182569 |
Most occurring categories
| Value | Count | Frequency (%) |
| Lowercase Letter | 6666406 | |
| Space Separator | 1330486 | 16.2% |
| Other Punctuation | 105473 | 1.3% |
| Uppercase Letter | 52385 | 0.6% |
| Decimal Number | 31540 | 0.4% |
| Dash Punctuation | 15300 | 0.2% |
| Close Punctuation | 8096 | 0.1% |
| Open Punctuation | 7365 | 0.1% |
| Math Symbol | 4948 | 0.1% |
| Control | 675 | < 0.1% |
| Other values (4) | 463 | < 0.1% |
Most frequent character per category
Lowercase Letter
| Value | Count | Frequency (%) |
| e | 818343 | |
| t | 635689 | 9.5% |
| i | 551913 | 8.3% |
| a | 549610 | 8.2% |
| n | 523392 | 7.9% |
| o | 511601 | 7.7% |
| r | 452635 | 6.8% |
| s | 378133 | 5.7% |
| c | 288766 | 4.3% |
| d | 276061 | 4.1% |
| Other values (16) | 1680263 |
Uppercase Letter
| Value | Count | Frequency (%) |
| A | 9162 | |
| C | 4614 | 8.8% |
| I | 3687 | 7.0% |
| D | 3403 | 6.5% |
| P | 3121 | 6.0% |
| S | 3117 | 6.0% |
| R | 2936 | 5.6% |
| E | 2273 | 4.3% |
| M | 2247 | 4.3% |
| O | 2061 | 3.9% |
| Other values (16) | 15764 |
Other Punctuation
| Value | Count | Frequency (%) |
| , | 50900 | |
| ; | 24773 | |
| . | 16066 | 15.2% |
| : | 9253 | 8.8% |
| ? | 1777 | 1.7% |
| / | 1394 | 1.3% |
| % | 795 | 0.8% |
| ' | 405 | 0.4% |
| * | 70 | 0.1% |
| · | 39 | < 0.1% |
Decimal Number
| Value | Count | Frequency (%) |
| 1 | 10185 | |
| 0 | 5324 | |
| 2 | 4562 | |
| 3 | 2464 | 7.8% |
| 5 | 2202 | 7.0% |
| 4 | 1834 | 5.8% |
| 6 | 1522 | 4.8% |
| 8 | 1245 | 3.9% |
| 7 | 1126 | 3.6% |
| 9 | 1076 | 3.4% |
Control
| Value | Count | Frequency (%) |
| | 514 | |
| | 71 | 10.5% |
| | 71 | 10.5% |
| | 5 | 0.7% |
| 4 | 0.6% | |
| | 4 | 0.6% |
| | 2 | 0.3% |
| | 2 | 0.3% |
| | 2 | 0.3% |
Math Symbol
| Value | Count | Frequency (%) |
| | | 4177 | |
| + | 236 | 4.8% |
| = | 211 | 4.3% |
| × | 105 | 2.1% |
| ± | 90 | 1.8% |
| < | 84 | 1.7% |
| > | 45 | 0.9% |
Close Punctuation
| Value | Count | Frequency (%) |
| ) | 7927 | |
| ] | 124 | 1.5% |
| } | 45 | 0.6% |
Open Punctuation
| Value | Count | Frequency (%) |
| ( | 7165 | |
| [ | 124 | 1.7% |
| { | 76 | 1.0% |
Other Number
| Value | Count | Frequency (%) |
| ¼ | 22 | |
| ½ | 8 | 26.7% |
Space Separator
| Value | Count | Frequency (%) |
| 1330486 |
Dash Punctuation
| Value | Count | Frequency (%) |
| - | 15300 |
Other Symbol
| Value | Count | Frequency (%) |
| ° | 404 |
Connector Punctuation
| Value | Count | Frequency (%) |
| _ | 16 |
Modifier Symbol
| Value | Count | Frequency (%) |
| ^ | 13 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Latin | 6718791 | |
| Common | 1504346 | 18.3% |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| e | 818343 | |
| t | 635689 | 9.5% |
| i | 551913 | 8.2% |
| a | 549610 | 8.2% |
| n | 523392 | 7.8% |
| o | 511601 | 7.6% |
| r | 452635 | 6.7% |
| s | 378133 | 5.6% |
| c | 288766 | 4.3% |
| d | 276061 | 4.1% |
| Other values (42) | 1732648 |
Common
| Value | Count | Frequency (%) |
| 1330486 | ||
| , | 50900 | 3.4% |
| ; | 24773 | 1.6% |
| . | 16066 | 1.1% |
| - | 15300 | 1.0% |
| 1 | 10185 | 0.7% |
| : | 9253 | 0.6% |
| ) | 7927 | 0.5% |
| ( | 7165 | 0.5% |
| 0 | 5324 | 0.4% |
| Other values (40) | 26967 | 1.8% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 8221794 | |
| None | 1343 | < 0.1% |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 1330486 | ||
| e | 818343 | 10.0% |
| t | 635689 | 7.7% |
| i | 551913 | 6.7% |
| a | 549610 | 6.7% |
| n | 523392 | 6.4% |
| o | 511601 | 6.2% |
| r | 452635 | 5.5% |
| s | 378133 | 4.6% |
| c | 288766 | 3.5% |
| Other values (77) | 2181226 |
None
| Value | Count | Frequency (%) |
| | 514 | |
| ° | 404 | |
| × | 105 | 7.8% |
| ± | 90 | 6.7% |
| | 71 | 5.3% |
| | 71 | 5.3% |
| · | 39 | 2.9% |
| ¼ | 22 | 1.6% |
| ½ | 8 | 0.6% |
| | 5 | 0.4% |
| Other values (5) | 14 | 1.0% |
Description
Categorical
HIGH CARDINALITY  UNIFORM  UNIQUE 
| Distinct | 2784 |
|---|---|
| Distinct (%) | 100.0% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 74.3 MiB |
| CROSS-REFERENCE TO RELATED APPLICATIONS This application is a continuation of U.S. application Ser. No. 12/567,718, entitled Steam Appliance, filed Sep. 25, 2009, which is herein incorporated by reference in its entirety. BRIEF DESCRIPTION OF THE DRAWINGS The accompanying drawings are not intended to be drawn to scale. For purposes of clarity, not every component may be labeled in every drawing. In the drawings: FIG. 1 is a side view of a steam appliance system according to one embodiment of the invention; FIG. 2 is a side view of a first portion of a connector according to one embodiment of the invention; FIG. 3 is a cross-sectional view of a second portion of a connector configured to engage with the first portion illustrated in FIG. 2; and FIG. 4 is an exploded perspective view of components of the second connector portion illustrated in FIG. 3. FIELD OF THE INVENTION The invention relates generally to steam appliances, and more specifically to a steam applicator that is connectable to a conduit but constructed and arranged be rotated without loosening or disengaging the connection. DISCUSSION OF THE RELATED ART Steam appliances are used in the home to apply steam to floors for cleaning and sanitizing. Various types of steam appliances are known, including canister steam appliances and self-contained steam mops for example. Canister steam appliances typically include a rollable steam generation unit, a hose to transfer the steam from the steam generation unit, a pole, and a mop head or other accessory which is connected to the end of the pole. Self-contained steam mops include a steam generation unit mounted directly on the pole. Handheld steam appliances typically include a container and a nozzle for discharging steam directly from the mouth of the container. SUMMARY Embodiments of the invention provided herein are directed to steam appliances in which a steam applicator is connectable to the steam appliance, but the steam applicator is permitted to rotate without loosening or disengaging the connection of the steam applicator to the steam appliance. According to one embodiment of the invention, a steam appliance includes a steam generation unit, a steam applicator, and a steam conduit configured to guide steam from the steam generation unit to a steam inlet for the steam applicator. The steam applicator is connectable to the steam conduit, and the steam applicator is rotatable relative to the steam conduit in either rotational direction without loosening the connection of the steam applicator to the steam conduit. According to another embodiment of the invention, a method of using a steam applicator having a handle with a end-to-end direction includes acts of grasping the handle with a first hand, grasping a steam conduit with a second hand, bringing a first threaded portion of the steam applicator into contact with a second threaded portion of the steam conduit, and connecting the steam applicator to the steam conduit. The method further includes using the steam applicator to apply steam to an object, and rotating the handle in either rotational direction about the end-to-end direction of the handle to rotate the steam applicator, wherein the rotation of the handle does not loosen the connection of the steam applicator to the steam conduit. Also included is a method of disconnecting the steam applicator from the steam conduit by simultaneously rotating the first threaded portion relative to the second threaded portion and applying an axial force between the conduit and the steam applicator, the axial force being sufficient to overcome a force applied by a resilient element, such that at least one of the first and second threaded portions is altered from a configuration in which the at least one threaded portion is rotatable relative to whichever of the steam applicator and the steam conduit that it is positioned on, to a configuration in which the at least one threaded portion is not rotatable relative to whichever of the steam applicator and the steam conduit that it is positioned on. According to a further embodiment of the invention, a steam appliance includes a steam generation unit, a steam applicator having a handle, a steam conduit to guide steam from the steam generation unit to the steam applicator, and means for mechanically connecting the steam conduit to the handle of the steam applicator. The handle is permitted to repeatedly rotate relative to the steam conduit in either rotation direction about an end-to-end direction of the handle without loosening the connection of the handle to the steam conduit. Various embodiments of the present invention provide certain advantages. Not all embodiments of the invention share the same advantages and those that do may not share them under all circumstances. Further features and advantages of the present invention, as well as the structure of various embodiments of the present invention are described in detail below with reference to the accompanying drawings. DETAILED DESCRIPTION Applicants have recognized the importance of providing a steam applicator assembly which can be freely rotated without compromising the connection of the applicator assembly to a steam conduit. The ability to rotate the steam applicator can be particularly important when the steam applicator assembly is a handheld assembly that is attached to a flexible hose or other flexible conduit because a user may wish to rotate the steam applicator without twisting or kinking the hose. It is also desirable to prevent unintentional disengagement of the steam applicator during rotation of the steam applicator to avoid steam loss and the inconvenience of reconnecting the steam applicator. According to some embodiments of the invention, a steam appliance permits a user to engage and disengage the steam applicator with the same type of motion and without detaching any components. In some embodiments, disconnecting the steam applicator requires two distinct motions. For example, a user may need to push the steam applicator toward the steam conduit and then twist the conduit to separate the steam conduit and the steam applicator. According to one embodiment of the invention, a steam applicator is connected to a flexible steam conduit with a threaded connector configuration which allows rotation of the steam applicator relative to the steam conduit during use without compromising the connection. The threaded connector includes an external thread portion and an internal thread portion. One of the thread portions, for example the internal thread portion, is positioned within an element such as a handle on the steam applicator. The internal thread portion is constructed and arranged to rotate within the handle. By allowing the internal thread portion to float within the handle, friction between the thread portions rotates the internal thread portion within the handle, thereby substantially preventing the complementary external thread portion from being fully twisted into or out of the internal thread portion. To successfully twist the external thread portion into or out of the internal thread portion, the user pushes the two thread portions toward each other, which temporarily fixes the internal thread portion to the handle, thereby permitting relative rotation of the two thread portions. A steam appliance system 100 including two attachable steam applicators 102, 104 is shown in FIG. 1. Steam applicators 102, 104 each may include a handle 107 which is permanently or detachably attached to the applicator. In the embodiment of FIG. 1, steam appliance system 100 includes a steam generation unit 108, a steam conduit 110, and attached steam applicator 102. Steam generation unit 108 may include any suitable type of steam generation system, for example a cool water reservoir 112 and an aluminum die-cast steam generator (not shown). In some embodiments, water may be heated to its boiling point within its reservoir to create steam. It should be noted that the method of steam generation is not intended to be a limiting aspect of the invention. In some embodiments, the steam generation unit 108 is handheld, while in other embodiments the steam generation unit may include a shoulder strap, or include wheels or other rollers. Steam conduit 110 is a flexible hose in some embodiments. Steam conduit 110 may be attachable to steam generation unit 108 with any suitable attachment 114, including a removable connector, such as a bayonet connector. One particular embodiment of a steam appliance which permits rotation a steam applicator without compromising the connection of the steam applicator to the steam appliance is shown in FIGS. 2-4. In this embodiment, a steam appliance includes an externally-threaded connector portion 202 attached to steam conduit 110. A hand grasp portion 206 is attached to steam conduit 110 and threaded connector portion 202 for the user to grip when attaching or detaching steam conduit 110 and handle 107. Steam conduit includes an elongated stem 208 to guide steam through handle 107 and to a steam outlet 212. O-rings 210 or other seal elements may be positioned on stem 208 to establish a seal with the steam applicator, whether that seal be within the handle of the steam applicator, or within the steam applicator itself. The stem and sealing aspects of the illustrated embodiment are not intended to be limiting. A stress release sleeve 214 may be included at the junction of steam conduit 110 and hand grasp portion 206 in some embodiments. An internally-threaded connector portion 302 with threads 304 is positioned within handle 107 in the embodiment illustrated in FIG. 3. Connector portion 302 is permitted to rotate within handle 107, and is also permitted to move axially between stops 306 and 308. Connector portion 302 is biased away from a lock element 310 by a coil spring 312. Instead of a spring, any suitable resilient element may be used to bias connector portion 302 away from lock element 310. For example, a compressible resilient foam gasket may be used in some embodiments. In still other embodiments, a constant force spring, an elastic band, or any other suitable tensioning device, may bias connector portion 302 away from locking element 310 by pulling on connector portion 302. When a user initially inserts externally-threaded connector portion 202 into internally-threaded connector portion 302, rotating the two portions relative to each other will not result in a mating of the threaded portions because connector portion 302 rotates with connector portion 202. However, when the user pushes connector portion 302 against locking element 310 by providing an axial force of at least a threshold force t to overcome the force provided by coil spring 312 connector portion is prevented from rotating by more than a small angle because locking tabs 314 on connector portion 302 are rotated into abutment with locking tabs 316 on the locking element 310. With locking element 310 prevented from rotating, connector portion 202 can be twisted into mating engagement with connector portion 302. Locking element 310 is prevented from moving axially away from connector portion 302 by a stop 318. In this manner, two distinct motions are required of the user to attach or remove a steam applicator from steam conduit 110. While in the illustrated embodiment the two distinct motions include an axial force and a twisting force acting simultaneously, other multiple distinct action configurations may be used. For example, in some embodiments, a ball and groove quick disconnect coupling is used to connect a steam conduit to a steam applicator. In such an embodiment, a first motion may include moving a locking collar, and a second motion may include pulling the handle of the steam applicator away from the steam conduit. Some embodiments may require two or more distinct motions to remove a steam applicator, while allowing attachment of a steam applicator with only a single motion. By requiring two or more distinct motions to remove a steam applicator, unintended disengagement or loosening of the steam applicator during use of the steam appliance may be prevented. For example, the user may rotate the steam applicator in either direction about an end-to-end direction of the steam application when cleaning surfaces, and it may be beneficial to avoid having the steam conduit rotate as a result of the steam applicator rotations. By allowing connector portion 302 to rotate relative to handle 107, handle 107 can rotate without twisting steam conduit 110 and with loosening the engagement of the two threaded connectors. For purposes herein, loosening a connection is intended to include compromising a connection. For example, in some embodiments, a connection may become less than fully engaged such that the connection is at risk of disengaging, yet the connection may not permit perceptible movement of the two connected components relative to one another. In some embodiments, one or more rotation stops may be included to limit the rotation angle of the steam applicator in either rotation direction (e.g., clockwise and counterclockwise about an end-to-end direction of the steam applicator). In such an embodiment, the steam applicator is permitted to rotate a certain amount, for example by permitting connector portion 302 to rotate, but the steam applicator rotation is prevented from further rotations by the rotation stops. The rotation stops may include one or more tabs (not shown) protruding from an interior wall of handle 107 between stops 306 and 308. In some embodiments, the steam applicator is permitted to rotate 180 degrees in either direction, and in some embodiments, the steam applicator is permitted to rotate 360 degrees in either direction. The embodiments described above allow for a tool-free attachment and removal of steam applicators from the steam appliance. In some embodiments, however, a tool may be used. While embodiments described herein are directed to rotations of a steam applicator or a handle about an end-to-end direction of the steam application or the handle, in some embodiments, pitch and/or yaw rotations may be permitted as well. A universal joint may be used in addition to, or instead of, the structures described herein. For purposes herein, the terms connect, connected, connection, attach, attached and attachment refer to direct connections and attachments, indirect connections and attachments, and operative connections and attachments. For example, steam applicator 102 is considered to be connected to steam conduit 110 even though steam applicator is directly connected to handle 107 which is, in turn, connected to steam conduit 110. Also for purposes herein, the terms connectable, attachable, removable, etc. refer both to components which can be connected, attached, removed, etc., and also refer to components which are connected, attached and removed. For ease of understanding, and without limiting the scope of the invention, the embodiments to which this disclosure is addressed are described above particularly in connection with a handheld portable steam appliance. It should be appreciated, however, that the present invention can be embodied in other types of steam appliances. Additionally, while the steam applicators described above employ steam pocket technology, other types of steam applicators may be used in conjunction with embodiments disclosed herein. Having thus described several aspects of at least one embodiment of this invention, it is to be appreciated various alterations, modifications, and improvements will readily occur to those skilled in the art. Such alterations, modifications, and improvements are intended to be part of this disclosure, and are intended to be within the spirit and scope of the invention. Accordingly, the foregoing description and drawings are by way of example only. | 1 |
|---|---|
| BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWING FIG. 1 is a diagram schematically illustrating steps of mounting a semiconductor chip to a printed substrate according to one embodiment of the present invention; FIG. 2 is a schematic diagram illustrating a part of a printed substrate manufacturing equipment according to one embodiment of the present invention, that is, a part configured to deliver a film to be used as an underfill to a film carrying jig; and FIG. 3 is a schematic diagram illustrating a part of the printed substrate manufacturing equipment according to one embodiment of the present invention, that is, a part configured to apply the film to be used as the underfill to the printed substrate. INCORPORATION BY REFERENCE The present application claims priority from Japanese Application P2011-067147 filed on Mar. 25, 2011, the content of which is hereby incorporated by reference into this application. BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to printed substrate manufacturing equipment and manufacturing method, and more particularly relates to printed substrate manufacturing equipment and manufacturing method favorably used to mount a semiconductor chip onto a printed substrate. 2. Description of the Related Art In flip chip bonding in a printed substrate, a solder ball is adhered to a connection pad which is formed on the printed substrate and a semiconductor chip is mounted on the substrate via the solder ball. When the semiconductor chip is mounted on the printed substrate by the above-mentioned flip chip bonding method, a gap G is formed between the semiconductor chip and the printed substrate in accordance with the height of the solder ball which is adhered to the connection pad. Therefore, such a problem may occur that the supporting force of the semiconductor chip is reduced and hence a crack is generated in a solder ring part of the solder ball. In particular, when the temperature is greatly changed, thermal stress may be exerted on the solder ball and the crack may be generated in the solder ball due to the thermal stress because thermal expansion coefficients of the semiconductor chip and the printed substrate are different from each other. Thus, it has been practiced so far to inject an underfill liquid which is a liquid substance into the gap G generated between the semiconductor chip and the printed substrate by using a dispenser in order to stably support the semiconductor chip as disclosed, for example, in Japanese Patent Application Laid-Open No. 2010-118634. Since the underfill liquid is injected into the gap G, it is desirable to prevent the liquid from leaking to the outside and hence a spill prevention dam is formed on an edge of the board. In a printed substrate described in Japanese Patent Application Laid-Open No. 2010-118634, a dispenser is used to form a spill prevention dam. Hitherto, a space between respective bumps has been wide enough to use the dispenser. However, the space between the bumps is reduced as the chip is refined and it becomes difficult to inject the underfill liquid by using the dispenser. Thus, formation of the underfill is difficult, which makes it also difficult to prevent generation of a crack due to thermal stress exerted between the semiconductor chip and the substrate. Thus, a substitutive method for the method of injecting the underfill liquid using the dispenser is searched for. BRIEF SUMMARY OF THE INVENTION The present invention has been made in view of the drawbacks of the above mentioned related art and an object of the present invention is to fix a printed substrate and a semiconductor chip to each other by filling a gap between them so as to obtain the same effect as that obtained when an underfill liquid is used. Another object is to implement a highly accurate printed substrate that prevents generation of a crack. In order to solve the above mentioned problems, the present invention provides a printed substrate manufacturing method of forming solder bumps on a plurality of electrode parts of a printed substrate and loading a semiconductor chip on the printed substrate via the plurality of solder bumps, including preparing a thermoplastic film to be used as an underfill that covers a surface of the printed substrate on which the solder bumps are formed, wherein parts of the film corresponding to the solder bumps are removed and a peripheral edge of a part of the film on which the semiconductor chip will be loaded has a protruded form, covering the printed substrate with the film and thereafter applying the film onto the board, loading the semiconductor chip on the printed substrate and carrying the board into a reflow furnace and applying heat and pressure to fuse the solder bumps in the reflow furnace. In the above mentioned printed substrate manufacturing method, preferably, in preparing the film, after the film which is in a rolled-up state has been cut into a section of a predetermined size, the film so cut is carried to a film drilling unit using a film carrying jig, drilling is performed on a part of the film corresponding to each solder bump formed on the printed substrate by the film drilling unit, and then the film is inverted together with the film carrying jig. In order to solve the above mentioned problems, the present invention also provides a printed substrate manufacturing equipment, including a film supply unit on which a thermoplastic film to be used as an underfill is wound in roll, a film drilling unit for drilling a part of the film supplied from the film supply unit corresponding to the position of a solder bump formed on a printed substrate, a film inversion unit for inverting the film together with a film carrying jig that holds the film and a film bonding unit for bonding the inverted film onto the printed substrate, wherein the film bonding unit includes an upper table for holding the inverted film carrying jig and film, a lower table on which the printed substrate is placed and which includes a heater for heating the printed substrate, and a driving device for vertically moving the upper table and the lower table. Preferably, the above mentioned printed substrate manufacturing device further includes a reflow furnace into which a semiconductor chip which is loaded on the printed substrate to which the film has been bonded by the film bonding unit is carried to fuse the solder bump to fix the semiconductor chip to the printed substrate. DETAILED DESCRIPTION OF THE INVENTION Printed substrate manufacturing equipment and manufacturing method according to the present invention will be described with reference to the accompanying drawings. FIG. 1 is a diagram for describing one embodiment of a manufacturing method for a printed substrate 33 according to the present invention, illustrating respective steps of mounting a semiconductor chip 41 to the printed substrate 33. Although not illustrated in FIG. 1, solder bumps 39 are printed on a surface of the printed substrate 33 by using a solder ball printer and reflow soldering is performed to fix the bumps onto the surface of the printed substrate 33 in a pre-process of manufacturing. As illustrated in portion (a) of FIG. 1, the printed substrate 33 with the solder bumps 39 formed is carried into an underfill formation unit and is loaded on a lower table 34 (step S1). When the printed substrate 33 is loaded on the lower table 34, an underfill film (hereinafter, referred to as a film as the case may be) 30 on which drilling is performed in advance by a CVD (Chemical Vapor Deposition) device after the form of each solder bump 39 is supplied from a not-illustrated underfill film supply device. A protrusion (protruded part) 40 is formed on an end (for example, a peripheral edge) of the film 30. The protrusion 40 is formed so as to prevent the semiconductor chip 41 from moving on the printed substrate 33 regardless of application of vibration or the like to the printed substrate 33, when it is intended to move the semiconductor chip 41 in a state that is loaded on the printed substrate 33. The film 30 is 5 to 20 ?m in thickness and thermoplastic. The film 30 is made adhesive with heat to adhere the semiconductor chip 41 to the printed substrate 33. Marks for alignment are made on the film 30 and the printed substrate 33. An underfill film formation unit (for example, a film bonding device) 50 includes an imaging camera (for example, a two-field camera with upper and lower fields) 32 for detecting these marks and takes a picture of the position of each mark by the camera 32. The picture that the camera 32 has taken is sent to a not-illustrated control unit and is subjected to image processing by the control unit. Then, an amount of misalignment between the mark positions is obtained and a lower table 34 is horizontally moved to align the film 30 with the printed substrate 33. After alignment of the film 30 with the printed substrate 33 has been completed as illustrated in portion (b) of FIG. 1, the film 30 is lowered toward the surface of the printed substrate 33. Then, the printed substrate 33 is covered with the film 30 except parts corresponding to the solder bumps 39 (step S2). The semiconductor chip 41 is loaded on the solder bumps 39 after the printed substrate 33 has been covered with the film 30 as illustrated in portion (c) of FIG. 1 (step S3). Pictures of alignment marks on the semiconductor chip 41 and the solder bumps 39 are taken by the camera 32 also when the semiconductor chip 41 is to be aligned with the solder bumps 39. Then, an amount of misalignment between them is measured as in the case in alignment of the film 30 with the printed substrate 33 and a grip of the semiconductor chip 41 is horizontally moved in accordance with the amount of misalignment to align the semiconductor chip 41 with the solder bumps 39. If the printed substrate 33 is moved after the semiconductor chip 41 has been mounted on it, the possibility of occurrence of misalignment will be increased because the semiconductor chip 41 is simply placed on the solder bumps 39. Thus, the protruded part is formed on the end of the film 30 on the side on which the semiconductor chip 41 is to be loaded. As an alternative, the protruded part may be formed when drilling is performed on the film 30. After the semiconductor chip 41 has been mounted on the printed substrate 33 and a mounted state thereof has been inspected, the printed substrate 33 is carried to a reflow furnace. The underfill film 30 is pressed downward in a direction of an arrow in the reflow furnace as illustrated in portion (d) of FIG. 1. Heating is performed simultaneously with pressing. The printed substrate 33 and the semiconductor chip 41 are adhered and fixed to each other by heating and pressing (HP) the film 30 (step S4). After fixing of the semiconductor chip 41 onto the printed substrate 33 has been completed, the printed substrate 33 is carried to a process of inspection. FIG. 2 illustrates a forming device 45 for the underfill film (film) 30. In an example illustrated in FIG. 2, the film 30 is formed as a sheet-shaped roll. A film roll 11 includes a cover film 12 and the underfill film 30. The cover film 12 and the underfill film 30 are laminated in order from within. A guide roll 13 is disposed below the film roll 11 in order to carry the film 30 from the film roll 11 onto a carrying surface. The guide roll 13 is used to peel off the cover film 12. The peeled-off cover film 12 is taken up on a take-up roll 14 which is disposed adjacent to the film roll 11. Drive units for the film roll 11 and the take-up roll 14 include a not-illustrated torque adjuster respectively, for adjusting torque in accordance with the residual quantity of the film 30. The torque is adjusted by the torque adjuster, by which it is allowed to carry the film 30 in a state that its tension is maintained constant. A leading end holding member 15 and a trailing end holding member 16 for carrying the film 30 in a state that predetermined areas of the leading and trailing ends of the film 30 are sucked and adsorbed to them are disposed under the guide roll 13. A vacuum chamber is disposed in the leading end holding member 15 and an adsorption hole is formed in its upper surface. The vacuum chamber is connected to a not-illustrated vacuum pump. When the vacuum pump is driven, the leading end of the film is sucked and adsorbed to the upper surface of the leading end holding member 15. That is, the film 30 is held on the leading end holding member 15 by using a vacuum adsorption mechanism. The leading end holding member 15 is supported on a movable part 21 of a ball screw 20 which is disposed under the leading end holding member 15. The ball screw 20 is directly connected to a servo motor 19. The leading end holding member 15 which is supported on the movable part 21 of the ball screw 20 is moved in a lateral direction (a film carrying direction) by driving the servo motor 19. An air cylinder 17 is connected to the movable part 21. The air cylinder 17 is allowed to carry the leading end of the film 30 to a position where the film 30 is adjacent to one of a pair of pressing rollers 23 that configure a pressing unit for pressing the film 30. A vacuum chamber is disposed in the trailing end holding member 16 and an adsorption hole is formed in its upper surface as in the case of the leading end holding member 15. A groove which extends in a width direction is formed in the member 16. The groove is also used as a cutter pedestal when the film 30 will be cut in the width direction by a cutter mechanism 18. The cutter mechanism 18 is disposed above the trailing end holding member 16 and is configured to be moved in the width direction by a rodless cylinder or the like. The cutter mechanism 18 is used to cut the film 30 in the width direction. Since the movable part 21 of the ball screw 20 supports the leading end holding member 15, the film 30 is carried with accuracy. In addition, since a coupling member 22 is rotated by driving a rotary actuator disposed on the movable part 21, it is allowed to retreat the trailing end holding member 16 downward from the film carrying surface. Each pressing roller 23 is configured by covering an outer periphery of a metal roll with highly heat-resistant rubber (silicon rubber or the like) so as to have a thickness of about 1.2 mm. When a voltage is applied to the film 30 from an electrode 26 included in a static electricity generator 28, the pressing roller 23 holds the film 30 on its surface by electrostatic adsorption. Therefore, if the rubber that covers the outer peripheral of the roller 23 is silicon rubber, its electric resistance will be increased. However, since the outer periphery covering rubber has such a thin thickness as about 1.2 mm, its influence on the electrostatic adsorption is little. It goes without saying that the effect of electrostatic adsorption will be increased by using heat-resistant conductive rubber. The pair of pressing rollers 23 are vertically disposed so as to pinch a film carrying jig 24 which is carried on a carrier roller 25 from above and from below. A not-illustrated air cylinder is coupled to each of the vertically disposed pair of pressing rollers 23 and the pressing rollers 23 are vertically moved by driving the air cylinder. Here, a metal part of each pressing roller 23 is grounded. Next, a film bonding operation will be described. In preparation for bonding of the film 30, the film 30 is manually drawn out from the film roll 11 and is delivered to the guide roll 13. The guide roll 13 peels off the cover film 12 as described above. The peeled-off cover film 12 is taken up on the take-up roll 14. The remaining film 30 is drawn out until it reaches the leading end of the trailing end holding member 16 and its rear surface side is sucked and adsorbed to the leading end holding member 15 and the trailing end holding member 16. In the above mentioned case, a motor which is the drive unit connected to the film roll 11 and the take-up roll 14 is operated to exert a constant tension on the film 30. In the above-mentioned state, the groove part in the trailing end holding member 16 is positioned such that a cutting blade of the cutter mechanism 18 passes along it. Then, the cutter mechanism 18 is moved in the width direction to cut the film 30. When cutting of the film 30 has been completed, sucking and adsorbing force of the trailing end holding member 16 that has adsorbed the film 30 so far is released and a cut-off piece of the film 30 is discarded. In the above-mentioned case, the film 30 is sucked and adsorbed to the leading end holding member 15 in a state that the leading end of the film 30 is protruded beyond the leading end of the leading end holding member 15 by about 10 mm, by which preparation for the operation of bonding the film 30 is completed. In a state that preparation for application of the film 30 has been completed, both the pressing rollers 23 which are positioned on and under the substrate carrying surface are at upper positions and are rotating in a substrate carrying direction in a state that the rollers 23 are heated by built-in heaters. An upper surface of the lower pressing roller 23 is in contact with the film carrying jig 24 to carry the film carrying jig 24 from the left side toward the right side in an example illustrated in FIG. 2. In the operation of bonding the film 30, first, the servo motor 19 is operated to move the movable part 21 of the ball screw 20 to the neighbourhood of the pressing rollers 23. When a rotary actuator disposed on the trailing end holding member 16 is driven, the coupling member 22 rotates to retreat the trailing end holding member 16 downward from the film carrying surface. Next, the air cylinder 17 is operated to move the leading end holding member 15 until the leading end of the film 30 reaches a position around the center of the upper surface of the upper pressing roller 23. After the film 30 has been situated at the above-mentioned predetermined position, a high voltage is applied from a not-illustrated static electricity generation source to the electrode 26. In the above mentioned case, the leading end of the film 30 is situated between the electrode 26 and the upper pressing roller 23. Thus, a film leading end part which is protruded beyond the leading end holding member 15 is charged and adsorbed to the grounded upper pressing roller 23. The upper pressing roller 23 is rotated in a carrying direction of the film carrying jig 24 and carries the adsorbed film 30 downward (toward the film carrying jig 24). When sucking and adsorbing force of the leading end holding member 15 is released, the film 30 is carried toward the printed substrate 33 with rotation of the upper pressing roller 23. Then, the air cylinder 17 and the movable part 21 are operated to return the leading end holding member 15 that has delivered the film 30 to the pressing roller 23 to a position under the guide roll 13. At the same time, the rotary actuator is driven to rotate the coupling member 22 so as to also return the retreated trailing end holding member 16 to the position of the film carrying surface. After the film 30 has been carried to a position (where the film 30 is brought into contact with the surface of the carried film carrying jig 24) directly under the upper pressing roller 23, rotation of the pressing rollers 23 is stopped. Then, the film 30 which is positioned above the leading end holding member 15 and the trailing end holding member 16 is held in a state that it is sucked and adsorbed to the respective holding members 15 and 16 at its leading and trailing ends. The cutter mechanism 18 is driven to cut the film 30 in the width direction. In the above-mentioned case, positions of the cutter mechanism 18 and the trailing end holding member 16 are adjusted such that the cut film 30 has a length which is long enough to be bonded to the printed substrate 33. As an alternative, the cutter mechanism 18, the leading end holding member 15 and the trailing end holding member 16 may be operated in synchronization with carrying of the film 30 without stopping the rotation of the pressing rollers 23 so as to cut the film 30 in an adsorptive-held state. The film carrying jig 24 is formed longer than the printed substrate 33 to which the film 30 will be actually bonded. After the film 30 has been cut to a predetermined length, the carrier roller 25 carries the film carrying jig 24 to a film bonding position (where the film will be bonded to the substrate). After the film carrying jig 24 has reached the film bonding position, a heightwise position of the lower pressing roller 23 is left as it is and only the upper pressing roller 23 is lowered (toward the lower pressing roller 23). As a result, the film 30 comes into contact with the surface of the film carrying jig 24 and then pressing is started. In the above-mentioned process, the film 30 is carried to the pressing rollers 23 simultaneously with carrying of the film carrying jig 24. However, since the trailing end holding member 16 is also moved toward the pressing rollers 23 in synchronization with carrying of the film 30, the tension exerted on the film is made constant. The film 30 is gradually pressed onto the film carrying jig 24 with rotation of the pressing rollers 23. On the other hand, when the trailing end holding member 16 to which the film 30 is adsorbed reaches the vicinity of the pressing rollers 23, a high voltage is applied to the electrode 26 of the static electricity generator 28 as in the case that the leading end of the film 30 is delivered from the leading end holding member 15 to the pressing roller 23. When the high voltage is applied to the electrode 26, the trailing end of the film 30 which is situated under the electrode 26 is charged and electrostatically adsorbed to the pressing roller 23. After the trailing end of the film 30 has been wholly delivered to the pressing roller 23, the sucking and adsorbing force of the trailing end holding member 16 is released. Then, the coupling member 22 is rotated to retreat the member 16 downward. On the other hand, the leading end holding member 15 is in a state that the leading end of a film 30 to be bonded next is sucked and adsorbed to it and is moved to the vicinity of the pressing roller 23 in a state that the film 30 is stuck and adsorbed to it. Since the trailing end of the film 30 is electrostatically adsorbed to the pressing roller 23, close contact of the film 30 with the film carrying jig 24 is allowed without letting the film 30 hang down from the surface of the film carrying jig 24. Thus, a film-bonding part may not be crumpled and any bubble may not enter it in pressing. Since the lower pressing roller 23 is grounded, the static electricity of the film 30 which is held on the upper pressing roller 23 is discharged when the film 30 comes into contact with the film carrying jig 24. After the entire surface of the film 30 has been pressed onto the surface of the film carrying jig 24, the upper pressing roller 23 is moved upward to deliver the next film 30 from the leading end holding member 15 to the upper pressing roller 23. After the leading end of the film 30 has been delivered to the upper pressing roller 23, the leading end holding member 15 moves to a position under the guide roll 13. At the same time, the trailing end holding member 16 which is in a retreated state is also returned to the position of the film carrying surface. As a result, a series of processes of the film bonding operation is completed. In the above mentioned embodiment, the leading and trailing ends of the film 30 are electrostatically adsorbed to the holding members 15 and 16 in order to deliver the film 30 to the pressing roller 23. As an alternative, the entire surface of the film 30 may be electrostatically charged to be adsorbed to the pressing roller 23. In addition, as a substitution for the vacuum adsorption mechanism which is used as the film holding mechanism included within the leading end holding member 15 and the trailing end holding member 16, an electrostatic adsorption holding mechanism may be used as in the case of the unit for making the film 30 adsorb to the pressing roller 23. The film 30 which is attached onto the film carrying jig 24 is sent to a not-illustrated drilling unit in which, then, drilling is performed on a part corresponding to the electrode part (the part corresponding to the part of forming the solder bump 39) on the printed substrate 33. Drilling is performed by a not-illustrated drilling machine. Before performing drilling, a protrusion is formed on an end of the film 30 by using a press machine. Owing to formation of the protrusion, the semiconductor chip 41 may not be moved with vibration or the like when the printed substrate 33 is to be moved simply by placing the semiconductor chip 41 on the printed substrate 30 without fixing it to the substrate. As an alternative, the protrusion may be formed when the film 30 is bonded onto the printed substrate 33. The drilled film 30 is carried to the film bonding device 50 in order to load the drilled film 30 on the printed substrate 33. FIG. 3 illustrates a schematic configuration of the film bonding device 50. In the film bonding device 50, the lower table 34 on which the printed substrate 33 will be loaded is disposed on a base 31. The lower table 34 includes a not-illustrated XY? table for moving the lower table 34 in a horizontal plane and an XY? table driving mechanism 36. Supports are disposed on four corners of the base 31 and an upper table support beam 37 for holding an upper table 35 is attached onto the supports. A driving device 38 for vertically moving the upper table 35 is disposed on the support beam 37. The upper table 35 is attached to the driving device 38. The two-field camera 32 with upper and lower fields is disposed between the upper table 35 and the lower table 34 to be horizontally movable. Before the film carrying jig 24 with the film 30 attached is carried into the film bonding device 50, a surface of the film 30 to be held is inverted together with the film carrying jig 24 by a not-illustrated inverting device. The film carrying jig 24 is carried into the film bonding device 50 in an inverted state. Then, the film carrying jig 24 is held under the upper table 35 which is disposed in opposition to the lower table 34 on which the printed substrate 33 is loaded with the film surface turned downward. In the above mentioned case, a negative pressure is applied to a not-illustrated surface of the upper table 35 to hold the film 30 under the upper table 35 by vacuum adsorption together with the film carrying jig 24. Pictures of alignment marks which are formed in advance on the surface of the film 30 and the surface of the printed substrate 33 are taken by the two-field camera 32 with upper and lower fields. A not-illustrated control unit performs image processing on the taken pictures to obtain an amount of misalignment between the alignment marks on the surfaces of the film 30 and the substrate 33. The lower table 34 is horizontally moved for alignment on the basis of the obtained misalignment amount. Since the lower table 34 includes a heater, it is allowed to heat the printed substrate 33 to a predetermined temperature. When the printed substrate 33 is loaded on the lower table 34, the heater is turned on to warm the printed substrate 33. After the pictures of the alignment marks have been taken, the two-field camera 32 with upper and lower fields is retreated from surfaces of the upper table 35 and lower table 34. At the completion of alignment, the table vertically driving mechanism 38 is operated to lower the upper table 35 with the film 30 supported. The film 30 is bonded onto the surface of the printed substrate 33 while applying a predetermined pressure onto the surface of the printed substrate 33. That is, heat and pressure are applied to temporarily fix the underfill film (film) 30 onto the surface of the printed substrate 33 except the electrode part of the printed substrate 33. In the above mentioned description, a process of forming the protrusion 40 on the end (the part corresponding to an end (for example, a peripheral edge) of the semiconductor chip) is performed before the process of drilling the film 30 is performed. As an alternative, the protrusion to which the end of the semiconductor chip 41 is fixed may be formed when performing the process of bonding the film 30 onto the printed substrate 33. At the completion of bonding of the film 30, the flow proceeds to a process of mounting the semiconductor chip 41 on the printed substrate 33. In mounting the semiconductor chip 41 on the printed substrate 33, the position of the electrode of the semiconductor chip 41 is measured in advance by using the camera 32. The semiconductor chip 41 is mounted on the surface of the printed substrate 33 with the underfill film 30 formed by using an existing chip mounter with robot hand. The printed substrate 33 with the semiconductor chip 42 mounted is carried into the reflow furnace in which, then, a soldering chip is fused to fixedly bond the semiconductor chip 42 to the printed substrate 33. Since the semiconductor chip 41 is not fixed to the printed substrate in carrying the substrate 33 into the reflow furnace, the protrusion 40 is formed on the end of the underfill film 30 to hold the end of the semiconductor chip 41 so as to avoid movement of the semiconductor chip 41. In the above mentioned embodiment, before the semiconductor chip is pressed onto the printed substrate, the underfill film is formed after the form of the printed substrate from which the electrode part is eliminated and the underfill film so formed is bonded onto the surface of the printed substrate to mount the semiconductor chip in a predetermined position, in place of an existing method of mounting a semiconductor chip on a printed substrate and then injecting an underfill liquid into between the printed substrate and the semiconductor chip. Owing to the above mentioned arrangement, it may become possible to cope with a reduction in space between electrodes which is caused by refinement. That is, it may become possible to firmly fix the semiconductor chip to the printed substrate regardless of presence of such a narrow space between the printed substrate and the semiconductor chip that a capillary phenomenon which is utilized when a liquefied underfill is used may not occur. According to the present invention, since the underfill is formed by a plastic film, it may become possible to fix the substrate and the semiconductor chip to each other so as to obtain the same effect as that obtained when an underfill liquid is used. In addition, since it may become possible to surely fix the semiconductor chip and the printed substrate to each other with the underfill film, it may become possible to avoid generation of a crack due to thermal stress or the like. | 1 |
| CROSS-REFERENCE TO RELATED APPLICATIONS This application is a continuation of U.S. patent application Ser. No. 13/222,929, filed Aug. 31, 2011, (now granted as U.S. Pat. No. 8,512,657), which is a continuation-in-part of U.S. patent application Ser. No. 12/712,681, filed on Feb. 25, 2010, (now granted as U.S. Pat. No. 8,012,439), which claims priority to GB Patent Application Nos. 0903262.4, filed on Feb. 26, 2009, and 0922612.7, filed on Dec. 24, 2009, and this application is a continuation-in-part of U.S. patent application Ser. No. 13/203,631, filed on Aug. 26, 2011, (now granted as U.S. Pat. No. 8,608,820), as the national stage application of International Application No. PCT/GB2010/050347, filed on Feb. 26, 2010, which claims priority to GB Patent Application Nos. 0903262.4, filed on Feb. 26, 2009, and 0922612.7, filed on Dec. 24, 2009, all of which are incorporated herein by reference in their entireties. BRIEF DESCRIPTION OF THE DRAWINGS In order that the invention may be more fully understood, reference is made to the accompanying drawings wherein: FIG. 1 is a graph showing the size distributions of PM in the exhaust gas of a diesel engine. For comparison, a gasoline size distribution is shown at FIG. 4 of SAE 1999-01-3530; FIGS. 2A-C show schematic drawings of three embodiments of washcoated porous filter substrates according to the invention; FIG. 3 is a schematic graph of mercury porosimetry relating the pore size distribution of a porous filter substrate, a porous washcoat layer and a porous filter substrate including a porous surface washcoat layer; FIG. 4 is a Table setting out a matrix of wallflow filter substrate pore size vs. washcoat loading indicating the suitability of the coated wallflow filter for use in a vehicular gasoline exhaust gas aftertreatment system; FIG. 5 is a graph showing the results of a Soot Loading Back Pressure study comparing backpressure against soot loading for 5.66 inch×6 inch SiC wallflow filters coated with two different oxidation catalyst washcoat loadings (g/in3) and a bare filter (all not according to the invention) with a Fe/beta zeolite selective catalytic reduction (SCR) catalyst (according to the invention) at a comparable washcoat loading; FIG. 6 is a graph comparing the backpressure in the same Soot Loading Back Pressure test for a Cu/SSZ-13 zeolite (a small pore zeolite) catalyst and a Fe/Beta zeolite (a large pore zeolite) SCR catalyst; and FIG. 7 is a bar chart comparing the particulate number emissions (particulate number per kilometer) from a 2.0 liter Euro 5 compliant light duty diesel vehicle fitted with standard diesel oxidation catalyst followed by a 3.0 liter SiC filter at 23 ?m nominal mean pore size coated with a Fe/Beta zeolite SCR catalyst for meeting the Euro 5/6 particle number emission limit of 6×1011 km?1 (UN/ECE Particulate Measurement Programme (PMP)) with the same system containing a bare filter. FIELD OF THE INVENTION The present invention relates to a filter for use in treating particulate matter (PM) in exhaust gas derived from any combustion process, such as from a compression ignition engine or from a positive ignition engine. In an embodiment, the filter is used to treat PM in exhaust gas derived from any combustion process where it is not possible to remove PM from the exhaust gas by build-up of PM (so-called cake filtration) or by a combination of depth filtration and cake filtration. The combustion process is typically that of a vehicular engine. In particular, an embodiment of the invention relates to a filter for use in treating PM derived from a vehicular positive ignition engine, particularly stoichiometrically operated positive ignition engines but also lean-burn positive ignition engines. Another embodiment of the invention relates to a filter for use in treating PM and oxides of nitrogen derived from a compression ignition engine. BACKGROUND OF THE INVENTION Positive ignition engines cause combustion of a hydrocarbon and air mixture using spark ignition. Contrastingly, compression ignition engines cause combustion of a hydrocarbon by injecting the hydrocarbon into compressed air and can be fuelled by diesel fuel, biodiesel fuel, blends of diesel and biodiesel fuels and compressed natural gas. Positive ignition engines can be fuelled by gasoline fuel, gasoline fuel blended with oxygenates including methanol and/or ethanol, liquid petroleum gas or compressed natural gas. Ambient PM is divided by most authors into the following categories based on their aerodynamic diameter (the aerodynamic diameter is defined as the diameter of a 1 g/cm 3 density sphere of the same settling velocity in air as the measured particle): (i) PM-10particles of an aerodynamic diameter of less than 10 ?m; (ii) Fine particles of diameters below 2.5 ?m (PM-2.5); (iii) Ultrafine particles of diameters below 0.1 ?m (or 100 nm); and (iv) Nanoparticles, characterised by diameters of less than 50 nm. Since the mid-1990's, particle size distributions of particulates exhausted from internal combustion engines have received increasing attention due to possible adverse health effects of fine and ultrafine particles. Concentrations of PM-10 particulates in ambient air are regulated by law in the USA. A new, additional ambient air quality standard for PM-2.5 was introduced in the USA in 1997 as a result of health studies that indicated a strong correlation between human mortality and the concentration of fine particles below 2.5 ?m. Interest has now shifted towards nanoparticles generated by diesel and gasoline engines because they are understood to penetrate more deeply into human lungs than particulates of greater size and consequently they are believed to be more harmful than larger particles, extrapolated from the findings of studies into particulates in the 2.5-10.0 ?m range. Size distributions of diesel particulates have a well-established bimodal character that correspond to the particle nucleation and agglomeration mechanisms, with the corresponding particle types referred to as the nuclei mode and the accumulation mode respectively (see FIG. 1). As can be seen from FIG. 1, in the nuclei mode, diesel PM is composed of numerous small particles holding very little mass. Nearly all diesel particulates have sizes of significantly less than 1 ?m, i.e. they comprise a mixture of fine, i.e. falling under the 1997 US law, ultrafine and nanoparticles. Nuclei mode particles are believed to be composed mostly of volatile condensates (hydrocarbons, sulfuric acid, nitric acid etc.) and contain little solid material, such as ash and carbon. Accumulation mode particles are understood to comprise solids (carbon, metallic ash etc.) intermixed with condensates and adsorbed material (heavy hydrocarbons, sulfur species, nitrogen oxide derivatives etc.) Coarse mode particles are not believed to be generated in the diesel combustion process and may be formed through mechanisms such as deposition and subsequent re-entrainment of particulate material from the walls of an engine cylinder, exhaust system, or the particulate sampling system. The relationship between these modes is shown in FIG. 1. The composition of nucleating particles may change with engine operating conditions, environmental condition (particularly temperature and humidity), dilution and sampling system conditions. Laboratory work and theory have shown that most of the nuclei mode formation and growth occur in the low dilution ratio range. In this range, gas to particle conversion of volatile particle precursors, like heavy hydrocarbons and sulfuric acid, leads to simultaneous nucleation and growth of the nuclei mode and adsorption onto existing particles in the accumulation mode. Laboratory tests (see e.g. SAE 980525 and SAE 2001-01-0201) have shown that nuclei mode formation increases strongly with decreasing air dilution temperature but there is conflicting evidence on whether humidity has an influence. Generally, low temperature, low dilution ratios, high humidity and long residence times favour nanoparticles formation and growth. Studies have shown that nanoparticles consist mainly of volatile material like heavy hydrocarbons and sulfuric acid with evidence of solid fraction only at very high loads. Contrastingly, engine-out size distributions of gasoline particulates in steady state operation show a unimodal distribution with a peak of about 60-80nm (see e.g. FIG. 4 in SAE 1999-01-3530). By comparison with diesel size distribution, gasoline PM is predominantly ultrafine with negligible accumulation and coarse mode. Particulate collection of diesel particulates in a diesel particulate filter is based on the principle of separating gas-borne particulates from the gas phase using a porous barrier. Diesel filters can be defined as deep-bed filters and/or surface-type filters. In deep-bed filters, the mean pore size of filter media is bigger than the mean diameter of collected particles. The particles are deposited on the media through a combination of depth filtration mechanisms, including diffusional deposition (Brownian motion), inertial deposition (impaction) and flow-line interception (Brownian motion or inertia). In surface-type filters, the pore diameter of the filter media is less than the diameter of the PM, so PM is separated by sieving. Separation is done by a build-up of collected diesel PM itself, which build-up is commonly referred to as filtration cake and the process as cake filtration. It is understood that diesel particulate filters, such as ceramic wallflow monoliths, may work through a combination of depth and surface filtration: a filtration cake develops at higher soot loads when the depth filtration capacity is saturated and a particulate layer starts covering the filtration surface. Depth filtration is characterized by somewhat lower filtration efficiency and lower pressure drop than the cake filtration. WO 03/011437 discloses a gasoline engine having an exhaust system comprising means for trapping PM from the exhaust gas and a catalyst for catalysing the oxidation of the PM by carbon dioxide and/or water in the exhaust gas, which catalyst comprising a supported alkali metal. The means for trapping PM is suitable for trapping PM of particle range 10-100 nm, and can be a wallflow filter made from a ceramic material of appropriate pore size such as cordierite coated with the catalyst, a metal oxide foam supporting the catalyst, a wire mesh, a diesel wallflow filter designed for diesel applications, an electrophoretic trap or a thermophoretic trap (see e.g. GB-A-2350804). WO 2008/136232 A1 discloses a honeycomb filter having a cell wall composed of a porous cell wall base material and, provided on its inflow side only or on its inflow and outflow sides, a surface layer and satisfying the following requirements (1) to (5) is used as a diesel particulate filter: (1) the peak pore diameter of the surface layer is identical with or smaller than the average pore diameter of the cell wall base material, and the porosity of the surface layer is larger than that of the cell wall base material; (2) with respect to the surface layer, the peak pore diameter is from 0.3 to less than 20 ?m, and the porosity is from 60 to less than 95% (measured by mercury penetration method); (3) the thickness (L1) of the surface layer is from 0.5 to less than 30% of the thickness (L2) of the cell wall; (4) the mass of the surface layer per filtration area is from 0.01 to less than 6 mg/cm 2; and (5) with respect to the cell wall base material, the average pore diameter is from 10 to less than 60 ?m, and the porosity is from 40 to less than 65%. See also SAE paper no. 2009-01-0292. Other techniques suggested in the art for separating gasoline PM from the gas phase include vortex recovery. In the United States, no similar emission standards have been set. However, the State of California Air Resources Board (CARB) recently published a paper entitled Preliminary Discussion PaperAmendments to California's Low-Emission Vehicle [LEV] Regulations for Criteria PollutantsLEV III (release date 8 th Feb. 2010) in which a new PM standard of between 2 and 4 mg PM/mile (1.25-2.50 mg PM/km (currently 10 mg PM/mile (6.25 mg PM/km))) is proposed, the paper commenting that: Staff has received input from a number of manufacturers suggesting that a standard of 3 mg PM/mile (1.88 mg PM/km) can be met for gasoline direct injection engines without requiring the use of particulate filters. Additionally, the paper states that since the PM mass and count emissions appear to be correlated: Although a mandatory number standard is not being considered at this time, an optional PM number standard of about 1012 particles/mile [6.2511 particles/km] is being considered (which could be chosen by manufacturers instead of the PM mass standard). However, since neither the PM standard nor the PM number standard has been set by CARB yet, it is too soon to know whether particulate filtration will be necessary for the Californian or US vehicle market generally. It is nevertheless possible that certain vehicle manufacturers will choose filters in order to provide a margin of safety on any positive ignition engine design options selected to meet whatever standards are eventually set. The new Euro 6 emission standard presents a number of challenging design problems for meeting gasoline emission standards. In particular, how to design a filter, or an exhaust system including a filter, for reducing the number of PM gasoline (positive ignition) emissions, yet at the same time meeting the emission standards for non-PM pollutants such as one or more of oxides of nitrogen (NO x), carbon monoxide (CO) and unburned hydrocarbons (HC), all at an acceptable back pressure, e.g. as measured by maximum on-cycle backpressure on the EU drive cycle. It is envisaged that a minimum of particle reduction for a three-way catalysed particulate filter to meet the Euro 6 PM number standard relative to an equivalent flowthrough catalyst is ?50%. Additionally, while some backpressure increase for a three-way catalysed wallflow filter relative to an equivalent flowthrough catalyst is inevitable, in our experience peak backpressure over the MVEG-B drive cycle (average over three tests from fresh) for a majority of passenger vehicles should be limited to <200 mbar, such as <180 mbar, <150 mbar and preferably <120 mbar e.g. <100 mbar. PM generated by positive ignition engines has a significantly higher proportion of ultrafine, with negligible accumulation and coarse mode compared with that produced by diesel (compression ignition) engines, and this presents challenges to removing it from positive ignition engine exhaust gas in order to prevent its emission to atmosphere. In particular, since a majority of PM derived from a positive ignition engine is relatively small compared with the size distribution for diesel PM, it is not practically possible to use a filter substrate that promotes positive ignition PM surface-type cake filtration because the relatively low mean pore size of the filter substrate that would be required would produce impractically high backpressure in the system. Furthermore, generally it is not possible to use a conventional wallflow filter, designed for trapping diesel PM, for promoting surface-type filtration of PM from a positive ignition engine in order to meet relevant emission standards because there is generally less PM in positive ignition exhaust gas, so formation of a soot cake is less likely; and positive ignition exhaust gas temperatures are generally higher, which can lead to faster removal of PM by oxidation, thus preventing increased PM removal by cake filtration. Depth filtration of positive ignition PM in a conventional diesel wallflow filter is also difficult because the PM is significantly smaller than the pore size of the filter medium. Hence, in normal operation, an uncoated conventional diesel wallflow filter will have a lower filtration efficiency when used with a positive ignition engine than a compression ignition engine. Another difficulty is combining filtration efficiency with a washcoat loading, e.g. of catalyst for meeting emission standards for non-PM pollutants, at acceptable backpressures. Diesel wallflow particulate filters in commercially available vehicles today have a mean pore size of about 13 ?m. However, we have found that washcoating a filter of this type at a sufficient catalyst loading such as is described in US 2006/0133969 to achieve required gasoline (positive ignition) emission standards can cause unacceptable backpres sure. In order to reduce filter backpressure it is possible to reduce the length of the substrate. However, there is a finite level below which the backpressure increases as the filter length is reduced. Suitable filter lengths for filters according to embodiments of the present invention are from 2-12 inches long, preferably 3-6 inches long. Cross sections can be circular and in our development work we have used 4.66 and 5.66 inch diameter filters. However, cross-section can also be dictated by space on a vehicle into which the filter is required to fit. So for filters located in the so-called close coupled position, e.g. within 50 cm of the engine exhaust manifold where space is at a premium, elliptical or oval filter cross sections can be contemplated. As would be expected, backpressure also increases with washcoat loading and soot loading. There have been a number of recent efforts to combine three-way catalysts with filters for meeting the Euro 6 emission standards. U.S. 2009/0193796 discloses a three-way conversion catalyst coated onto a particulate trap. The Examples disclose e.g. a soot filter having a catalytic material prepared using two coats: an inlet coat and an outlet coat. The mean pore size of the soot filter substrate used is not mentioned. The inlet coat contains alumina, an oxygen storage component (OSC) and rhodium all at a total loading of 0.17 g in ?3; the outlet coat includes alumina, an OSC and palladium, all at a total loading of 0.42 g in?3. However, we believe that the three-way catalyst washcoat loading of <0.5 g in?3 provides insufficient three-way activity to meet the required emission standards alone, i.e. the claimed filter appears to be designed for inclusion in a system for location downstream of a three-way catalyst comprising a flowthrough substrate monolith. WO 2009/043390 discloses a catalytically active particulate filter comprising a filter element and a catalytically active coating composed of two layers. The first layer is in contact with the in-flowing exhaust gas while the second layer is in contact with the out-flowing exhaust gas. Both layers contain aluminium oxide. The first layer contains palladium, the second layer contains an oxygen-storing mixed cerium/zirconium oxide in addition to rhodium. In Examples, a wallflow filter substrate of unspecified mean pore size is coated with a first layer at a loading of approximately 31 g/l and a second layer at a loading of approximately 30 g/l. That is, the washcoat loading is less than 1.00 g in ?3. For a majority of vehicle applications, this coated filter is unlikely to be able to meet the required emission standards alone. A difficulty in coating a filter with a catalyst composition is to balance a desired catalytic activity, which generally increases with washcoat loading, with the backpressure that is caused by the filter in use (increased washcoat loading generally increases backpressure) and filtration efficiency (backpressure can be reduced by adopting wider mean pore size and higher porosity substrates at the expense of filtration efficiency). SUMMARY OF THE INVENTION According to an embodiment of the invention, we have now discovered, very surprisingly, that it is possible to adapt a relatively porous particulate filtersuch as a particulate filter adapted for a diesel applicationso that it can be used to trap e.g. ultrafine positive ignition PM at an acceptable pressure drop and backpressure. In particular, our inventors have determined that a washcoat that hinders access of the PM to a porous structure of a filter substrate can beneficially promote surface filtration substantially at the expense of depth filtration to the extent that cake filtration of PM derived from a positive ignition engine is promoted or enhanced. Early indications suggest that positive ignition PM combusts in oxygen at lower temperatures than diesel PM. Investigations are continuing, but the invention makes use of this observation by providing means for trapping the positive ignition PM for combustion in oxygen. According to one aspect, the invention provides a filter for filtering particulate matter (PM) from exhaust gas emitted from an engine, such as a compression ignition engine or a positive ignition engine, e.g. a vehicular positive ignition engine such as a stoichiometrically-operated positive ignition engine or a lean burn positive ignition engine, which filter comprising a porous substrate having inlet surfaces and outlet surfaces, wherein the inlet surfaces are separated from the outlet surfaces by a porous structure containing pores, e.g. surface pores, of a first mean pore size, wherein the porous substrate is coated with a washcoat comprising a plurality of solid particles wherein the porous structure of the washcoated porous substrate contains pores of a second mean pore size, and wherein the second mean pore size is less than the first mean pore size. DETAILED DESCRIPTION OF THE INVENTION Early indications are that at least some embodiments of the present invention directed to use with a positive ignition engine are capable of reducing positive ignition engine particle number emissions by >30% such as >50% e.g. >80% or even >90% at acceptable backpressure. Mean pore size can be determined by mercury porosimetry. It will be understood that the benefit of the invention is substantially independent of the porosity of the substrate. Porosity is a measure of the percentage of void space in a porous substrate and is related to backpressure in an exhaust system: generally, the lower the porosity, the higher the backpressure. However, the porosity of filters for use in the present embodiments of the invention are typically >40% or >50% and porosities of 45-75% such as 50-65% or 55-60% can be used with advantage. The mean pore size of the washcoated porous substrate is important for filtration. So, it is possible to have a porous substrate of relatively high porosity that is a poor filter because the mean pore size is also relatively high. The porous substrate can be a metal, such as a sintered metal, or a ceramic, e.g. silicon carbide, cordierite, aluminium nitride, silicon nitride, aluminium titanate, alumina, cordierite, mullite e.g., acicular mullite (see e.g. WO 01/16050), pollucite, a thermet such as Al 2O3/Fe, Al2O3/Ni or B4C/Fe, or composites comprising segments of any two or more thereof. In a preferred embodiment, the filter is a wallflow filter comprising a ceramic porous filter substrate having a plurality of inlet channels and a plurality of outlet channels, wherein each inlet channel and each outlet channel is defined in part by a ceramic wall of porous structure, wherein each inlet channel is separated from an outlet channel by a ceramic wall of porous structure. This filter arrangement is also disclosed in SAE 810114, and reference can be made to this document for further details. Alternatively, the filter can be a foam, or a so-called partial filter, such as those disclosed in EP 1057519 or WO 01/080978. Reasons motivating the coating of a wallflow filter for a diesel application are typically different from that of embodiments of the present invention directed to use with a positive ignition engine. In diesel applications, a washcoat is employed to introduce catalytic components to the filter substrate, e.g. catalysts for oxidising NO to NO 2, yet a significant problem is to avoid backpressure issues as soot is accumulated. Accordingly, a balance is struck between the desired catalytic activity and acceptable backpressure. Contrastingly, a primary motivating factor for washcoating a porous substrate for use of embodiments of the present invention directed to use with a positive ignition engine is to achieve both a desired filtration efficiency and catalytic activity. In one embodiment, the first mean pore size e.g. of surface pores of the porous structure of the porous filter substrate is from 8 to 45 ?m, for example 8 to 25 ?m, 10 to 20 ?m or 10 to 15 ?m. In particular embodiments, the first mean pore size is >18 ?m such as from 15 to 45 ?m, 20 to 45 ?m e.g. 20 to 30 ?m, or 25 to 45 ?m. In embodiments, the filter has a washcoat loading of >0.25 g in ?3, such as >0.5g in?3 or ?0.80 g in?3, e.g. 0.80 to 3.00 g in?3. In preferred embodiments, the washcoat loading is >1.00 g in?3 such as ?1.2 g in?3, >1.5 g in?3, >1.6 g in?3 or >2.00 g in ?3 or for example 1.6 to 2.4 g in?3. In particular combinations of filter mean pore size and washcoat loading the filter combines a desirable level of particulate filtration and catalytic activity at acceptable backpressure. In a first, preferred embodiment, the filter comprises a surface washcoat, wherein a washcoat layer substantially covers surface pores of the porous structure and the pores of the washcoated porous substrate are defined in part by spaces between the particles (interparticle pores) in the washcoat. That is, substantially no washcoat enters the porous structure of the porous substrate. Methods of making surface coated porous filter substrates include introducing a polymer, e.g. poly vinyl alcohol (PVA), into the porous structure, applying a washcoat to the porous filter substrate including the polymer and drying, then calcining the coated substrate to burn out the polymer. A schematic representation of the first embodiment is shown in FIG. 2A. Methods of coating porous filter substrates are known to the skilled person and include, without limitation, the method disclosed in WO 99/47260, i.e. a method of coating a monolithic support, comprising the steps of (a) locating a containment means on top of a support, (b) dosing a pre-determined quantity of a liquid component into said containment means, either in the order (a) then (b) or (b) then (a), and (c) by applying pressure or vacuum, drawing said liquid component into at least a portion of the support, and retaining substantially all of said quantity within the support. Such process steps can be repeated from another end of the monolithic support following drying of the first coating with optional firing/calcination. In this first embodiment, an average interparticle pore size of the porous washcoat is 5.0 nm to 5.0 ?m, such as 0.1-1.0 ?m. A D90 of solid washcoat particles in this first, surface coating embodiment can be greater than the mean pore size of the porous filter substrate and can be in the range 10 to 40 ?m, such as 15 to 30 ?m or 12 to 25 ?m. D90 as used herein defines the particle size distribution in a washcoat wherein 90% of the particles present have a diameter within the range specified. Alternatively, in embodiments, the mean size of the solid washcoat particles is in the range 1 to 20 ?m. It will be understood that the broader the range of particle sizes in the washcoat, the more likely that washcoat may enter the porous structure of the porous substrate. The term substantially no washcoat enters the porous structure of the substrate should therefore be interpreted accordingly. According to a second embodiment, the washcoat can be coated on inlet and/or outlet surfaces and also within the porous structure of the porous substrate. We believe that a surface coating around a pore opening at the inlet and/or outlet surfaces, thereby narrowing the e.g. surface pore size of a bare filter substrate, promotes interaction of the gas phase including PM without substantially restricting the pore volume, so not giving rise to significant increases in back pressure. That is, the pores at a surface of the porous structure comprise a pore opening and the washcoat causes a narrowing of substantially all the pore openings. A schematic representation of the second embodiment is shown in FIG. 2B. Methods of making a filter according to the second embodiment can involve appropriate formulation of the washcoat known to the person skilled in the art including adjusting viscosity and surface wetting characteristics and application of an appropriate vacuum following coating of the porous substrate (see also WO 99/47260). In the first and second embodiments, wherein at least part of the washcoat is coated on inlet and/or outlet surfaces of the porous substrate, the washcoat can be coated on the inlet surfaces, the outlet surfaces or on both the inlet and the outlet surfaces. Additionally either one or both of the inlet and outlet surfaces can include a plurality of washcoat layers, wherein each washcoat layer within the plurality of layers can be the same or different, e.g. the mean pore size in a first layer can be different from that of a second layer. In embodiments, washcoat intended for coating on outlet surfaces is not necessarily the same as for inlet surfaces. Where both inlet and outlet surfaces are coated, the washcoat formulations can be the same or different. Where both the inlet and the outlet surfaces are washcoated, the mean pore size of washcoat on the inlet surfaces can be different from the mean pore size of washcoat on the outlet surfaces. For example, the mean pore size of washcoat on the inlet surfaces can be less than the mean pore size of washcoat on the outlet surfaces. In the latter case, a mean pore size of washcoat on the outlet surfaces can be greater than a mean pore size of the porous substrate. Whilst it is possible for the mean pore size of a washcoat applied to inlet surfaces to be greater than the mean pore size of the porous substrate, it is advantageous to have washcoat having smaller pores than the porous substrate in washcoat on inlet surfaces to prevent or reduce any combustion ash or debris entering the porous structure. According to a third embodiment, the washcoat sits substantially within, i.e. permeates, the porous structure of the porous substrate. A schematic representation of this third embodiment is shown in FIG. 2C. Methods of making a filter according to the third embodiment include the appropriate formulation of the washcoat known to the person skilled in the art including viscosity adjustment, selection of low wetting characteristics and application of an appropriate vacuum following washcoating of the porous substrate (see also WO 99/47260). Alternatively, the porous substrate can be soaked in an appropriate solution of salts and the resulting product dried and calcined. EP 1663458 discloses a SCR filter, wherein the filter is a wallflow monolith and wherein an SCR catalyst composition permeates walls of the wallflow monolith. The specification discloses generally that the walls of the wallflow filter can contain thereon or therein (i.e. not both) one or more catalytic materials. According to the disclosure, permeate, when used to describe the dispersion of a catalyst slurry on the wallflow monolith substrate, means the catalyst composition is dispersed throughout the wall of the substrate. In the... | 1 |
| ????? ??????????????????????????????????????????????????? ???????????????? ?????????????? ????????????????????????????? ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ???????????????????? ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ??????? ??????? ????? ??????? ???? ??????? ????????? ??????????? ????????????? ???????????????? ?????? ????????????? ?????????????? ???????????????? ?????????????? ?????????? ????? ????? ???????????????????????? ???????????????????????????????? ??????????????????????????????????? ???????????????????????????????? ?????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ????????????????????????????????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????????????? ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ??????????????????????????????????????????????????????????????????????????????????????????????????????? ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ?????? ??????????????????????????????? ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????????? ????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????2????????????????????????????????????????????????????????????????????? ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ?????? ?????????????????????????? ?????????????????????????? ??????????????????????????????????????????????????????????????? ??????????????????????????????????????????????????????? ?????? ?????????????????????????? ?????????????????????????? ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ?????????????????????????????????????????????????????????????????????? ??????????????????????????????????????????????????????????????????????????????????????????? ??????????????????????????????????????????????????????????????????????????? ?????????????????????????????????????????????????????????????? ????????????????????????????????????? | BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is an overall view of a low back pain treatment tool according to Embodiment 1 of the present invention. FIG. 2 is a developed view of the low back pain treatment tool according to Embodiment 1 of the present invention. FIG. 3 is an overall view of a low back pain treatment tool according to Embodiment 2 of the present invention. FIG. 4 is an overall view of a low back pain treatment tool according to Embodiment 3 of the present invention. FIG. 5 is a schematic view showing a case where a wood hand/arm holding portion shown in Embodiment 1 of the present invention is used on the back of a recipient. FIG. 6 is a schematic view showing a case where the wood hand/arm holding portion shown in Embodiment 1 of the present invention is used as an armrest. FIG. 7 is a schematic view for explaining a case where the wood hand/arm holding portion shown in Embodiment 1 of the present invention is used in front of the recipient, with his/her chest and abdomen pressed against a posture holding surface. | TECHNICAL FIELD The present invention relates to a low back pain treatment tool by means of correction of the sacrum, ilium, coccyx, or the like, or more specifically, by means of correction of the pelvis constituted thereby. BACKGROUND ART Pelvis correction is the most common method of relieving low back pain. As a conventional method for pelvis correction, there has been available a treatment method which uses a belt or traction device for fastening the pelvis. A temporary effect can be obtained by compressing only the pelvis using such a device, but the effect does not last very long: for example, the pain comes back after a predetermined period of time elapses since the end of the use of the belt or the like. Examples of such a device include the one that uses a geared motor (Patent Document 1) and the one that requires a recipient to perform light exercise (Patent Document 2). These devices should be used on a recipient who is in a sitting position, a supine position, or the like, and are not designed for correcting the pelvis while he/she raises his/her body up, or more specifically, is in a standing position which is a stable state for the lumbar vertebra. In addition, the use of a mechanical device such as a motor may lead to excessive correction depending on how it is used. PRIOR ART DOCUMENT Patent Document Patent Document 1: Japanese Unexamined Patent Application Publication No. 2010-188171 Patent Document 2: Japanese Unexamined Patent Application Publication No. 8-126718 SUMMARY OF THE INVENTION Problems to be Solved by the Invention The followings are the problems to be solved. 1. Only a temporary effect can be obtained by compressing the pelvis. 2. The pelvis is not corrected while a recipient is in a standing position which is a stable state for the lumbar vertebra. 3. A device which uses a motor may provide excessive correction. 4. A device which requires light exercise lacks in convenience, and limits users who can use it. In consideration of the above problems, it is an object of the present invention to provide a low back pain treatment tool which can correct the pelvis while a recipient is in a standing position, and which safely and properly corrects the pelvis by pressing the coccyx using the weight of the recipient. Means for Solving the Problem As described in claim 1, the present invention is a low back pain treatment tool comprising: a cylindrical casing elongated in a longitudinal direction; a coccyx contact treatment member which is slidably placed through an elastic member in an axial direction of the cylindrical casing; a coccyx contact buffering member which is provided on an upper end of the coccyx contact treatment member; a posture holding member having a posture holding surface in a longitudinal direction, which faces the cylindrical casing; and a handle fixed to the posture holding member. In addition, as described in claim 2, the present invention is the low back pain treatment tool according to claim 1, wherein the cylindrical casing is fixed and supported on the posture holding member by fixing a horizontal seat plate vertically with respect to the posture holding surface and coupling a lower end of the cylindrical casing to an upper surface of the horizontal seat plate. Further, as described in claim 3, the present invention is the low back pain treatment tool according to claim 1, wherein the cylindrical casing is fixed and supported on the posture holding member by fixing the posture holding member on a horizontal base plate, fixing a pair of left and right side plates orthogonally to a horizontal surface of the base plate and the posture holding surface, and attaching a horizontal seat plate between the side plates. Still further, as described in claim 4, the present invention is a low back pain treatment tool comprising: a cylindrical casing elongated in a longitudinal direction; a coccyx contact treatment member which is slidably placed through an elastic member in an axial direction of the cylindrical casing; a coccyx contact buffering member which is provided on an upper end of the coccyx contact treatment member; a posture holding member having a posture holding surface in a longitudinal direction, which faces the cylindrical casing; a handle fixed to the posture holding member; a horizontal seat plate which fixes and supports the cylindrical casing on the posture holding member by being fixed vertically with respect to the posture holding surface and coupling a lower end of the cylindrical casing to an upper surface of the horizontal seat plate; a horizontal base plate which fixes the posture holding member; a pair of left and right side plates which are fixed orthogonally to a horizontal surface of the base plate and the posture holding surface, and which support left and right sides of the horizontal base plate respectively; corner portions formed by an outer surface of either of the side plates, the posture holding surface, and a horizontal surface of the base plate; and rectangular parallelepiped foot rest blocks which are detachably placed at the corner portions. Effects of the Invention According to the invention set forth in claim 1, riding on the coccyx contact treatment member of the low back pain treatment tool in a standing position can restore the downward movement of the spine by upward vertical compression from immediately below the coccyx using the weight of the recipient. Treating a recipient in a standing position can allow positional correction of the sacrum, ilium, coccyx, or the like, or more specifically, correction of the pelvis constituted thereby, in a stable state for the lumbar vertebra, making it possible to continuously relieve low back pain. By vertically vibrating the coccyx contact treatment member which is slidably placed through the elastic member, while riding on it, a recipient can finely adjust the position of the coccyx contact treatment member at the pelvis, so that he/she can achieve pelvis correction at a proper position. According to the invention set forth in claim 2, the cylinder casing is fixed and supported on the posture holding member by fixing the cylinder casing on the upper surface of the horizontal seat plate provided at a proper height, the length of the cylinder casing can be reduced. This prevents excessive moment force from being applied to the bolt which is located at the basal portion of the cylinder casing to fix it, thereby reducing the occurrence of failures. In addition, shorter length of the cylinder casing can save on costs. According to the invention set forth in claim 3, by providing the pair of left and right side surface plates fixed orthogonally to the horizontal seat plate and the posture holding surface of the posture holding member, the orientation of the horizontal seat plate can be kept constant even under load of the weight of the recipient. According to the invention set forth in claim 4, the rectangular parallelepiped foot rest blocks are stably provided in place at the corner portions, which are formed by three surfaces consisting of the outer surface of either of the side plates, the horizontal surface of the base plate, and the posture holding surface, so that the blocks can simultaneously come into contact with the surfaces. Thereby the recipient can more easily apply his/her weight to the coccyx contact treatment member in a standing position while riding on the treatment tool. More specifically, he/she can thereby appropriately select and easily adjust the height at which he/she can take his/her feet off the foot rest blocks while riding on the treatment tool, and can also make height adjustment in accordance with his/her height, before he/she uses the treatment tool. | BEST MODES FOR CARRYING OUT THE INVENTION (Embodiment 1) Embodiment 1 of the present invention will be described below with reference to FIGS. 1 and 2. With a cylindrical casing 7 placed so that its axial direction is along the vertical direction, an inner cylindrical casing 8 and a coccyx contact treatment member 9a, each having a smaller diameter than that of the casing 7, are inserted thereinto. In this case, a coil spring as an elastic member 10 is provided below the inner cylindrical casing 8, and then the inner cylindrical casing 8 and the coccyx contact treatment member 9a are arranged so that they can slide vertically relative to the casing 7. With such an arrangement, the coccyx contact treatment member 9a is placed so that it can slide in the axial direction of the casing 7 through the elastic member 10. The coccyx contact treatment member 9a has a cylindrical shape, is configured so that its diameter can be changed in accordance with the body size of a recipient, and has a flat surface to be contacted by the recipient. It should be noted, however, that a coccyx contact treatment member 9b having projections on the surface to be contacted by the recipient, may be used depending on the symptoms of low back pain of the recipient. A sponge is provided as a coccyx contact buffering member 11 in a center of a recipient-side end face of the coccyx contact treatment member 9a or 9b to avoid excessive compression of the coccyx of the recipient. A base for supporting the cylindrical casing 7 is constituted by a horizontal seat plate 6, a pair of side plates 3 provided on the left and right sides of the horizontal seat plate 6, and a base plate 5. The cylindrical casing 7 is fixed to the horizontal seat plate 6, which is a constitute element of the base, with bolts 12, washers 13, and nuts 14. A posture holding member 2 which is used by a recipient to hold his/her posture when he/she rides on the coccyx contact treatment member 9a has a posture holding surface of a plate-like shape elongated in the vertical direction, and is provided adjacent to the cylindrical casing 7 to be fixed to the base plate 5, side plates 3, and horizontal seat plate 6. A handle which is used by a recipient when he/she rides on the coccyx contact buffering member 11 is fixed to the posture holding member 2. Rectangular parallelepiped foot rest blocks 15 for a recipient are placed at corner portions formed by three surfaces consisting of the outer surface of either of the side plates 3, the posture holding surface of the posture holding member 2, and the horizontal surface of the base plate, so that the blocks can simultaneously come into contact with the surfaces. A method of using a low back pain treatment tool 1 according to the above-mentioned embodiment will be described with reference to FIG. 5. FIG. 5 is a view showing a case where a hand/arm holding portion 4 as a handle is used so that the back of a recipient comes into contact with the posture holding member 2. The recipient straddles the cylindrical casing 7 of the low back pain treatment tool 1 to place his/her coccyx on the coccyx contact buffering member 11. At this time, the recipient spreads his/her legs by about the breadth of his/her shoulders in a standing position. With his/her back against the posture holding member 2, the recipient then stretches his/her arms backward over the hand/arm holding portion 4 as a handle, bends his/her arms so that the handle is located on the inside of his/her elbows, and takes his/her forearms toward the front of him/her from below the handle. Thereby, the recipient can stably keep himself/herself in a standing position. Depending on the symptoms of his/her low back pain, he/she may correct his/her pelvis and relieve his/her pain by using the low back pain treatment tool 1 for five minutes per use and about two times per day. The foot rest blocks 15 have a rectangular parallelepiped shape, and hence can be easily positioned at the corner portions formed by the three surfaces consisting of the outer surface of either of the side plates 3, the posture holding surface of the posture holding member 2, and the horizontal surface of the base plate 5, while simultaneously coming into contact with the three surfaces. Thereby the recipient can more easily apply his/her weight to the coccyx contact treatment member 11 in a standing position while riding on the treatment tool. More specifically, he/she can thereby appropriately select and easily adjust the height at which he/she can take his/her feet off the foot rest blocks while riding on the treatment tool, and can also make height adjustment in accordance with his/her height by stacking two or more foot rest blocks 15 or replacing the foot rest blocks 15 with ones of different heights, before he/she uses the treatment tool. The coccyx contact treatment member 9a is slidably placed through the elastic member, and therefore, when the recipient places his/her coccyx on the coccyx contact buffering member 11, he/she finely adjusts the position of the coccyx contact treatment member 9a by vertically vibrating the coccyx contact treatment member 9a while riding on it. FIG. 6 is a view showing a case where the low back pain treatment tool according to the present invention is used with hand/arm holding portions 4 as handles being used as armrests. FIG. 7 is a view showing a case where the low back pain treatment tool according to the present invention is used with the chest and abdomen of a recipient pressed against the posture holding member 2. (Embodiment 2) Embodiment 2 of the present invention will be described with reference to FIG. 3. The internal configuration of a cylindrical casing 7 is the same as that in Embodiment 1. In this embodiment, the cylindrical casing 7 is directly fixed to a base plate 5, which is a constituent element of a base, with bolts 12, washers 13, and nuts 14. Longer longitudinal length of the cylindrical casing 7 reduces the number of components and allows simpler configuration as compared with Embodiment 1. (Embodiment 3) Embodiment 3 of the present invention will be described with reference to FIG. 4. The internal configuration of a cylindrical casing 7 is the same as that in Embodiment 1. In this embodiment, a base for supporting a cylindrical casing 7 is constituted by a horizontal seat plate 6 and a base plate 5. The cylindrical casing 7 is fixed to the horizontal seat plate 6, which is a constitute element of the base, with bolts 12, washers 13, and nuts 14. The horizontal seat plate 6 is fixed to a posture holding member 2 with shelf supports 17, and the posture holding member 2 is fixed to the base plate 5 with bolts. In this embodiment, it is only required to fix the horizontal seat plate 6 to the posture holding member 2, and therefore, as in the second embodiment, the number of components is smaller and simpler configuration is possible than in Embodiment 1. The upper end faces of the cylindrical casing 7 and the coccyx contact treatment member 9a are circular so as not to injure a recipient in FIG. 1, but are not limited to this, and may be elliptic for example. Further, in FIG. 1, the coccyx contact treatment member 9a is separated from an inner cylindrical casing 8 in consideration of the possibility that a recipient may change the shape of the coccyx contact treatment member 9a. However, no problem arises even if these components are integrated Again in FIG. 1, the coccyx contact treatment member 9a is smaller in diameter than the cylindrical casing 7, so that the coccyx contact treatment member 9a is placed inside the cylindrical casing 7. However, the present invention is not limited to this configuration, and the coccyx contact treatment member 9a may cover the cylindrical casing 7. The elastic member 10 can be changed in accordance with the weight or symptoms of the recipient, and a coil spring is used in FIG. 2, but a leaf spring or rubber may be used as the elastic member 10. The coccyx contact treatment member 9a or 9b comes into contact with a recipient, and hence is preferably made of wood. However, depending on the symptoms of the recipient, the coccyx contact treatment member 9a or 9b may be made of rubber which is softer than wood, or aluminum which is harder than wood. The horizontal seat plate 6 and the cylindrical casing 7 are fixed with bolts in FIG. 2. However, the present invention is not limited to this, and they may be fixed, for example, with a wedge or by fitting. The hand/arm holding portion 4 which is used as a handle in FIGS. 5 and 6 is rodlike. However, the shape of the hand/arm holding portion 4 is not limited to this, and may be platelike. Referring to FIG. 3, the hand/arm holding portion 4 is coupled to the posture holding member 2 so as to allow height adjustment. DESCRIPTION OF REFERENCE NUMERALS 1 : Low back pain treatment tool 2 : Posture holding plate 3 : Side plate 4 : Hand/arm holding portion 5 : Base plate 6 : Horizontal seat plate 7 : Cylindrical casing 8 : Inner cylindrical casing 9 a: Coccyx contact treatment member 9 b: Coccyx contact treatment member having projections 10 : Elastic member 11 : Coccyx contact buffering member 12 : Casing fixing bolt 13 : Casing fixing washer 14 : Casing fixing nut 15 : Foot rest block 16 : Human body 17 : Shelf support | 1 |
| BRIEF DESCRIPTION OF THE DRAWINGS The present invention will become more fully understood from the detailed description given hereinbelow and the accompanying drawings which are given by way of illustration only, and thus are not limitative of the present invention, and wherein: FIG. 1 is a whole configuration diagram showing the configuration of an electric clutch; FIG. 2 is a block diagram showing the whole configuration of a fail detecting device for a rotation angle sensor according to one embodiment of the present invention; FIG. 3 is an enlarged diagram of a cam; FIG. 4 is an explanatory diagram of the configuration of the cam; FIG. 5 is a graph showing the output characteristic of an angle sensor; FIG. 6 is a graph showing the sensor output of the angle sensor when the cam continuously rotates; FIG. 7 is a flowchart showing the procedure of angle sensor fail detection processing according to one embodiment of the present invention; and FIG. 8 is a sub-flowchart showing the procedure of sensor value comparison processing. CROSS-REFERENCE TO RELATED APPLICATIONS The present application claims priority under 35 USC 119 to Japanese Patent Application No. 2010-068476 filed Mar. 25, 2011 the entire contents of which are hereby incorporated by reference. BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a fail detecting device for a rotation angle sensor. More particularly to a fail detecting device for a rotation angle sensor for detecting the fail state of the rotation angle sensor that detects the rotation angle of an object to be detected. 2. Description of Background Art Conventionally, there has been known a configuration in which a plurality of rotation angle sensors are provided in a rotation angle detecting system to detect the rotation angle of a rotating body as preparation for the occurrence of a fail such as breakdown in the rotation angle sensor. Japanese Patent Laid-open No. 2005-265768 discloses a configuration in a rotation angle detecting system to detect the rotation angle of a ball bearing configured with a bearing ring composed of inner ring and outer ring. A plurality of spherical rolling elements rotate along the bearing ring with a cage that separates the rolling elements. More specifically, in this configuration, at least two rotation angle sensors formed of Hall elements are provided to detect the rotation angle of the cage. However, in the technique described in Japanese Patent Laid-open No. 2005-265768, although a fail can be easily detected by comparing the respective sensor outputs even when a fail such as breakdown has occurred in any sensor, there is a problem that the increase in the number of sensors causes an increase in the number of parts and an increase in the complexity of arithmetic processing, and so forth. SUMMARY AND OBJECTS OF THE INVENTION An object of an embodiment of the present invention is to solve the above-described problem of the related art and provide a fail detecting device for a rotation angle sensor, capable of surely detecting a fail of the rotation angle sensor even if the number of rotation angle sensors that deal with an object to be detected is one. To achieve the above-described object, according to an embodiment of the present invention, in a fail detecting device for a rotation angle sensor, having a cam ( 25) that has a cam surface in which an actuating surface (A, B) that reciprocates a push rod (35) and a non-actuating surface (C, D, E) that does not reciprocate the push rod (35) are continuously formed, an angle sensor (21) formed of an endless rotary potentiometer that detects the rotation angle of the cam (25) and has an output voltage (S) increasing in proportion to the rotation angle in a range of 360 degrees, and a controller (50) that detects a fail state of the angle sensor (21), the cam (25) is configured so as to be driven to rotate in one direction by an electric motor (1) controlled by the controller (50) to reciprocate the push rod (35). The output voltage (S) of the angle sensor (21) is set so that a region equal to or lower than a first predetermined voltage (V1) and a region equal to or higher than a second predetermined voltage (V2) higher than the first predetermined voltage (V1) are recognized as a dead zone (D). The controller (50) is configured so as to drive the rotation of the cam (25) to a predetermined position in the non-actuating surface (C, D, E) at a constant speed in transition of the cam surface of the cam (25) abutting against the push rod (35) from the side of the actuating surface (A, B) to the side of the non-actuating surface (C, D, E). The angle sensor (21) is configured so that the dead zone (D) is disposed at a position in the non-actuating surface (C, D, E) of the cam (25) and in an area in front of the predetermined position. According to an embodiment of the present invention, the controller ( 50) measures an elapsed time from transition of the cam surface to the dead zone (D) by a timer (54) and determines that the rotation angle sensor (21) is in the fail state if the output voltage (S) corresponding to the dead zone (D) is detected although an estimated time of passage through the dead zone (D) has elapsed. According to an embodiment of the present invention, the controller ( 50) measures an elapsed time from transition of the cam surface from the actuating surface (B) to the non-actuating surface (C) by a timer (54) and determines that the rotation angle sensor (21) is in the fail state if the output voltage (S) corresponding to the dead zone (D) is detected although an estimated time of passage through the dead zone (D) has elapsed. According to an embodiment of the present invention, the controller ( 50) stores the output voltage (S) of timing to transition to the dead zone (D) as a saved value (V2) and determines that the rotation angle sensor (21) is in the fail state if the output voltage (S) is the same as the saved value (V2) although an estimated time of passage through the dead zone (D) has elapsed and a predetermined time has elapsed in this state. According to an embodiment of the present invention, the controller ( 50) determines that the rotation angle sensor (21) is in the fail state if the output voltage (S) is outside a range between upper and lower limits set in advance although an estimated time of passage through the dead zone (D) has elapsed and a predetermined time has elapsed in this state. According to an embodiment of the present invention, the controller ( 50) stores the sensor value (S) of timing to transition to the dead zone (D) as a saved value (V2) and determines that the rotation angle sensor (21) is in the fail state if the output voltage (S) is not a value corresponding to the predetermined position in the non-actuating surface (E) although an estimated time of passage through the dead zone (D) has elapsed. According to an embodiment of the present invention, the cam is configured so as to be driven to rotate in one direction by the electric motor controlled by the controller and reciprocate the push rod. The output voltage of the angle sensor is set so that the region equal to or lower than the first predetermined voltage and the region equal to or higher than the second predetermined voltage higher than the first predetermined voltage are recognized as the dead zone. The controller is configured so as to drive rotation of the cam to a predetermined position in the non-actuating surface at a constant speed in the transition of the cam surface of the cam abutting against the push rod from the actuating surface side to the non-actuating surface side. The angle sensor is configured so that the dead zone is disposed at a position in the non-actuating surface of the cam and in an area in front of the predetermined position. Therefore, the predetermined time to reach to the predetermined position after the passage through the dead zone of the angle sensor in the transition of the cam from the actuating surface side to the non-actuating surface side is obtained in advance. Thus, for example if no change is observed in the sensor output although the predetermined time has elapsed from the entry into the dead zone, this can be determined to be the fail state of the angle sensor. This allows detection of the fail state of the rotation angle sensor even if the number of rotation angle sensors corresponding to the push rod is one, and thus can suppress increase in the number of parts and the cost. According to an embodiment of the present invention, the controller measures the elapsed time from the transition of the cam surface to the dead zone by the timer and determines that the rotation angle sensor is in the fail state if the output voltage corresponding to the dead zone is detected although the estimated time of the passage through the dead zone has elapsed. Thus, the time measurement by the timer is started at the timing of the transition to the dead zone. This enhances the reliability of the time measurement for detecting the dead zone passage. According to an embodiment of the present invention, the controller measures the elapsed time from the transition of the cam surface from the actuating surface to the non-actuating surface by the timer and determines that the rotation angle sensor is in the fail state if the output voltage corresponding to the dead zone is detected although the estimated time of the passage through the dead zone has elapsed. Thus, the time measurement by the timer is started at the timing of the transition of the cam surface from the actuating surface side to the non-actuating surface side. This enhances the reliability of the time measurement for detecting the dead zone passage. According to an embodiment of the present invention, the controller stores the output voltage of the timing to transition to the dead zone as the saved value and determines that the rotation angle sensor is in the fail state if the output voltage is the same as the saved value although the estimated time of the passage through the dead zone has elapsed and the predetermined time has elapsed in this state. Thus, the determination as to the fail state can be accurately made by comparison between the stored saved value and the present output voltage. According to an embodiment of the present invention, the controller determines that the rotation angle sensor is in the fail state if the output voltage is outside the range between the upper and lower limits set in advance although the estimated time of the passage through the dead zone has elapsed and the predetermined time has elapsed in this state. Thus, the determination as to the fail state can be accurately made by comparison between the upper and lower limits set in advance and the present output voltage. According to an embodiment of the present invention, the controller stores the sensor value of the timing to transition to the dead zone as the saved value and determines that the rotation angle sensor is in the fail state if the output voltage is not a value corresponding to the predetermined position in the non-actuating surface although the estimated time of the passage through the dead zone has elapsed. Thus, the determination as to the fail state can be accurately made based on the output voltage at a position except for the dead zone. Further scope of applicability of the present invention will become apparent from the detailed description given hereinafter. However, it should be understood that the detailed description and specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS Preferred embodiments of the present invention will be described in detail below with reference to the drawings. FIG. 1 is a whole configuration diagram of an electric clutch 30 according to one embodiment of the present invention. The electric clutch 30 is e.g. a mechanism that is disposed between engine and transmission of a motorcycle or the like for controlling the disconnection and connection of the rotational driving force. The normally-open electric clutch 30 driven by an electric motor 1 is based on a double-spring system including a push spring 39 and a return spring 43 having spring rates different from each other as biasing members to bias the clutch in the open (disengagement) direction. The electric clutch 30 is so configured that a cam shaft 23 on which a cam 25 is provided is driven to rotate to an arbitrary angle by the rotational driving force of the electric motor 1 to thereby reciprocate a push rod 35 abutting against the cam 25 and drive disengagement and engagement of the clutch. The electric motor 1 has a rotor 4 formed integrally with an output shaft 5 and a stator 3 fixed to the inner circumference of a motor housing 2. A bearing 7 that pivotally supports the output shaft 5 is fitted into a base part 6 that seals the opening of the motor housing 2. A gear 8 formed at an end of the output shaft 5 is meshed with a first intermediate gear 9 that is pivotally supported by bearings 10 and 11 and is composed of two gears integrally formed. The rotational driving force transmitted to the first intermediate gear 9 is transmitted to an input gear 20 spline-fitted into the cam shaft 23 via a second intermediate gear 12 pivotally supported by bearings 13 and 14 and a third intermediate gear 16 pivotally supported by bearings 17 and 18. In the second intermediate gear 12, a tool attachment shaft 15 for allowing attachment of an emergency tool (not shown) to manually rotate the second intermediate gear 12 is provided. At the upper end of the cam shaft 23 in the diagram, a rotation angle sensor (hereinafter, it will be often referred to simply as the angle sensor) 21 formed of a potentiometer to detect the rotation angle of the cam shaft 23 is provided. The cam shaft 23 is pivotally supported by a bearing 19 disposed close to the input gear 20 and bearings 24 and 26 disposed on both sides of the cam 25 in such a manner as to be freely rotatable. In the present embodiment, an oil seal 22 is disposed at substantially the intermediate part of the cam shaft 23. This allows e.g. a layout in which the mechanism from the electric clutch 30 to the cam 25 is housed in the crankcase of the engine whereas the mechanism from the electric motor 1 to the intermediate part of the cam shaft 23 is disposed outside the crankcase. The electric clutch 30 is attached to one end of a main shaft 48 as the input shaft of the transmission (not shown). A primary driven gear 45 that is pivotally supported on the main shaft 48 in such a manner as to be freely rotatable and to which the rotational driving force is transmitted from the crankshaft (not shown) is connected to a clutch outer 41 via plural annular dampers 46. A bearing 47 of the main shaft 48 is disposed on the left side of the primary driven gear 45 in the diagram. When the electric clutch 30 becomes the engaged state, the rotational driving force of the clutch outer 41 is transmitted to the main shaft 48 via a clutch inner 44. More specifically, when the push rod 35 is pushed to the left side in the diagram by the rotational driving force of the electric motor 1, a first push plate 36 is pressed via a bearing 34. The push spring 39 composed of a plurality of coil springs is disposed between the first push plate 36 and a second push plate 38. The return spring 43 composed of plural coil springs is disposed between the second push plate 38 and the clutch inner 44. The second push plate 38 is slid in the left direction in the diagram against the biasing force of both springs 39 and 43. Thereby, the clutch engagement operation is carried out. The second push plate 38 is engaged with the clutch inner 44 in such a manner so as to give a predetermined preload to the return spring 43 and is fixed to the main shaft 48 by a nut 33 with the intermediary of a washer 32 to restrict the range of the slide in the right direction in the diagram. Furthermore, the range of the slide of the first push plate 36 in the right direction in the diagram is restricted by a circlip 37. When the second push plate 38 is slid in the left direction in the diagram, a clutch plate 42 is pressed in the left direction in the diagram by an annular pressing member 40 fixed to the second push plate 38. Thereby, the electric clutch 30 is switched from the disengaged state to the engaged state. FIG. 2 is a block diagram showing the whole configuration of the fail detecting device for a rotation angle sensor according to one embodiment of the present invention. The same numeral as that in the above description denotes the same or equivalent part. A controller 50 includes a sensor output recognizer 51 that recognizes the sensor output of the angle sensor 21, a sensor fail determiner 52 that determines the fail state of the angle sensor 21, a motor controller 53 that controls the electric motor 1, and a timer 54 that measures various predetermined times. The sensor output recognizer 51 inputs the sensor output of the angle sensor 21 to the sensor fail determiner 52. The motor controller 53 inputs the control state of the electric motor 1 to the sensor fail determiner 52. The sensor fail determiner 52 detects the fail state of the angle sensor 21 based on the control state of the electric motor 1 and the measurement result of the timer 54 in addition to the sensor output from the angle sensor 21. FIG. 3 is an enlarged diagram of the cam 25. FIG. 4 is an explanatory diagram of the configuration of the cam 25. The cam 25 rotates integrally with the cam shaft 23 driven to rotate by the electric motor 1 to thereby reciprocate the push rod 35 that is supported so as to be capable of reciprocation in the left and right directions in the diagram. In the cam 25, a continuous cam surface composed of cam surfaces 25a to 25e is formed. The cam 25 according to the present embodiment is driven by the electric motor 1 in such a manner so as to rotate only in the anticlockwise direction. Thereby, the cam surface abutting against the push rod 35 changes in the order of the cam surface 25a?25b?25c?25d?25e in association with the rotation of the cam 25. In the present embodiment, the cam surface 25a that drives the clutch in the engagement direction is set as engagement area A. The cam surface 25b that drives the clutch in the disengagement direction is set as disengagement area B. The cam surface 25c that keeps the disengaged state of the clutch is set as bridge area C. The cam surface 25d that similarly keeps the disengaged state of the clutch is set as dead zone D. The cam surface 25e that similarly keeps the disengaged state of the clutch is set as standby area E. The disengagement area B is formed so that the rising (lift amount) of the cam surface 25b is small, and is configured so that the clutch can be rapidly switched from the state of being engaged by the cam surface 25a to the disengaged state by merely driving the electric motor 1 by a slight angle. The cam surfaces 25c, 25d, and 25e can be formed by a single circular arc. In the present embodiment, the engagement area A and the disengagement area B will be collectively referred to as the actuating surface of the clutch. Furthermore, the bridge area C, the dead zone D, and the standby area E will be collectively referred to as the non-actuating surface of the clutch. The area that includes the position corresponding to 0 degrees as the rotation angle of the cam 25 and ranges between an angle ?1 and an angle ?2 is defined as the dead zone D. The area from the angle ?1 to 90 degrees is defined as the standby area E. The area from 90 degrees to 180 degrees is defined as the engagement area A. The area from 180 degrees to 270 degrees is defined as the disengagement area B. The area from 270 degrees to the angle ?2 is defined as the bridge area C. In the present embodiment, in the transition of the cam 25 from the actuating surface to the non-actuating surface, the cam 25 is driven to rotate to a predetermined position in the non-actuating surface at a constant speed to prepare for the next clutch engagement operation. More specifically, in the transition of the cam 25 from the actuating surface to the non-actuating surface, i.e. in the transition from the disengagement area B to the bridge area C, the cam 25 is driven to rotate to a predetermined position in the standby area E at a constant speed. Due to this feature, the passage through the dead zone D located between the bridge area C and the standby area E is carried out at the constant speed necessarily. The processing of driving the rotation of the cam 25 at a constant speed is started simultaneously with the detection of the boundary between the disengagement area B and the bridge area C and can be executed for a predetermined time in which the cam 25 can be surely rotated to the standby area E. The cam 25 may be stopped at a predetermined position in the standby area E based on the output of the angle sensor 21 after the processing is started simultaneously with detection of the boundary between the disengagement area B and the bridge area C. FIG. 5 is a graph showing the output characteristic of the angle sensor 21. FIG. 6 is a graph showing the sensor output of the angle sensor when the continuously rotates. As described above, the angle sensor 21 is an endless rotary potentiometer whose sensor output (output voltage) S increases in proportion to the rotation angle in the range of 360 degrees. More specifically, the sensor output S is 0 when the angle is 0 degrees. The sensor output S increases in proportion to the angle of rotation and 5 V as the maximum voltage is generated when the angle is 360 degrees. Therefore, if the cam 25 continuously rotates in one direction, a voltage waveform having such a form as to connect 0 V and 5 V is continuously output as shown in FIG. 6. In the present embodiment, among the sensor outputs from 0 V to 5 V, only center values that can be expected to provide high accuracy are used as the effective sensor value and the other part is set as the dead zone. More specifically, the range from 0 degrees to the angle ? 1 corresponding to a sensor output V1 (first predetermined voltage) is set as a dead zone D1 and the range from the angle ?2 corresponding to a sensor output V2 (second predetermined voltage) to 360 degrees is set as a dead zone D2. The dead zones D1 and D2 will be collectively referred to as the dead zone D. The fail detecting device for a rotation angle sensor according to the present invention is characterized in that the dead zone D of the angle sensor 21 is disposed on the non-actuating surface side of the cam 25 and in front of the position to which the cam 25 is driven to rotate at a constant speed in the transition from the disengagement area B to the bridge area C as shown in FIG. 4. Due to this feature, in the transition of the cam 25 from the actuating surface to the non-actuating surface, the passage through the dead zone D is carried out at the constant speed necessarily. Furthermore, because the cam 25 is necessarily rotated to the predetermined position at the constant speed in the transition of the cam 25 from the actuating surface to the non-actuating surface, the position of the cam 25 can be predicted by time measurement by the timer 54. In view of the above-described characteristic, even an angle detecting system having only one angle sensor 21 can easily detect the fail state of the angle sensor 21. For example, the transition from the bridge area C to the dead zone D can be detected due to the reaching of the sensor output S to V2. Thus, if time measurement by the timer 54 is started in response to this transition, it can be determined that a fail has occurred in the angle sensor 21 based on a phenomenon that the sensor output still remains within the sensor output range corresponding to the dead zone D even after the elapse of a predetermined time. Furthermore, the motor controller 53 recognizes the drive signal to the electric motor 1. Thus, if the sensor output corresponding to the standby area E is not output as designed even after the end of the period in which the cam 25 is driven to the standby area E after the passage through the dead zone D at a constant speed, this can be determined to be the fail state of the angle sensor 21. Moreover, also if no change is observed in the sensor output although the electric motor 1 is being driven, this can be determined to be the fail state of the angle sensor 21. The above-described fail determination is made by the sensor fail determiner 52 shown in FIG. 2. FIG. 7 is a flowchart showing the procedure of angle sensor fail detection processing according to one embodiment of the present invention. FIG. 8 is a sub-flowchart showing the procedure of sensor value comparison processing. In a step S1, whether or not the clutch has been disengaged is determined. This determination can be made based on whether or not the sensor output S of the angle sensor 21 has become the value corresponding to the disengagement area B of the cam 25. Furthermore, it is also possible to detect whether or not the clutch has been disengaged based on the rotation speed ratio between the crankshaft and the transmission shaft. If the positive determination is made in the step S 1, the processing proceeds to a step S2, where a sensor saved value before the entry into the dead zone D is recorded. This saved value is the sensor output S detected at the boundary of the bridge area C and the dead zone D of the cam 25. In the present embodiment, the saved value is V2 detected at the angle ?2. In a subsequent step S 3, whether or not the cam 25 is moving to the standby area E is determined. This determination is made based on whether or not control of driving the rotation of the cam 25 to a predetermined position in the standby area E at a constant speed by the motor controller 53 is being carried out. The predetermined position in the standby area E can be arbitrarily set in advance. If the positive determination is made in the step S 3, the processing proceeds to a step S4, where whether or not the estimated time of the dead zone passage has elapsed is determined. This determination can be made because the cam 25 is driven to rotate to a predetermined position in the standby area E at a constant speed in the transition from the disengagement area B to the bridge area C and time measurement by the timer 54 is started at a predetermined timing. The estimated time of the passage through the dead zone D can be calculated in advance based on the rotation speed of the cam 25. By starting the time measurement in response to detection of the boundary between the disengagement area B and the bridge area C of the cam 25 and by starting the time measurement in response to detection of the boundary between the bridge area C and the dead zone D, the completion timing of the passage through the dead zone D can be detected based on the output of the timer 54. If the positive determination is made in the step S 4, the processing proceeds to a step S5, where the sensor value comparison processing is executed. Details of this processing will be described later. If the negative determination is made in the step S1, S3, or S4, the series of control is ended directly. FIG. 8 illustrates the sub-flow showing the procedure of the sensor value comparison processing in the above-described step S5. In a step S10, whether or not the sensor value is equal to or smaller than the set upper limit is determined. In this determination, it is determined whether or not the sensor output S sticks to the upper limit (e.g. 5 V) because any fail has occurred in the angle sensor 21. If the positive determination is made in the step S10, the processing proceeds to a step S11, where whether or not the sensor value is equal to or larger than the set lower limit is determined. In this determination, it is determined whether or not the sensor output S sticks to the lower limit (e.g. 0 V) because any fail has occurred in the angle sensor 21. Next, if a positive determination is made in step S 11, the processing proceeds to step S12, where whether or not the sensor value is in an unequal relationship with the sensor saved value is determined. This determination is made based on a prediction that the sensor output S should be a value different from the sensor saved value V2 after the passage through the dead zone D. Subsequently, if the positive determination is made in the step S 12, the processing proceeds to a step S13, where whether or not the sensor value is a value in the range corresponding to the standby area is determined. This determination is made based on a prediction that the sensor output S should be a value output in the standby area E after the passage through the dead zone D. If the positive determination is made in the step S13, it is determined that the angle sensor 21 is normally operating, so that the series of control is ended. It is also possible to make the determination as to the fail state based on whether or not the sensor value is a value output in the dead zone. This determination is based on a prediction that the sensor output S should not be a value output in the dead zone D after the passage through the dead zone D. If a negative determination is made in the step S 10, S11, S12, or S13, the processing proceeds to a step S14, where a fail detection mode starts based on a determination that possibly any fail has occurred in the angle sensor 21. In the fail detection mode, time measurement by the timer 54 is started. In a step S15, it is determined whether or not a predetermined time has elapsed from the start of the fail detection mode, i.e. from the appearance of suspicion of a fail. If the positive determination is made in step S15, the processing proceeds to step S16, where it is determined that the angle sensor 21 is in the fail state. As described above, in the fail detecting device for a rotation angle sensor according to the present invention, the cam 25 is driven to rotate to a predetermined position in the standby area E at a constant speed in the transition of the cam 25 from the actuating surface to the non-actuating surface, i.e. in the transition from the disengagement area B to the bridge area C. Furthermore, the angle sensor 21 is so configured that the dead zone D is disposed at a position in the non-actuating surfaces C, D, and E of the cam 25 and in the area in front of the predetermined position. Therefore, the predetermined time to reach to the predetermined position after the passage through the dead zone of the angle sensor in the transition of the cam from the actuating surface side to the non-actuating surface side is obtained in advance. Thus, for example if no change is observed in the sensor output although the predetermined time has elapsed from the entry into the dead zone, this can be determined to be the fail state of the angle sensor. This allows even a rotation angle detecting system having only one angle sensor to detect the fail state of the angle sensor and thus can suppress increase in the ... | 1 |
| Other values (2779) |
Length
| Max length | 31693 |
|---|---|
| Median length | 31576 |
| Mean length | 27912.133 |
| Min length | 4428 |
Characters and Unicode
| Total characters | 77707377 |
|---|---|
| Distinct characters | 148 |
| Distinct categories | 17 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 2 ? |
Unique
| Unique | 2784 ? |
|---|---|
| Unique (%) | 100.0% |
Sample
| 1st row | CROSS-REFERENCE TO RELATED APPLICATIONS This application is a continuation of U.S. application Ser. No. 12/567,718, entitled Steam Appliance, filed Sep. 25, 2009, which is herein incorporated by reference in its entirety. BRIEF DESCRIPTION OF THE DRAWINGS The accompanying drawings are not intended to be drawn to scale. For purposes of clarity, not every component may be labeled in every drawing. In the drawings: FIG. 1 is a side view of a steam appliance system according to one embodiment of the invention; FIG. 2 is a side view of a first portion of a connector according to one embodiment of the invention; FIG. 3 is a cross-sectional view of a second portion of a connector configured to engage with the first portion illustrated in FIG. 2; and FIG. 4 is an exploded perspective view of components of the second connector portion illustrated in FIG. 3. FIELD OF THE INVENTION The invention relates generally to steam appliances, and more specifically to a steam applicator that is connectable to a conduit but constructed and arranged be rotated without loosening or disengaging the connection. DISCUSSION OF THE RELATED ART Steam appliances are used in the home to apply steam to floors for cleaning and sanitizing. Various types of steam appliances are known, including canister steam appliances and self-contained steam mops for example. Canister steam appliances typically include a rollable steam generation unit, a hose to transfer the steam from the steam generation unit, a pole, and a mop head or other accessory which is connected to the end of the pole. Self-contained steam mops include a steam generation unit mounted directly on the pole. Handheld steam appliances typically include a container and a nozzle for discharging steam directly from the mouth of the container. SUMMARY Embodiments of the invention provided herein are directed to steam appliances in which a steam applicator is connectable to the steam appliance, but the steam applicator is permitted to rotate without loosening or disengaging the connection of the steam applicator to the steam appliance. According to one embodiment of the invention, a steam appliance includes a steam generation unit, a steam applicator, and a steam conduit configured to guide steam from the steam generation unit to a steam inlet for the steam applicator. The steam applicator is connectable to the steam conduit, and the steam applicator is rotatable relative to the steam conduit in either rotational direction without loosening the connection of the steam applicator to the steam conduit. According to another embodiment of the invention, a method of using a steam applicator having a handle with a end-to-end direction includes acts of grasping the handle with a first hand, grasping a steam conduit with a second hand, bringing a first threaded portion of the steam applicator into contact with a second threaded portion of the steam conduit, and connecting the steam applicator to the steam conduit. The method further includes using the steam applicator to apply steam to an object, and rotating the handle in either rotational direction about the end-to-end direction of the handle to rotate the steam applicator, wherein the rotation of the handle does not loosen the connection of the steam applicator to the steam conduit. Also included is a method of disconnecting the steam applicator from the steam conduit by simultaneously rotating the first threaded portion relative to the second threaded portion and applying an axial force between the conduit and the steam applicator, the axial force being sufficient to overcome a force applied by a resilient element, such that at least one of the first and second threaded portions is altered from a configuration in which the at least one threaded portion is rotatable relative to whichever of the steam applicator and the steam conduit that it is positioned on, to a configuration in which the at least one threaded portion is not rotatable relative to whichever of the steam applicator and the steam conduit that it is positioned on. According to a further embodiment of the invention, a steam appliance includes a steam generation unit, a steam applicator having a handle, a steam conduit to guide steam from the steam generation unit to the steam applicator, and means for mechanically connecting the steam conduit to the handle of the steam applicator. The handle is permitted to repeatedly rotate relative to the steam conduit in either rotation direction about an end-to-end direction of the handle without loosening the connection of the handle to the steam conduit. Various embodiments of the present invention provide certain advantages. Not all embodiments of the invention share the same advantages and those that do may not share them under all circumstances. Further features and advantages of the present invention, as well as the structure of various embodiments of the present invention are described in detail below with reference to the accompanying drawings. DETAILED DESCRIPTION Applicants have recognized the importance of providing a steam applicator assembly which can be freely rotated without compromising the connection of the applicator assembly to a steam conduit. The ability to rotate the steam applicator can be particularly important when the steam applicator assembly is a handheld assembly that is attached to a flexible hose or other flexible conduit because a user may wish to rotate the steam applicator without twisting or kinking the hose. It is also desirable to prevent unintentional disengagement of the steam applicator during rotation of the steam applicator to avoid steam loss and the inconvenience of reconnecting the steam applicator. According to some embodiments of the invention, a steam appliance permits a user to engage and disengage the steam applicator with the same type of motion and without detaching any components. In some embodiments, disconnecting the steam applicator requires two distinct motions. For example, a user may need to push the steam applicator toward the steam conduit and then twist the conduit to separate the steam conduit and the steam applicator. According to one embodiment of the invention, a steam applicator is connected to a flexible steam conduit with a threaded connector configuration which allows rotation of the steam applicator relative to the steam conduit during use without compromising the connection. The threaded connector includes an external thread portion and an internal thread portion. One of the thread portions, for example the internal thread portion, is positioned within an element such as a handle on the steam applicator. The internal thread portion is constructed and arranged to rotate within the handle. By allowing the internal thread portion to float within the handle, friction between the thread portions rotates the internal thread portion within the handle, thereby substantially preventing the complementary external thread portion from being fully twisted into or out of the internal thread portion. To successfully twist the external thread portion into or out of the internal thread portion, the user pushes the two thread portions toward each other, which temporarily fixes the internal thread portion to the handle, thereby permitting relative rotation of the two thread portions. A steam appliance system 100 including two attachable steam applicators 102, 104 is shown in FIG. 1. Steam applicators 102, 104 each may include a handle 107 which is permanently or detachably attached to the applicator. In the embodiment of FIG. 1, steam appliance system 100 includes a steam generation unit 108, a steam conduit 110, and attached steam applicator 102. Steam generation unit 108 may include any suitable type of steam generation system, for example a cool water reservoir 112 and an aluminum die-cast steam generator (not shown). In some embodiments, water may be heated to its boiling point within its reservoir to create steam. It should be noted that the method of steam generation is not intended to be a limiting aspect of the invention. In some embodiments, the steam generation unit 108 is handheld, while in other embodiments the steam generation unit may include a shoulder strap, or include wheels or other rollers. Steam conduit 110 is a flexible hose in some embodiments. Steam conduit 110 may be attachable to steam generation unit 108 with any suitable attachment 114, including a removable connector, such as a bayonet connector. One particular embodiment of a steam appliance which permits rotation a steam applicator without compromising the connection of the steam applicator to the steam appliance is shown in FIGS. 2-4. In this embodiment, a steam appliance includes an externally-threaded connector portion 202 attached to steam conduit 110. A hand grasp portion 206 is attached to steam conduit 110 and threaded connector portion 202 for the user to grip when attaching or detaching steam conduit 110 and handle 107. Steam conduit includes an elongated stem 208 to guide steam through handle 107 and to a steam outlet 212. O-rings 210 or other seal elements may be positioned on stem 208 to establish a seal with the steam applicator, whether that seal be within the handle of the steam applicator, or within the steam applicator itself. The stem and sealing aspects of the illustrated embodiment are not intended to be limiting. A stress release sleeve 214 may be included at the junction of steam conduit 110 and hand grasp portion 206 in some embodiments. An internally-threaded connector portion 302 with threads 304 is positioned within handle 107 in the embodiment illustrated in FIG. 3. Connector portion 302 is permitted to rotate within handle 107, and is also permitted to move axially between stops 306 and 308. Connector portion 302 is biased away from a lock element 310 by a coil spring 312. Instead of a spring, any suitable resilient element may be used to bias connector portion 302 away from lock element 310. For example, a compressible resilient foam gasket may be used in some embodiments. In still other embodiments, a constant force spring, an elastic band, or any other suitable tensioning device, may bias connector portion 302 away from locking element 310 by pulling on connector portion 302. When a user initially inserts externally-threaded connector portion 202 into internally-threaded connector portion 302, rotating the two portions relative to each other will not result in a mating of the threaded portions because connector portion 302 rotates with connector portion 202. However, when the user pushes connector portion 302 against locking element 310 by providing an axial force of at least a threshold force t to overcome the force provided by coil spring 312 connector portion is prevented from rotating by more than a small angle because locking tabs 314 on connector portion 302 are rotated into abutment with locking tabs 316 on the locking element 310. With locking element 310 prevented from rotating, connector portion 202 can be twisted into mating engagement with connector portion 302. Locking element 310 is prevented from moving axially away from connector portion 302 by a stop 318. In this manner, two distinct motions are required of the user to attach or remove a steam applicator from steam conduit 110. While in the illustrated embodiment the two distinct motions include an axial force and a twisting force acting simultaneously, other multiple distinct action configurations may be used. For example, in some embodiments, a ball and groove quick disconnect coupling is used to connect a steam conduit to a steam applicator. In such an embodiment, a first motion may include moving a locking collar, and a second motion may include pulling the handle of the steam applicator away from the steam conduit. Some embodiments may require two or more distinct motions to remove a steam applicator, while allowing attachment of a steam applicator with only a single motion. By requiring two or more distinct motions to remove a steam applicator, unintended disengagement or loosening of the steam applicator during use of the steam appliance may be prevented. For example, the user may rotate the steam applicator in either direction about an end-to-end direction of the steam application when cleaning surfaces, and it may be beneficial to avoid having the steam conduit rotate as a result of the steam applicator rotations. By allowing connector portion 302 to rotate relative to handle 107, handle 107 can rotate without twisting steam conduit 110 and with loosening the engagement of the two threaded connectors. For purposes herein, loosening a connection is intended to include compromising a connection. For example, in some embodiments, a connection may become less than fully engaged such that the connection is at risk of disengaging, yet the connection may not permit perceptible movement of the two connected components relative to one another. In some embodiments, one or more rotation stops may be included to limit the rotation angle of the steam applicator in either rotation direction (e.g., clockwise and counterclockwise about an end-to-end direction of the steam applicator). In such an embodiment, the steam applicator is permitted to rotate a certain amount, for example by permitting connector portion 302 to rotate, but the steam applicator rotation is prevented from further rotations by the rotation stops. The rotation stops may include one or more tabs (not shown) protruding from an interior wall of handle 107 between stops 306 and 308. In some embodiments, the steam applicator is permitted to rotate 180 degrees in either direction, and in some embodiments, the steam applicator is permitted to rotate 360 degrees in either direction. The embodiments described above allow for a tool-free attachment and removal of steam applicators from the steam appliance. In some embodiments, however, a tool may be used. While embodiments described herein are directed to rotations of a steam applicator or a handle about an end-to-end direction of the steam application or the handle, in some embodiments, pitch and/or yaw rotations may be permitted as well. A universal joint may be used in addition to, or instead of, the structures described herein. For purposes herein, the terms connect, connected, connection, attach, attached and attachment refer to direct connections and attachments, indirect connections and attachments, and operative connections and attachments. For example, steam applicator 102 is considered to be connected to steam conduit 110 even though steam applicator is directly connected to handle 107 which is, in turn, connected to steam conduit 110. Also for purposes herein, the terms connectable, attachable, removable, etc. refer both to components which can be connected, attached, removed, etc., and also refer to components which are connected, attached and removed. For ease of understanding, and without limiting the scope of the invention, the embodiments to which this disclosure is addressed are described above particularly in connection with a handheld portable steam appliance. It should be appreciated, however, that the present invention can be embodied in other types of steam appliances. Additionally, while the steam applicators described above employ steam pocket technology, other types of steam applicators may be used in conjunction with embodiments disclosed herein. Having thus described several aspects of at least one embodiment of this invention, it is to be appreciated various alterations, modifications, and improvements will readily occur to those skilled in the art. Such alterations, modifications, and improvements are intended to be part of this disclosure, and are intended to be within the spirit and scope of the invention. Accordingly, the foregoing description and drawings are by way of example only. |
|---|---|
| 2nd row | RELATED APPLICATIONS The present application is a divisional of prior U.S. patent application Ser. No. 12/353,217, filed Jan. 13, 2009, which claims the benefit U.S. Provisional Application No. 61/070,097, filed Mar. 20, 2008. The '217 and '097 applications are herein incorporated by reference in their entirety. BRIEF DESCRIPTION OF THE DRAWINGS The various features and advantages of this disclosure will become apparent to those skilled in the art from the following detailed description of the currently disclosed embodiment. The drawings that accompany the detailed description can be briefly described as follows: FIG. 1 is a general perspective view of an exemplary rotary wing aircraft embodiment for use with the present disclosure; FIG. 2 is a side sectional view of a helicopter main rotor, including a main rotor shaft having a vibration suppression system mounted to the upper mast or shaft extension member of the main rotor system; FIG. 3A is a schematic perspective view of a vibration suppressor system having adjacent annular stators; FIG. 3B is a sectional view through the system of FIG. 3A along line 3B-3B; FIG. 3C is an expanded perspective view of a single mass which rotates upon an annular stator; FIG. 4A is a top view of another non-limiting embodiment of a vibration suppressor system; FIG. 4B is a cross-sectional view taken along line 4B-4B in FIG. 4A; FIG. 4C is a cross-sectional view taken along line 4C-4C in FIG. 4B; FIG. 5A is another non-limiting embodiment of a vibration suppressor system with ring bearings that support disk-shaped eccentric masses; FIG. 5B is a cross-sectional view taken along line 5B-5B in FIG. 5A; FIG. 5C is a cross-sectional view taken along line 5B-5B in FIG. 5A of another non-limiting embodiment that radially compresses the vibration suppressor system by location of eccentric masses between the two ring bearings; FIGS. 6A-6E are schematic top views of a vibration suppressor system with segmental propulsion; FIG. 7A is another embodiment of the vibration suppressor system having electromagnets arranged around an inner ring; FIG. 7B is a top view of another vibrating suppressor system having electromagnets arranged around an outer ring; FIG. 8A is a schematic representation of a condition where the maximum force is produced by one annular stator of the vibration suppressor system; and FIG. 8B is a schematic representation of a condition where an intermediate force is produced by one annular stator of the vibration suppressor system; and FIG. 8C is a schematic representation of a condition where a minimum force is produced by one annular stator of the vibration suppressor system. BACKGROUND The present disclosure relates to a vibration suppressor system. Vibration suppression is often utilized to null vibrations associated with a rotating system. Such vibrations, when left unattenuated may lead to crew and structural fatigue and premature failure of system components. The vibrations may also be transmitted through adjacent support structure to other areas and systems remote from the vibration source. Consequently, it may be desirable to suppress these vibrations proximal the vibration source. One application which exemplifies vibration isolation/absorption is the main rotor system of a rotary-wing aircraft. Typically, the main rotor system includes a hub system which drives a plurality of rotor blades subject to a variety of aerodynamic and gyroscopic loads. For example, as each rotor blade advances or retreats relative to the freestream airflow, each rotor blade experiences a rise and fall of in-plane aerodynamic drag. Furthermore, as the tip of each rotor blade advances with each revolution of the rotor system, the relative velocity at the blade tip may approach supersonic Mach numbers. As such, variations may occur at various coefficients which define blade performance (e.g., moment, lift and drag coefficients). Moreover, gyroscopic and Coriolis forces are generated which may cause the blades to lead or lag. These effects, as well as others, generate vibrations, which, if not suppressed, are transmitted to the airframe, typically through the main rotor gearbox mount structure. Various vibration suppressor systems have been devised to suppress vibrations. Mast-mounted vibration isolators suppress or isolate in-plane vibrations at a location proximal to the source. Transmission, cabin or cockpit absorbers reduce vibrations at a location remote from the source. Mast-mounted vibration isolators having a plurality of resilient arms (i.e., springs) extend in a spaced-apart spiral pattern between a hub attachment fitting and a ring-shaped inertial mass. Several pairs of spiral springs are mounted to and equiangularly arranged with respect to both the hub attachment fitting and the inertial mass so as to produce substantially symmetric spring stiffness in an in-plane direction. The spring-mass system, i.e., spiral springs in combination with the ring-shaped mass, is tuned in the non-rotating system to a frequency equal to N*rotor RPM (e.g., 4P for a four-bladed rotor) at normal operating speed, so that in the rotating system the spring mass system will respond to both N+1 and N?1 frequency vibrations (i.e., 3P and 5P for a four-bladed rotor). N is the number of rotor blades. While the spiral spring arrangement produces a relatively small width dimension (i.e., the spiraling of the springs increases the effective spring rate), the height dimension of each vibration isolator is increased to react out-of-plane loads via upper and lower pairs of spiral springs. This increased profile dimension increases the profile area, and consequently the profile drag produced by the isolator. The spiral springs must also be manufactured to relatively precise tolerances to obtain the relatively exact spring rates necessary for efficient operation. As such, manufacturing costs may be significant. Additionally, the weight of this device is very high, thus reducing the useful payload of the helicopter. Furthermore, these vibration isolators are passive devices which are tuned to a predetermined in-plane frequency and cannot be adjusted in-flight to isolate in-plane loads which may vary in frequency depending upon flight regime. Yet another general configuration of a mast-mounted vibration isolator is referred to as a bifilar. Bifilars include a hub attachment fitting connected to and driven by the rotorshaft with a plurality of radial arms which project outwardly from the fitting with a mass coupled to the end of each arm via a rolling pin arrangement. A pin rolls within a cycloidally-shaped bushing to permit edgewise motion of each mass relative to its respective arm. The geometry of the pin arrangement in combination with the centrifugal forces acting on the mass (imposed by rotation of the bifilar) results in an edgewise anti-vibration force at a 4 per revolution frequency which is out-of-phase with the large 4 per revolution (4P) in-plane vibrations of the rotor hub for a 4 bladed rotor system. The frequency of 4P is the frequency as observed in a nonrotating reference system such as the airframe. Pairs of opposed masses act in unison to produce forces which counteract forces active on the rotor hub. For the masses to produce the necessary shear forces to react the in-plane vibratory loads of the rotor system, counteracting bending moments are also produced. These force couples may impose relatively large edgewise bending loads in the radial arms, and consequently, the geometry thereof must produce the necessary stiffness (EI) at the root end of the arms. As such, these increased stiffness requirements result in relatively large and heavy bifilar arms. While the bifilar system has proven effective and reliable, the weight of the system, nearly 210 lbs for one typical system, may be detrimental to the overall lifting capacity of the aircraft. Furthermore, the pin mount for coupling each mass to the respective radial arm may require periodic removal and replacement, which may increase the Direct Maintenance Costs (DMC) of aircraft operations. SUMMARY A vibration suppressor according to an exemplary aspect of the present disclosure includes an annular electric motor system defined about an axis of rotation of a rotating system, and a control system in communication with the annular electric motor system to independently control rotation of at least two masses about the axis of rotation to reduce in-plane vibration of the rotating system. A method of reducing vibrations in a rotary-wing aircraft main rotor system having N number of blades which rotate about an axis of rotation at a rotational speed of 1P such that the main rotor system produces NP vibrations according to an exemplary aspect of the present disclosure includes independently rotating a multiple of independently rotatable masses disposed about an axis of rotation defined by the main rotor system and controlling a relative angular position of the multiple of independently rotatable masses to reduce the NP vibrations of the main rotor system. DETAILED DESCRIPTION OF THE DISCLOSED EMBODIMENT FIG. 1 schematically illustrates a rotary-wing aircraft 10 having a main rotor system 12. The aircraft 10 includes an airframe 14 having an extended tail 16 which mounts an anti-torque system such as a tail rotor system 18. The main rotor assembly 12 is driven about an axis of rotation R through a main rotor gearbox (illustrated schematically at MRG) which is powered by one or more engines E. The main rotor system 12 includes a multiple of rotor blades 20 mounted to a rotor hub 22. The rotor hub 22 is driven about the axis of rotation R by a main rotor shaft 24 which is driven by the main rotor gearbox MRG. Although a particular helicopter configuration is illustrated and described in the disclosed non-limiting embodiment, other configurations and/or machines, such as high speed compound rotary wing aircraft with supplemental translational thrust systems, dual contra-rotating, coaxial rotor system aircraft, turbo-props, tilt-rotors and tilt-wing aircraft, will also benefit herefrom. A vibration suppressor system 30 is mounted to the main rotor system 12 for rotation therewith and may thereby be referred to as a hub mounted vibration suppressor (HMVS). Vibratory forces active on the main rotor system 12 are generated by a variety of factors, although the dominant vibrations originate from aerodynamic and/or gyroscopic forces generated by each rotor blade 20. A four bladed rotor system, for example, produces 3P vibratory loads, i.e., in a single revolution, the magnitude of the load vector varies from a minimum to a maximum value three times in the rotating frame of reference. The 3P vibratory loads resolve into 4P vibration in a non-rotating frame of reference such as the airframe 14 due to the addition of the 1P rotor rotational speed. In addition, 5P vibratory loads are produced in a direction opposite the rotational direction of the main rotor system. The 5P vibratory loads also resolve into 4P vibration in the non-rotating frame of reference due to the subtraction of the opposite 1P rotor rotational speed. While a variety of factors influence the vibratory spectrum of a rotor system, such vibrations are generally a result of each rotor blade experiencing maximum lift when advancing and minimum lift when retreating. In another example, a seven bladed rotor systemhaving 6P co-rotation and 8P counter-rotational vibratory load resolve into a 7P vibration in the non-rotating frame of reference such as the airframe 14. Referring to FIG. 2, the vibration suppressor system 30 generally includes an annular electric motor system 32, a control system 34 and a power system 36. The controller can be included in the electric motor system 32 i.e. it is typically in the rotating system) The annular electric motor system 32 may be contained within a housing 38 for rotation with the main rotor system 12. The annular electric motor system 32 in one non-limiting embodiment includes a first and second annular stator 40A, 40B mounted within the housing 38. Each stator 40A, 40B represents a primary analogous to a fixed portion of a linear electric motor. The first stator 40A is defined about the axis of rotation R to support a first set of masses MA1, MA2, which are independently rotatable about the first stator 40A (also illustrated in FIG. 3A). The second stator 40B is defined about the axis of rotation R to support a second set of masses MB1, MB2 which are independently rotatable about the second stator 40B (also illustrated in FIG. 3A). The first stator 40A may be located adjacent the second stator 40B in a stacked arrangement which facilitates a light weight and low profile arrangement which may be readily mounted atop the main rotor hub 22 within the housing 38. Alternatively, the first stator 40A and second stator 40B may be located in the non-rotating system, i.e., in under the main rotor gearbox MRG. In this non-limiting embodiment, the MA1, MA2 would rotate at 4P and MB1 and MB2 would also rotate at 4P but in the opposite direction. The control system 34 issues control signals to an amplifier 34A of the annular electric motor system 32 to control the rotational speed and relative angular position of the masses MA1, MA2, MB1, MB2 of the vibration suppressor system 30. The power system 36 in one non-limiting embodiment may be the aircraft electrical bus, which delivers electrical power created by a main rotor gearbox powered generator 44. The masses MA1, MA2, MB1, MB2 each represent an independent secondary analogous to a moving part of a linear electric motor. The control system 34 may include a speed sensor 42 which senses the instantaneous rotational speed 1P of the main rotor shaft 24 to control the rotational velocity and relative angular position of each of the masses the masses MA1, MA2, MB1, MB2. Although the speed sensor 42 in one non-limiting embodiment may be a dedicated unit which directly measures the main rotor system 12 speed, the control system 34 may alternatively or additionally obtain the speed information from the generator 44 within the power system 36. The generator 44 turns at a predefined speed relative to the main rotor system 12 and may, in one non-limiting embodiment include a 5 kVa generator which provides a 115 volt, 400 Hz 3 phase potential to generate power for the vibration suppressor system 30 as well as provide the main rotor system speed reference signal. The generator 44 is mechanically driven by the MRG such that the rotational speed of the generator is a fixed multiple of the main rotor NP frequency. The electrical phase of the generator voltage is a fixed multiple of the generator rotational speed. Thus, the electrical voltage phase signal is a reflection of the NP frequency. As the rotor speed and NP frequency vary while in flight, the electrical voltage phase signal also varies and is perfectly slaved thereto, i.e. a fixed multiple of the main rotor speed. This makes the voltage signal an effective reference signal that will exactly track main rotor system speed. Hence, the control system 34 may use the phase information to issue the appropriate low power control signals to the amplifier 34A which issues high power signals to the vibration suppression system 30. While the vibration suppressor system 30 may employ a control system 34 with a predefined schedule or model of the vibrations, e.g., at prescribed rotor speeds, another non-limiting embodiment utilizes a vibration sensing system 46 with at least one vibration feedback sensor 48 for issuing vibration signals indicative of the vibrations (e.g., amplitude, frequency and phase) at one or more locations within the fixed frame of reference, e.g., MRG, fuselage, cabin, or cockpit. It should be understood that the vibration sensing system 46 may alternatively be integrated within the control system 34. The control system 34 samples vibration levels at predefined intervals or rates to identify a trendpositive (lower vibration levels) or negative (larger vibration levels) such that as vibration levels change, the control system 34 issues modified control signals the vibration suppressor system 30 until a combination of rotational speed and angular position of the masses MA1, MA2, MB1, MB2 minimize vibratory loads in the main rotor system 12. Power may be transferred from the stationary system to the rotating system via a slip ring 50 or the like. Only a small amount of additional weight is required inasmuch as the slip ring 50 is typically pre-existing in a rotary wing aircraft for other systems e.g., a rotor blade de-ice system. This slip ring 50 may also be used to communicate control signals when the control system 34 is mounted in the airframe 14 rather than on the main rotor system 12. Alternatively, the control system 34 may be located within the vibration suppressor system 30 such that the power system 36 communicates power to the slip ring 50 then to the control system 34. Referring to FIG. 3A, one non-limiting embodiment of the vibration suppressor system 30 includes the first annular stator 40A, the second annular stator 40B with respective masses MA1, MA2 and MB1, MB2 which independently transit therein. The first annular stator 40A and the second annular stator 40B include a multitude of electro-magnets 52A, 52B arranged around each respective stator 40A, 40B. It should be understood that many different magnet configurations are possible, for example, a continuous iron portion with wire wound slots powered by the amplifier 34A. The multitude of electro-magnets 52A, 52B receive power from the amplifier 34A in response to the control system 34 to independently drive the masses MA1, MA2, MB1, MB2. Masses MA1, MA2 in this non-limiting embodiment operate to suppress 5P vibration such that for a rotor system 12 which operates at 1P of 4.3 Hz, the masses MA1, MA2 transit the first annular stator 40A at 21.5 Hz in a rotational direction opposite that of the main rotor system 12. Masses MB1, MB2 in this non-limiting embodiment operate to suppress 3P vibration such that for a rotor system 12 which operates at 1P of 4.3 Hz, the masses MB1, MB2 transit the second annular stator 40B at 12.9 Hz in a rotational direction the same as that of the main rotor system 12. It should be understood that this non-limiting embodiment is for a four-bladed main rotor system 12 and that other main rotor systems 12 as well as other rotational systems will also benefit therefrom. As the first and second annular stator 40A, 40B are mounted to the main rotor system 12 for rotation therewith, the masses MA1, MA2, MB1, MB2 need only be driven at five revolutions per cycle of the rotor system (for masses MA1, MA2) and at three revolutions per cycle in the opposite direction (for masses MB1, MB2) to achieve the desired 4P frequency. That is, since the masses MA1, MA2, MB1, MB2 are, in the rotating reference system of the main rotor system 12 which rotates at one revolution per cycle (1P), the masses MA1, MA2, MB1, MB2 need only augment the rotational speed by the difference (3P+1P) to achieve the necessary 4P in the stationary reference system for masses MB1, MB2 which rotate in the direction of the rotor system 12 and 5P?1P to achieve the necessary 4P in the stationary reference system for masses MA1, MA2 which rotate in a direction opposite of the rotor system 12. The first annular stator 40A and the second annular stator 40B are generally of a channel shape in cross-section (FIG. 3B) such that the respective masses MA1, MA2 and MB1, MB2 are guided therein as well as are retained therein when the electro-magnets 52A, 52B are unpowered. That is, the first annular stator 40A and the second annular stator 40B are shaped to retain the masses MA1, MA2, MB1, MB2 when centrifugal force is unavailable. Although only a single mass (e.g., mass MA 1) will be described in detail herein, it should be understood that each of the masses MA1, MA2, MB1, MB2 may be generally alike in configuration. Furthermore, each of the masses MA1, MA2 and MB1, MB2 provide the desired xP suppression by providing a particular masshere the masses MA1, MA2 may weigh approximately one pound (1 lb.), while the masses MB1, MB2 may weigh approximately two and one half pounds (2.5 lbs.) for stators 40A, 40B with a radius of approximately one foot. It should be understood that these dimensions are for example only and various arrangements may be provided in accordance with the present disclosure. Referring to FIG. 3C, each of the masses MA1, MA2, MB1, MB2 in this non-limiting embodiment generally include a first wheel 54, a second wheel 56, a truck 58 which supports the wheels 54, 56 and a conductor 60 (FIG. 3C). The conductor 60 may be poles (permanent magnets) for a brushless electric motor embodiment or a conductive element for an inductive motor embodiment. Bearings 62 or the like may be utilized to support the wheels 54, 56 on the truck 58. Each truck 58 represents an independent secondary analogous to the moving part of a linear electric motor. The truck 58 and/or the conductor 60 may provide the majority of the mass to provide the required anti-vibration forces. Furthermore, either or both of the wheels 54, 56 may be utilized to carry the majority of the mass. For the non-limited embodiment where low bearing loads in the truck 58 are desired, either or both of the wheels 54, 56 may operate as the conductor, i.e. no separate conductive plate type conductor 60 need be provided on the truck 58. The other wheel 56, 54 may thereby carry the majority of the mass. That is, one wheel 54 is relatively light in weight and conductive to provide propulsion, while the other wheel 56 of the same truck 58 is heavy in weight to define the eccentric mass. Referring to FIG. 4A, each of the masses MA1, MA2, MB1, MB2 in this non-limiting embodiment includes a first wheel 80, a second wheel 82 and a truck 84 which supports the wheels 80, 82 with a radial-oriented conductor 86 (FIG. 4B) formed in part by the truck 84. At least a portion of the truck 84 forms the conductor 86 which is acted upon by a stator 88. Each stator 88 represents a primary analogous to a fixed portion of a linear electric motor. The stator 88 in this non-limiting embodiment is a wire wound slotted and laminated iron component. Each of the masses MA 1, MA2, MB1, MB2 represents the independent secondary analogous to the moving part of a linear electric motor. The conductor 86 may be manufactured of a conductive material such as copper or aluminum. In this non-limiting embodiment, the conductor 86 is oriented to be in-plane with the plane formed by the primary stator 88 such that the wheels 80, 82 need not provide propulsion. The wheels 80, 82 ride within an outer guide ring 90 (see FIGS. 4B and 4C). The truck 84 may form and/or include a relatively significant mass M between the wheels 80, 82 (FIG. 4C). Referring to FIG. 5A, each of the masses MA1, MA2, MB1, MB2 in this non-limiting embodiment are supported within an annular bearing 100A, 100B formed within an outer bearing support 102. Each of the masses MA1, MA2, MB1, MB2 in this non-limiting embodiment includes a radial-oriented conductor 104A, 104B formed in part by a truck 106A, 106B. At least a portion of the truck 106A, 106B forms the conductor 104A, 104B which is acted upon by a stator 110 which represents the primary analogous to a fixed portion of a linear electric motor. Each truck 106A, 106B may form a relatively significant eccentric mass M which is supported adjacent the annular bearing 100A, 100B (FIG. 5B). That is, each truck 106A, 106B forms an eccentric mass M which rides within the annular bearing 100A, 100B. Alternatively, each truck 106A?, 106B? forms an eccentric mass M which is arranged between the annular bearing 100A, 100B (FIG. 5C). This arrangement locates the eccentric mass M in a more radial outboard position which facilitates a lighter weight mass for an equivalent diameter annular bearing 100A, 100B. Referring to FIG. 6A, the two individual masses MA1, MA2 located on the first annular stator 40A and the two individual masses MB1, MB2 located on the second annular stator 40B (not shown) are independent controlled through primary sector power transmission. The sixty degree (60°)primary sectors in FIGS. 6A-6E facilitate the minimization of electronic components required to independently control the motion of each of the masses MA1, MA2 and MB1, MB2. Although only the first annular stator 40A with masses MA1, MA2 will be described in the examples herein, it should be understood that each of the two individual masses MB1, MB2 located on the second annular stator 40Bor additional annular statorsare generally alike in configuration and operation. The primary sectors are independently commanded when only one mass MA 1, MB1 overlap that primary sector. In this way, one secondary mass MA1 is driven relative to the other mass MA2. In the examples illustrated in FIGS. 6A-6E masses MA1, MA2 are close together; thus a large anti-vibration force is produced. At this instant the primary sector 1 propels mass MA2 and the primary sector 6 propels mass MA2 thus independently regulating the velocities of masses MA1, MA2. As the two masses MA1, MA2 move clockwise, their dimension precludes both masses MA1, MA2 from occupying the same primary sector at the same time. Notice on subsequent Figures, that MAR2 departs sector 2 before MA1 enters sector 2. This permits independent control of the motions of masses MA1, MA2. Notice that MA1 and MA2 can of any dimension since the positions of masses MA1, MA2 may be tracked with a sensor system and can not be entirely within the same primary sector at the same time. As the masses MA 1, MA2 move around the first annular stator 40A, the primary sectors which are at the same azimuth as the respective masses MA1, MA2 are selectively powered to control the respective masses MA1, MA2. On occasion one of the masses MA 1, MA2 may abridge two primary sectors (FIGS. 6B-6E) such that two primary sectors are powered and commanded to control the motion. Referring to FIG. 7A, each of the masses MA1, MA2, MB1, MB2 in this non-limiting embodiment generally include an independent wheel 64 in which the wheel 64 itself operates as the mass and the conducting secondary with no truck whatsoever. This eliminates the need for bearings. Each wheel 64 may travel within an outer guide ring 66 and an inner guide ring 68 which define a respective groove 66?, 68?. The inner guide ring 68 may be formed of electromagnets 70 which both power each wheel 64 as well as restrains each wheel 64 when not powered. It should be understood that other electro-magnet system arrangement may alternatively or additionally be utilized, e.g., the electro-magnet guide ring 70A may be the outer ring 66A (FIG. 7B). In operation, the masses MB 1, MB2 (FIGS. 8A-8C) are propelled by the electro-magnets 52A within the annular stator 40B at a rotational speed greater than the rotational speed of the main rotor system 12 and appropriately positioned to yield a load vector P1 which is equal and opposite to the load vector R1 produced by the main rotor system 12. This counteracting load vector P1 may be interpreted as a vector which attempts to cancel or null the displacement of the main rotor system 12 and rotor shaft 24. FIGS. 8A-8C depict various operating positions of masses MB1, MB2. Masses MA1, MA2 operate in an analogous manner which therefore need not be described in further detail. The vibration suppressor system 30 controls the rotational speed of the masses MA1, MA2, MB1, MB2 to produce a counteracting load of the correct magnitude and phase to suppress vibrations. Referring to FIG. 8A, the masses MB1, MB2 are essentially adjacent and act in unison to produce a maximum force vector P1MAX. It should be understood that bumpers or such like may be provided to minimize impact between each mass MB 1, MB2, which may occur during some operational conditions. Referring to FIG. 8B, the masses MB1, MB2 define a right angle (90 degrees) therebetween thereby producing a force vector P1MAX/(sqrt(2)) that is a fraction of the magnitude of the maximum force vector. Referring to FIG. 8C, the masses MB1, MB2 are directly opposite (180 degree separation) and are essentially opposing to cancel the vectors produced by each of the masses MB1, MB2 such that essentially zero net force is generated at P1MIN. The ability to independently vary the relative angular position of the masses is especially valuable in applications wherein the magnitude of the vibratory load active in/on the rotating system varies as a function of operating regime or operating speed. In a rotary-wing aircraft, for example, it is common to require the highest levels of vibration isolation in high speed forward flight i.e., where the rotor blades are experiencing the largest differential in aerodynamic loading from advancing to retreating sides of the rotor system. Consequently, it may be expected that the vibration suppressor system 30 produce the maximum load vector P1MAX (FIG. 8A). In yet another example, it is anticipated that the lowest levels of vibration isolation would occur in a loiter or hovering operating mode, where the rotor blades are exposed to the generally equivalent aerodynamic and gyroscopic affects. Consequently, it may be expected that the vibration suppressor system 30 a minimal load vector P1MIN (FIG. 8C). It should be understood that relative positional terms such as forward, aft, upper, lower, above, below, and the like are with reference to the normal operational attitude of the vehicle and should not be considered otherwise limiting. Although particular step sequences are shown, described, and claimed, it should be understood that steps may be performed in any order, separated or combined unless otherwise indicated and will still benefit from the present disclosure. The foregoing description is exemplary rather than defined by the limitations within. Many modifications and variations of the present disclosure are possible in light of the above teachings. The disclosed embodiments of this disclosure have been disclosed, however, one of ordinary skill in the art would recognize that certain modifications would come within the scope of this disclosure. It is, therefore, to be understood that within the scope of the appended claims, the disclosure may be practiced otherwise than as specifically described. For that reason the following claims should be studied to determine the true scope and content of this disclosure. |
| 3rd row | This application is a Continuation of Ser. No. 11/202,741, filed 11 Aug. 2005 in the United States, which is a Continuation of Ser. No. 10/306,865, now issued as U.S. Pat. No. 7,011,818, filed 27 Nov. 2002 in the United States, which is a Continuation of Ser. No. 09/680,863, now issued as U.S. Pat. No. 6,521,260, filed 6 Oct. 2000 in the United States which is a Continuation of Ser. No. 08/875,391, now issued as U.S. Pat. No. 6,153,224, filed 25 Sep. 1997 in the United States which is a National Stage of PCT/GB96/00215, filed 31 Jan. 1996 which claims benefit of United Kingdom application no. 9521937.4 filed 26 Oct. 1995 and United Kingdom application no. 9501841.2 filed 31 Jan. 1995 and which applications are incorporated herein by reference. To the extent appropriate, a claim of priority is made to each of the above disclosed applications. Embodiments of the invention will now be described by way of example with reference to the accompanying drawings, of which: FIG. 1 shows a section through a carrier particle including additive particles on its surfaces; FIG. 2 is a perspective view of a dry powder inhaler; FIG. 3 is a sectional diagram of a twin stage impinger; and FIGS. 4 a & 4b show the effect of a milling treatment on the carrier particle of FIG. 1. This invention relates to carrier particles for use in dry powder inhalers. More particularly the invention relates to a method of producing such particles, to a dry powder incorporating the particles and to the particles themselves. Inhalers are well known devices for administering pharmaceutical products to the respiratory tract by inhalation. Inhalers are widely used particularly in the treatment of diseases of the respiratory tract. There are a number of types of inhaler currently available. The most widely used type is a pressurised metered dose inhaler (MDI) which uses a propellant to expel droplets containing the pharmaceutical product to the respiratory tract. Those devices are disadvantageous on environmental grounds as they often use CFC propellants, and on clinical grounds related to the inhalation characteristics of the devices. An alternative device to the MDI is the dry powder inhaler. The delivery of dry powder particles of pharmaceutical products to the respiratory tract presents certain problems. The inhaler should deliver the maximum possible proportion of the active particles expelled to the lungs, including a significant proportion to the lower lung, preferably at the low inhalation capabilities to which some patients, especially asthmatics, are limited. It has been found, however, that, when currently available dry powder inhaler devices are used, in many cases only about 10% of the active particles that leave the device on inhalation are deposited in the lower lung. More efficient dry powder inhalers would give clinical benefits. The type of dry powder inhaler used is of significant importance to the efficiency of delivery over a range of airflow conditions of the active particles to the respiratory tract. Also, the physical properties of the active particles used affect both the efficiency and reproducibility of delivery of the active particles and the site of deposition in the respiratory tract. On exit from the inhaler device, the active particles should form a physically and chemically stable aerocolloid which remains in suspension until it reaches a conducting bronchiole or smaller branching of the pulmonary tree or other absorption site preferably in the lower lung. Once at the absorption site, the active particle should be capable of efficient collection by the pulmonary mucosa with no active particles being exhaled from the absorption site. The size of the active particles is important. For effective delivery of active particles deep into the lungs, the active particles should be small, with an equivalent aerodynamic diameter substantially in the range of 0.1 to 5 ?m, approximately spherical and monodispersed in the respiratory tract. Small particles are, however, thermodynamically unstable due to their high surface area to volume ratio, which provides significant excess surface free energy and encourages particles to agglomerate. In the inhaler, agglomeration of small particles and adherence of particles to the walls of the inhaler are problems that result in the active particles leaving the inhaler as large agglomerates or being unable to leave the inhaler and remaining adhered to the interior of the inhaler. The uncertainty as to the extent of agglomeration of the particles between each actuation of the inhaler and also between different inhalers and different batches of particles, leads to poor dose reproducibility. It has been found that powders are reproducibly fluidisable, and therefore reliably removable from an inhaler device, when the particles have a diameter greater than 90 ?m. To give the most effective dry powder aerosol, therefore, the particles should be large while in the inhaler, but small when in the respiratory tract. In an attempt to achieve that situation, one type of dry powder for use in dry powder inhalers may include carrier particles to which the fine active particles adhere whilst in the inhaler device, but which are dispersed from the surfaces of the carrier particles on inhalation into the respiratory tract to give a fine suspension. The carrier particles are often large particles greater than 90 ?m in diameter to give good flow properties as indicated above. Small particles with a diameter of less than 10 ?m may be deposited on the wall of the delivery device and have poor flow and entrainment properties leading to poor dose uniformity. The increased efficiency of redispersion of the fine active particles from the agglomerates or from the surfaces of carrier particles during inhalation is regarded as a critical step in improving the efficiency of the dry powder inhalers. It is known that the surface properties of a carrier particle are important. The shape and texture of the carrier particle should be such as to give sufficient adhesion force to hold the active particles to the surface of the carrier particle during fabrication of the dry powder and in the delivery device before use, but that force of adhesion should be low enough to allow the dispersion of the active particles in the respiratory tract. In order to reduce the force of adhesion between carrier particles and active particles, it has been proposed to add a ternary component. In particular, using carrier particles of lactose and active particles of salbutamol, it has been proposed to add particles of magnesium stearate or Aerosil 200 (trade name of Degussa for colloidal silicon dioxide) in an amount of 1.5% by weight based on the weight of the carrier particles to a lactose-salbutamol mix. The conclusion of that proposal, however, was that, although the adhesion between the carrier particles and the active particles was reduced by the presence of the additive particles, the addition of the additive particles was undesirable. It is an object of the invention to provide a method for producing carrier particles and a powder for use in dry powder inhalers, and to provide carrier particles and a powder that mitigates the problems referred to above. We have found that, contrary to the teaching of the prior art referred to above, the presence of additive particles which are attached to the surfaces of the carrier particles to promote the release of the active particles from the carrier particles is advantageous provided that the additive particles are not added in such a quantity that the active particles segregate from the surfaces of the carrier particles during fabrication of the dry powder and in the delivery device before use. Furthermore, we have found that the required amount of the additive particles is surprisingly small and that, if a greater amount is added, there will be no additional benefit in terms of inhalation performance but it will adversely affect the ability to process the mix. The required amount of additive particles varies according to the composition of the particlesin the case where the additive particles are of magnesium stearate (that being a material that may be used but is not preferred), we have found that an amount of 1.5 percent by weight based on the total weight of the powder is too great and causes premature segregation of the active particles from the carrier particles. We believe that the same considerations apply in the case of Aerosil 200. The present invention provides a powder for use in a dry powder inhaler, the powder including active particles and carrier particles for carrying the active particles, the powder further including additive material on the surfaces of the carrier particles to promote the release of the active particles from the carrier particles on actuation of the inhaler, the powder being such that the active particles are not liable to be released from the carrier particles before actuation of the inhaler. Actuation of the inhaler refers to the process during which a dose of the powder is removed from its rest position in the inhaler, usually by a patient inhaling. That step takes place after the powder has been loaded into the inhaler ready for use. In this specification we give many examples of powders for which the amount of the additive material is so small that the active particles are not liable to be released from the carrier particles before actuation of the inhaler but are released during use of the inhaler. If it is desired to test whether or not the active particles of a powder are liable to be released from the carrier particles before actuation of the inhaler a test can be carried out. A suitable test is described at the end of this specification; a powder whose post-vibration homogeneity measured as a percentage coefficient of variation, after being subjected to the described test, is less than about 5% can be regarded as acceptable. In an example of the invention described below the coefficient is about 2% which is excellent, whereas in an example also described below and employing 1.5% by weight of magnesium stearate the coefficient is about 15% which is unacceptable. The surface of a carrier particle is not usually smooth but has asperities and clefts in its surface. The site of an asperity or of a cleft is believed to be an area of high surface energy. The active particles are preferentially attracted to and adhere most strongly to those high energy sites causing uneven and reduced deposition of the active particles on the carrier surface. If an active particle adheres to a high energy site, it is subjected to a greater adhesion force than a particle at a lower energy site on the carrier particle and will therefore be less likely to be able to leave the surface of the carrier particle on actuation of the inhaler and be dispersed in the respiratory tract. It would therefore be highly advantageous to decrease the number of those high energy sites available to the active particles. Additive material is attracted to and adheres to the high energy sites on the surfaces of the carrier particles. On introduction of the active particles, many of the high energy sites are now occupied, and the active particles therefore occupy the lower energy sites on the surfaces of the carrier particles. That results in the easier and more efficient release of the active particles in the airstream created on inhalation, thereby giving increased deposition of the active particles in the lungs. However, as indicated above, it has been found that the addition of more than a small amount of additive material is disadvantageous because of the adverse effect on the ability to process the mix during commercial manufacture. It is also advantageous for as little as possible of the additive material to reach the lungs on inhalation of the powder. Although the additive material will most advantageously be one that is safe to inhale into the lungs, it is still preferred that only a very small proportion, if any, of the additive material reaches the lung, in particular the lower lung. The considerations that apply when selecting the additive material and other features of the powder are therefore different from the considerations when a third component is added to carrier and active material for certain other reasons, for example to improve absorption of the active material in the lung, in which case it would of course be advantageous for as much as possible of the additive material in the powder to reach the lung. In the present case, as indicated above, there will be an optimum amount of additive material, which amount will depend on the chemical composition and other properties of the additive material. However, it is thought that for most additives the amount of additive material in the powder should be not more than 10%, more advantageously not more than 5%, preferably not more than 4% and for most materials will be not more than 2% or less by weight based on the weight of the powder. In certain Examples described below the amount is about 1%. Advantageously the additive material is an anti-adherent material and will tend to decrease the cohesion between the active particles and the carrier particles. Advantageously the additive material is an anti-friction agent (glidant) and will give better flow of powder in the dry powder inhaler which will lead to better dose reproducibility from the inhaler. Where reference is made to an anti-adherent material, or to an anti-friction agent, the reference is to include those materials which will tend to decrease the cohesion between the active particles and the carrier particles, or which will tend to improve the flow of powder in the inhaler, even though they may not usually be referred to as an anti-adherent material or an anti-friction agent. For example, leucine is an anti-adherent material as herein defined and is generally thought of as an anti-adherent material but lecithin is also an anti-adherent material as herein defined, even though it is not generally thought of as being anti-adherent, because it will tend to decrease the cohesion between the active particles and the carrier particles. The carrier particles may be composed of any pharmacologically inert material or combination of materials which is acceptable for inhalation. Advantageously, the carrier particles are composed of one or more crystalline sugars; the carrier particles may be composed of one or more sugar alcohols or polyols. Preferably, the carrier particles are particles of lactose. Advantageously, substantially all (by weight) of the carrier particles have a diameter which lies between 20 ?m and 1000 ?m, more preferably 50 ?m and 1000 ?m. Preferably, the diameter of substantially all (by weight) of the carrier particles is less than 355 ?m and lies between 20 ?m and 250 ?m. Preferably at least 90% by weight of the carrier particles have a diameter between from 60 ?m to 180 ?m. The relatively large diameter of the carrier particles improves the opportunity for other, smaller particles to become attached to the surfaces of the carrier particles and to provide good flow and entrainment characteristics and improved release of the active particles in the airways to increase deposition of the active particles in the lower lung. It will be understood that, throughout, the diameter of the particles referred to is the aerodynamic diameter of the particles. Advantageously, the additive material consists of physiologically acceptable material. As already indicated, it is preferable for only small amounts of additive material to reach the lower lung, and it is also highly preferable for the additive material to be a material which may be safely inhaled into the lower lung where it may be absorbed into the blood stream. That is especially important where the additive material is in the form of particles. The additive material may include a combination of one or more materials. It will be appreciated that the chemical composition of the additive material is of particular importance. Preferably the additive material is a naturally occurring animal or plant substance. Advantageously the additive material includes one or more compounds selected from amino acids and derivatives thereof, and peptides and polypeptides having molecular weight from 0.25 to 1000 KDa, and derivatives thereof. Amino acids, peptides or polypeptides and their derivatives are both physiologically acceptable and give acceptable release of the active particles on inhalation. It is particularly advantageous for the additive material to comprise an amino acid. Amino acids have been found to give, when present in low amounts in the powders as additive material, high respirable fraction of the active materials with little segregation of the powder and also with very little of the amino acid being transported into the lower lung. In respect of leucine, a preferred amino acid, it is found that, for example, for an average dose of powder only about 10 ?g of leucine would reach the lower lung. The additive material may comprise one or more of any of the following amino acids: leucine, isoleucine, lysine, valine, methionine, phenylalanine. The additive may be a salt or a derivative of an amino acid, for example aspartame or acesulfame K. Preferably the additive particles consist substantially of leucine, advantageously L-leucine. As indicated above, leucine has been found to give particularly efficient release of the active particles on inhalation. Whilst the L-form of the amino acids is used in Examples described below, the D- and DL-forms may also be used. The additive material may include one or more water soluble substances. This helps absorption of the substance by the body if the additive reaches the lower lung. The additive material may include dipolar ions, which may consist of zwitterions. Alternatively, the additive material may comprise particles of a phospholipid or a derivative thereof. Lecithin has been found to be a good material for the additive material. The additive material may include or consist of one or more surface active materials, in particular materials that are surface active in the solid state, which may be water soluble, for example lecithin, in particular soya lecithin, or substantially water insoluble, for example solid state fatty acids such as lauric acid, palmitic acid, stearic acid, erucic acid, behenic acid, or derivatives (such as esters and salts) thereof. Specific examples of such materials are: magnesium stearate; sodium stearyl fumarate; sodium stearyl lactylate; phospatidylcholines, phosphatidylglycerols and other examples of natural and synthetic lung surfactants; Liposomal formulations; lauric acid and its salts, for example, sodium lauryl sulphate, magnesium lauryl sulphate; triglycerides such as Dynsan 118 and Cutina HR; and sugar esters in general. Other possible additive materials include talc, titanium dioxide, aluminium dioxide, silicon dioxide and starch. As indicated above, it is most important for the additive material to be added in a small amount. For example, magnesium stearate is highly surface active and should therefore be added in particularly small amounts; phosphatidylcholines and phosphatidylglycerols on the other hand are less active and can usefully be added in greater amounts; in respect of leucine, which is still less active, an addition of 2% by weight leucine based on the weight of the powder gives good results in respect of the respirable fraction of the active particles, low segregation and low amount of leucine reaching the lower lung; an addition of a greater amount does not improve the results and in particular does not significantly improve the respirable fraction and therefore whilst even with 6% leucine a reasonable result is obtained that is not preferred since it results in an increased quantity of additive material being taken into the body and will adversely affect the processing properties of the mix. The additive material will often be added in particulate form but it may be added in liquid or solid form and for some materials, especially where it may not be easy to form particles of the material and/or where those particles should be especially small, it may be preferred to add the material in a liquid, for example as a suspension or a solution. Even then, however, the additive material of the finished powder may be in particulate form. An alternative possibility, however, that is within the scope of the invention is to use an additive material which remains liquid even in the final essentially particulate material which can still be described as a dry powder. In some cases improved clinical benefits will be obtained where the additive material is not in the form of particles of material. In particular, the additive material is less likely to leave the surface of the carrier particle and be transported into the lower lung. Where the additive material of the finished powder is particulate, the nature of the particles may be significant. The additive particles may be non-spherical in shape. In Examples 1 to 3 below, the additive particles are plate-like particles. Alternatively the additive particles may be angular for example prisms, or dendritic in shape. Additive particles which are non-spherical may be easier to remove from the surfaces of the carrier particles than spherical, non-angular particles and plate-like particles may give improved surface interaction and glidant action between the carrier particles. The surface area of the additive particles is also thought to be important. The surface area of the additive particles, as measured using gas absorption techniques, is preferably at least 5 m 2g?1. In many cases it is found that additive material comprising small plate-like particles is preferred. Advantageously, at least 95% by weight of the additive particles have a diameter less than 150 ?m, more advantageously less than 100 ?m, preferably less than 50 ?m. Preferably, the mass median diameter of the additive particles is not more than about 10 ?m. The additive particles preferably have a mass median diameter less than the mass median diameter of the carrier particles and will usually have a mass median diameter of approximately between a tenth and a hundredth that of the carrier particles. The diameter of the particles may be calculated by laser diffraction or by another method by which the aerodynamic diameter of the particles can be determined. The ratio in which the carrier particles, additive material and active particles are mixed will, of course, depend on the type of inhaler device used, the type of active particles used and the required dose. As indicated above, the amount of additive material is of particular importance. Advantageously the amount is in the range of from 0.1 to 10% by weight of the additive material based on the weight of the carrier particles. For the examples given below, the powder preferably consists of not less than 0.1% by weight of additive material based on the weight of the carrier particles and the powder preferably consists of at least 0.1% by weight of active particles based on the weight of the powder. Furthermore, the carrier particles are preferably present in an amount of at least 90%, more preferably at least 95%, by weight based on the weight of the powder. Conventional calculations of the extent of surface coverage of the carrier particles by the additive material shows that for the preferred carrier particles and preferred additive materials mixed in their preferred amounts, the amount of additive material is much more than that necessary to provide a monolayer coating of the carrier particle. For example, in the case of Example 1 described below, calculation shows that a small fraction of a percent of leucine by weight is sufficient to provide a monolayer coating, whereas 1% leucine by weight is employed. Furthermore, it is found that even with 1% leucine there is no coating of the carrier particles in the sense in which that word is normally used in the art, namely to refer to a continuous envelope around the carrier particle; rather inspection of the carrier particles under an electron microscope shows much of the surface of each lactose particle remaining exposed with leucine particles covering only limited portions of each lactose particle and forming a discontinuous covering on each lactose particle. It is believed that the presence of such a discontinuous covering, as opposed to a coating is an important and advantageous feature of the present invention. Preferably the additive material, whilst providing only a discontinuous covering for the carrier particles, does saturate the surfaces of the carrier particles in the sense that even if more additive material were provided substantially the same covering of the carrier particles would be achieved. When the additive material in the finished powder is particulate, some of the additive particles, either individually or as agglomerates, may act as carriers of active particles and may be separate from or may separate from the surfaces of the carrier particles with active particles attached to their surfaces. The dimensions of the combined active particle and additive particle may still be within the optimum values for good deposition in the lower lung. It is believed that active particles which adhere to the additive particles on the carrier particles may in some cases be preferentially released from the surfaces of the carrier particles and thereafter be deposited in the lower lung without the additive particles. Advantageously, the mass median diameter of the active particles is not more than 10 ?m, preferably not more than 5 ?m. The particles therefore give a good suspension on redispersion from the carrier particles and are delivered deep into the respiratory tract. Where the active particles are not spherical, the diameter of the particles may be calculated by laser diffraction or another method by which the aerodynamic diameter of the particles can be determined. The active material referred to throughout the specification will be material of one or a mixture of pharmaceutical product(s). It will be understood that the term active material includes material which is biologically active, in the sense that it is able to increase or decrease the rate of a process in a biological environment. The pharmaceutical products include those products which are usually administered orally by inhalation for the treatment of disease such as respiratory disease eg. ?-agonists, salbutamol and its salts, salmeterol and its salts. Other pharmaceutical products which could be administered using a dry powder inhaler include peptides and polypeptides, such as DNase, leucotrienes and insulin. The active particles may include a ? 2-agonist which may be terbutaline, a salt of terbutaline, for example terbutaline sulphate, or a combination thereof or may be salbutamol, a salt of salbutamol or a combination thereof. Salbutamol and its salts are widely used in the treatment of respiratory disease. The active particles may be particles of salbutamol sulphate. The active particles may be particles of ipatropium bromide. The active particles may include a steroid, which may be beclomethasone dipropionate or may be Fluticasone. The active principle may include a cromone which may be sodium cromoglycate or nedocromil. The active principle may include a leukotriene receptor antagonist. The active particles may include a carbohydrate, for example heparin. According to the invention, there are provided particles for use in a powder as described above, the particles including carrier particles of a first composition and of a size suitable for use in a dry powder inhaler and additive material of a second composition, the additive material being attached to the surfaces of the carrier particles. In a general aspect, the invention also provides a powder for use in a dry powder inhaler, the powder including active particles and carrier particles for carrying the active particles wherein the powder further includes additive material which is attached to the surfaces of the carrier particles to promote the release of the active particles from the carrier particles. According to the invention, there is also provided a method of producing particles suitable for use as particles in dry powder inhalers, the method including the step of mixing carrier particles of a size suitable for use in dry powder inhalers with additive material which becomes attached to the surfaces of the carrier particles. Additive material, which may be in liquid form or may comprise additive particles, or agglomerates of additive particles, may be introduced to a sample of carrier particles, which may have been treated as described below, and the mixture blended to allow the additive material to become attached to the surfaces of the carrier particles. As indicated above, the exact ratio in which the carrier particles and the additive particles are mixed will, of course, depend on the type of device and the type of active particles used. Also as indicated above, the proportion of the additive material in the powder is of particular importance. The size of the carrier particles is an important factor in the efficiency of the inhaler, and an optimum, or near optimum, range of size of particles is preferably selected. Therefore, the method advantageously further includes the step of selecting from a sample of carrier particles an advantageous range of size of carrier particles prior to the mixing step and, in the case where the additive material is in the form of particles when it is mixed with the carrier particles, preferably also includes the step of selecting from a sample of additive particles an advantageous range of size of additive particles prior to the mixing step. The step of selecting an advantageous range of size may be a sieving step. Advantageously the additive material and the carrier particles are mixed for between 0.1 hours and 0.5 hours. The particles may be mixed using a tumbling blender (for example a Turbula Mixer). Advantageously, the method further includes the step of treating the carrier particles to dislodge small grains from the surfaces of the carrier particles, without substantially changing the size of the carrier particles during the treatment. As indicated above, the surface of a carrier particle is not usually smooth but has asperities and clefts in the surface. As a result, the surfaces have areas of high surface energy to which active particles are preferentially attached. An active particle at a high energy site is less likely to be able to leave the surface and be dispersed in the respiratory tract than an active particle at a site of lower surface energy. During the treatment referred to immediately above, asperities are removed as small grains, thus removing active sites associated with the asperities. Advantageously, the mixing step is prior to the treatment step. The additive material may therefore be added in the form of large particles which are broken into smaller particles during the treatment. Alternatively the treatment may be carried out before the addition of the additive material or, alternatively, after the addition of the additive material and of the active particles. Advantageously, the small... |
| 4th row | CROSS REFERENCE TO RELATED APPLICATIONS This application is a continuation of U.S. application Ser. No. 12/841,064, filed Jul. 21, 2010, which is a continuation of U.S. application Ser. No. 12/326,831, filed Dec. 2, 2008, now U.S. Pat. No. 7,781,213, which is a divisional of U.S. application Ser. No. 11/789,669, filed Apr. 24, 2007, now U.S. Pat. No. 7,473,556, which is a continuation of U.S. application Ser. No. 09/849,499, filed May 4, 2001, now U.S. Pat. No. 7,247,480, which is a continuation of International Patent Application No. PCT/GB99/03653, filed Nov. 5, 1999, which application claims priority from GB Patent Application Number 9824306.6, filed Nov. 5, 1998. The entire content of the prior applications is incorporated herein by reference. The invention relates to a method for the production of dendritic cells from embryonic stem cells and to the dendritic cells so produced. The invention also relates to genetically modified embryonic stem cells and their use in the production of genetically modified dendritic cells; to methods for investigating dendritic cells; and to methods for investigating the function of mammalian genes. BRIEF DESCRIPTION OF THE FIGURES FIG. 1 : Phase-contrast micrographs of ES cell-derived dendritic cells. (a) Low power view of an embryoid body 24 hr after plating onto tissue culture plastic, showing the emigration of stomal cells in a radial fashion. (b-c) esDC developing around the periphery of a colony. Note the sharpe demarcation between stromal cells supporting their development and those that fail to do so. (d) Appearance of clusters of esDC (arrows) similar to those apparent in cultures of mouse bone marrow. (e) esDC that have seeded areas of the dish uncolonized by stromal cells. (f) Cultures of putative lymphoid esDC maintained in IL-3 alone. FIG. 2 : shows electron micrographs of esDC cultured in GM-CSF and IL-3; Electron micrographs of esDC cultured in GM-CSF and IL-3 showing typical DC morphology (a) and a propensity to phagocytose apoptotic cells (b), consistent with their immature phenotype. The bar represents 5 ?m. FIG. 3 : shows surface phenotype of esDC grown is GM-CSF and IL-3 assessed by flow cytometry; Surface phenotype of esDC grown is GM-CSF and IL-3 assessed by flow cytometry. Filled histograms indicate levels of expression of CD44 (a), B7-1 (b), ICAM-1 (c) B7-2 (d), CD40 (e), CD11c (f) and class II MHC (g). Open histograms represent levels of background staining determined using irrelevant species- and isotype-matched control antibodies. FIG. 4 : shows immunostimulatory activity of esDC in the allogeneic mixed leukocyte reaction; Immunostimulatory activity of esDC in the allogeneic MLR. esDC from the CBA/Ca ES cell line ESF116 were co-cultured with purified T cells form C57B1/10 mice and the extent of proliferation was measured as a function of 3H-TdR uptake 5 days later. FIG. 5 : shows IL-2 secretion by the T cells in response to antigen presentation by esDC, and inhibition of IL-2 by a mAbto MHC class II; (a) IL-2 secretion by the T cell hybridoma, 2G7.1, in response to HEL presented by live esDC (closed symbols) but not DC that had been fixed first in paraformaldehyde to prevent antigen uptake (open symbols). (b) Stimulation of the 2G7.1 hybridoma is inhibited by the addition of a mAb specific for class II MHC (closed symbols) but not by the addition of an irrelevant species and isotype-matched control antibody (open symbols). FIG. 6 : shows flow cytometric analysis of esDC following maturation induced by the addition of LPS to cultures; Flow cytometric analysis of esDC following maturation induced by the addition of LPS to cultures. Filled histograms indicated the levels of expression of class II MHC (a), CD11c (b), B7-1 (c), B7-2 (d), CD40 (e) and ICAM-1 (f). Open histograms indicate the levels of background staining obtained using irrelevant species and isotype-matched control antibodies. FIG. 7 : shows immunostimulatory activity of LPS-treated esDC. Immunostimulatory activity of LPS-treated esDC. Mature esDC stimulate the strong proliferation of naive, allogeneic T cells (closed circles) but only weak proliferation of syngeneic cells (open triangles). At the same time point, equivalent numbers of immature esDC fail to stimulate either allogeneic or syngeneic cells (open circles and closed triangles respectively). FIG. 8 : shows Immunostimulatory activity by myeloid and lymphoid esDC; A comparison of the immunostimulatory activity of myeloid (closed circles) and lymphoid esDC (open circles). FIG. 9 : shows antigen-processing activity of myeloid and lymphoid esDC. A comparison of the antigen-processing activity of myeloid and lymphoid esDC. At the top dose of DC, the lymphoid population (hatched bar) are considerably less able to present antigen to the hybridoma than myeloid DC (filled bar), although both induce widespread cell death. FIG. 10 : shows the generation of esDC stably transfected with GFP following introduction of the transgene Into the parent ES cell line. Generation of esDC stably transfected with GFP following introduction of the transgene Into the parent ES cell line. (a) Colony of ESF116 viewed under fluorescent confocal microscopy showing expression of GFP far in excess of the level of autofluorescence associated with the monolayer of embryonic fibroblasts (b). (c)-(d) Embryoid bodies derived from the ESF116.EGFP clone showing retention of the transgene during differentiation. (e)-(f) Representative esDC developing from transfected embryoid bodies viewed under phase contrast (e) and fluorescence microscopy (f) confirming expression of GFP by terminally-differentiated cells. BACKGROUND OF THE INVENTION The Role of Dendritic Cells in the Immune Response Dendritic cells (DC) constitute a trace population of leukocytes, originating from the bone marrow but distributed widely throughout most organs of the body, with the possible exception of the brain [Steinman 1991; Banchereau & Steinman, 1998]. The function of DC is largely dependent on their state of maturation, which varies according to their local microenvironment. DC resident within interstitial tissues, such as the Langerhans cells of the skin, are predominately immature, forming a network of cells adapted to the acquisition of foreign antigens following a local microbial challenge. To perform such a sentinel function, immature DC are competent phagocytes, taking up whole microorganisms and apoptotic cells for processing [Albert et al., 1998a], as well as soluble protein antigens by the endocytic route. Such activity betrays the close lineage relationship between DC and macrophages; indeed the classical DC first described by Steinman and colleagues [1973] are now known to be derived from myeloid progenitors, in common with members of the reticuloendothelial system. What distinguishes DC from macrophages, however, is the nature of their response to an encounter with antigen at a primary site of infection. Inflammatory stimuli, such as the local release of interferon-? or lipopolysaccharide, induce the maturation of DC precursors [De Smedt et al., 1996; Cella et al., 1997], causing them to lose the ability to acquire further antigens but inducing their migration via the draining lymphatics, to the secondary lymphoid organs [Austyn & Larsen, 1990]. Here they adopt a stimulatory role, presenting the cargo of antigens they acquired in situ, to the repertoire of naive T cells. Their ability to activate T cells that have never before encountered antigen, is a property unique to DC and is a function of the co-stimulatory molecules they express upon maturation, of which CD40, ICAM-1 (CD54), B7-1 (CD80) and B7-2 (CD86) are the best characterized. Furthermore, their propensity to induce a Th1 phenotype among the T cells which respond is due largely to the secretion of cytokines such as IL-12 and IL-18 [Cella et al., 1996; Koch et al., 1996]. Because of their unrivalled ability to stimulate naive T cells in vivo, all immune responses, whether protective or pathogenic, are initiated upon the recognition of antigen presented by DC. Consequently, the potential for modulating the outcome of an immune response by harnessing the function of DC has aroused widespread interest. Indeed, their potential has been successfully exploited in a number of laboratories for enhancing an otherwise inadequate immune response to tumour-specific antigens, resulting in efficient tumour regression [Mayordomo et al., 1995; Celluzzi et al., 1996]. Furthermore, by providing immature DC with a source of chlamydial antigens, Su and colleagues have been able to successfully immunize mice against subsequent infection with Chlamydia [Su et al., 1998], illustrating their likely usefulness in programs of vaccination against infectious agents that have proven difficult to eradicate using conventional strategies. Over the past few years, the study of immunology has been revolutionized by the discovery that DC may present antigen not only for the purpose of enhancing cell-mediated immunity, but also for the induction of self-tolerance [Finkelmann et al., 1996; Thomson et al., 1996]. This contention has been supported by the characterization of a second lineage of DC derived from a lymphoid progenitor in common with T cells [Wu et al., 1997; Shortman & Caux, 1997]. These cells share with myeloid DC the capacity to acquire, process and present antigen to T cells but appear to induce unresponsiveness among the cells with which they interact, either by preventing their expansion through limiting IL-2 release [Kronin et al., 1996], or provoking their premature death by apoptosis [Suss & Shortman, 1996]. In this respect, lymphoid DC have been reported to constitutively express Fas-ligand which induces cell death among cells expressing its counter-receptor, Fas. These findings have raised the additional prospect of further harnessing the properties of DC to down-modulate detrimental immune responses, such as those involved in autoimmune disease and the rejection of allografted tissues. In spite of the promise DC hold for exploitation in a therapeutic setting, a number of less-desirable properties of DC have consistently limited progress. Firstly, although it is the immunogenic and tolerogenic function of mature DC which is most amenable to immune intervention, DC exhibit a short life span once terminally differentiated. This has made the prospect of genetic modification of DC less attractive since any benefits gained are necessarily short-lived. Furthermore, primary DC are peculiarly resistant to transfection, confounding most attempts to stably express heterologous genes; indeed the best protocol currently available involves the use of mRNA instead of cDNA for transfection purposes, creating, at best, a transient expression system [Boczkowski et al., 1996]. Although many groups have attempted to circumvent some of these difficulties by generating stable DC lines, the results have been universally disappointing, most putative lines being either retrovirally transformed [Paglia et al., 1993; Girolomoni et al., 1995; Volkmann et al., 1996] or incapable of progressing beyond an immature state [Xu et al., 1995]. Thus none of these provides a useful, renewable source of DC or one that can be genetically manipulated. Embryonic Stem Cells and their Differentiation Embryonic stem (ES) cells are derived from the epiblast of advanced blastocysts. The epiblast cells contribute to all cell types of the developing embryo, rather than the extra-embryonic tissues. Individual ES cells share this totipotency but may be maintained and propagated in an undifferentiated state by culturing them in recombinant leukaemia inhibitory factor (rLIF) [Smith et al., 1988], or on a monolayer of embryonic fibroblasts which may act as a potent source of this or related cytokines. Although ES cells may be propagated for a few passages in LIF, for long term culture, fibroblast feeder cells are preferred since ES cells maintained indefinitely in rLIF may lose their differentiation potential. Unlike primary cultures of DC, ES cells are particularly amenable to genetic modification since they survive even the most harsh conditions for the introduction of foreign DNA, including electroporation. Consequently, ES cells have been used extensively over recent years for the production of transgenic mice and for gene targeting by homologous recombination. Indeed, by introducing a null mutation into selected genes, it has proven possible to generate knockout mice, congenitally deficient in expression of specific molecules [Fung-Leung & Mak, 1992; Koller & Smithies, 1992]. The ability of ES cells to contribute to all lineages of the developing mouse, once reintroduced into recipient blastocysts, is a property which has also proven useful in vitro for the study of lineage relationships [Snodgrass et al., 1992; Keller 1995]. Indeed, a variety of protocols has been devised to encourage differentiation of ES cells along specific pathways. To date, there have been reports of the emergence of cell types as diverse as cardiac muscle, endothelial cells, tooth and neurons [Fraichard et al., 1995; Li et al., 1998]. In addition, differentiating ES cells have been shown to engage in the development of haematopoietic stern cells [Palacios et al., 1995] with the potential to differentiate into erythrocytes, macrophages, mast cells [Wiles & Keller, 1991; Wiles, 1993] and lymphocyte precursors of both the T and B cell lineages [Gutierrez-Ramos & Palacios, 1992; Nisitani et al., 1994; Potocnik et al., 1997]. The Invention It has now been discovered that DC can be generated by culturing ES cells under certain conditions, more specifically in the presence of IL-3 and optionally GM-CSF. Despite the many studies of haematopoiesis following ES cell differentiation in vitro, the appearance of primary DC (i.e. DC not passaged in culture in their own right) has not previously been reported. Surprisingly, while IL-3 has been used in a number of studies, either alone or in combination with GM-CSF, to induce haematopoiesis within developing embryoid bodies [Wiles & Keller, 1991; Keller, 1995] no DC development has been reported, although a clear effect on erythropoiesis and the development of macrophages and mast cells was routinely observed. The new findings provide a novel approach to genetic modification of DC which makes use of ES cell differentiation in vitro. In particular, stable lines of genetically modified ES cells can be used to generate mutant DC on demand. Thus, according to a first aspect of the invention there is provided an es dentritic cell (esDC). As used herein, the term es as applied to dentritic cells (DC) is intended to define dentritic cells which are derived from embryonic stem (ES) cells. Thus, esDC cells may be generated directly from ES cells by culture in vitro (for example, as described herein). In another aspect, the invention provides a genetically modified immature dentritic cell capable of maturation. The cells of the invention are preferably human cells. Recent reports of the derivation of human ES cells [Thomson et al., 1998], have stimulated much interest in their exploitation for the generation of terminally-differentiated cell types for use in cell replacement therapy [Gearhart 1998; Keller and Snodgrass, 1999]. For many cell types, however, such as neurons, muscle fibres and oligodendrocytes, their effectiveness in vivo depends on the efficiency with which they can be targeted to the correct anatomical location and site of the original lesion, as well as their propensity to integrate into the host tissue and maintain their physiological competence. For this reason the ES technology now available is far more likely to find an application among populations of cells such as DC that, once reintroduced in vivo, have been shown to migrate under the influence of chemokines, along compex migratory pathways to secondary lymphoid tissues. Importantly, the skilled worker will readily be able to adapt the protocols described herein for the generation of DC from human ES cells, for the reasons explained below. Firstly, Thomson and colleagues [1998] made use of embryonic fibroblasts from the mouse as a source of feeder cells and found compatibility between the two species, allowing human ES cells to be maintained long-term in an undifferentiated state. Secondly, much is now known about the growth factors required for the differentiation of mature DC in vitro from human haematopoietic stem cells (HSC) [reviewed in Shortman and Caux, 1997]. Significantly, of all the combinations of cytokines tested, only GM-CSF and IL-3 have been found to have the capacity to support DC development from CD34+ HSC, although the efficacy of this protocol is greatly enhanced by the addition of TNF-a to the culture medium, suggesting that this cytokine may also facilitate esDC development from embryoid bodies. Importantly, recombinant human cytokines including GM-CSF, IL-3 and TNF-a are currently available from a number of commercial sources, making the technology readily accessible. Another approach contemplated by the invention achieves germline competence by harnessing nuclear transfer technology [Wilmut et al., 1997; Wakayama et al., 1998] to permit the transfer of nuclei from human cells to enucleated ES cells of another species (such as ESF116) in order to confer on the nucleus the propensity for germline transmission. Moreover, nuclear transfer in this way may represent a possible solution to the complex ethical concerns surrounding derivation of novel human ES cell lines, making them more widely-available for purposes such as the generation of DC for therapeutic applications. The invention also provides various medical uses of the cells of the invention, including therapy and prophylaxis. Particularly preferred are immunotherapeutic uses. The invention therefore provides in another aspect a method for producing dendritic cells which method comprises: * i) providing a population of embryonic stem cells; * ii) culturing the embryonic stem cells in the presence of a cytokine or combination of cytokines which bring about differentiation of the embryonic stem cells into dendritic cells; and * iii) recovering the dendritic cells from the culture. A cytokine which has been found to be of critical importance in the generation of DC from ES cells in vitro is IL-3. In the presence of IL-3 alone DC develop which exhibit the characteristics of lymphoid rather than myeloid DC. On the other hand, in the presence of a combination of IL-3 and GM-CSF, larger populations of DC appear which represent DC of myeloid origin. Thus, the invention is concerned with the production of lymphoid-type and myeloid-type DC under different conditions. The invention is also concerned with ES cells which are genetically modified and which can pass on the genetic modification or modifications to the resulting DC. Thus, the method according to the invention may employ genetically modified ES cells. The invention also provides dendritic cells produced by the methods described herein, and genetically modified ES cells useful in the methods described herein including ES cells in which a gene normally expressed in dendritic cells is inactivated, and ES cells transfected with a construct comprising a promoter which is preferentially active in dendritic cells. In another aspect, the invention provides a method for investigating a mammalian gene, which method comprises generating a test population of dendritic cells from a population of embryonic stem cells and comparing the test dendritic cells in respect of the gene. The source of IL-3 and GM-CSF for use in the invention is not critical; either or both may be provided for example in pure recombinant form, or secreted from a cell line transfected with the gene and expressing the recombinant protein. In the latter case, tissue culture supernatant from the cell line may be used. S 0 far as concentration is concerned, in the presence of murine IL-3 alone murine DC will develop in concentrations as low as 40 U/ml, although 5,000 U/ml is optimal. In practice a concentration of about 1,000 U/ml may be preferable since it is economically more viable and there is still good colony growth of DC at that concentration. For ES cells in the presence of IL-3 together with GM-CSF, some synergy between the two cytokines may occur. The cell surface receptors for IL-3 and GM-CSF have a common ?-chain and therefore quite possibly share some of the same cell signalling mechanisms. An optimum level of murine GM-CSF for development of murine DC is about 30±5 ng/ml. At that level there is receptor saturation. However, GM-CSF at a concentration as low as 0.1 ng/ml stimulates the production of trace numbers of DC in the presence of 1,000 U/ml IL-3. Important for the development of DC from ES cells is the formation of embryoid bodies, which are preferably in liquid suspension culture rather than in any semi-solid matrix. It is preferable that embryoid bodies are free-floating for differentiation to proceed optimally. Embryoid bodies are formed from ES cells which have been removed from the inhibitory effects of LIF. The cells proliferate to form clusters of viable cells, each of which represents an embryoid body and can comprise differentiated or partially differentiated cells of a variety of cell types. In a particular embodiment of the method according to the invention, embryoid bodies are plated onto tissue culture dishes and exposed to the appropriate cytokine or combination of cytokines to promote development of DC. The embryoid bodies adhere to the surface and give rise to colonies of stromal cells which migrate outwards. After a few days DC develop around the periphery, presumably from early haematopoietic stem cells present in the embryoid bodies. DC which develop in this way can be harvested in substantially pure form, normally with less than 10% contaminating cell types e.g. about 5 to 10% contaminating cell types. Prior to the formation of embryoid bodies, the ES cells are routinely maintained in an undifferentiated state in the presence of LIF. The LIF is generally provided at this stage in pure recombinant form. However, for maintenance of ES cells in long term culture prior to the formation of embryoid bodies, LIF is preferably provided by culturing the ES cells in the presence of fibroblast feeder cells which secrete LIF and other cytokines. ES cells for production of DC in the method according to the invention may conceivably be derived from any appropriate mammalian source. Illustrated herein are murine ES cells and DC, but it will be clear that the invention is not necessarily limited to murine cells. ES cells from certain mouse strains are found to be permissive for DC development, while ES cells from other strains are not. However, it will also be clear that the invention is not limited to those permissive strains disclosed herein since it is a straightforward matter to prepare ES cells from other strains and test them for their competence in differentiating into DC. The apparent inconsistency between the results presented herein and previous studies using ES cells in which no DC were produced or recovered, may reflect a variety of possible factors. These include differences in the protocols employed, an inability in previous studies to identify any resulting DC, and strain differences in the propensity of ES cells to support DC development. In support of the latter possibility, initial studies on the CBA/Ca cell line ESF116 were repeated using a second CBA/Ca line generated in-house (ESF99) and one from 129/Sv mice which is widely used for gene knockout technology and which is commercially available (D3). Interestingly, while ESF99 supported the development of esDC, albeit to a lesser extent than ESF116, D3 failed entirely to do so under the same culture conditions. ES cells generated from other strains can easily be tested for their ability to support development of DC by using the protocols described herein. An additional example of a mouse strain from which ES cells have been shown to support development of DC is C57B1/6 (ESF75). Certain applications of the invention are discussed in more detail below and in the Examples which follow. It will be clear that the invention is not limited to the specific embodiments described herein. In particular, the genetic manipulation of the ES cells may be in any manner which results in any useful DC phenotype. Uses of the present invention extend to the fields of tumour immunotherapy and vaccination against infectious agents. Examples include transfection of the parent ES cells with genes encoding tumour-specific antigens or candidate microbial antigens against which a protective immune response is desirable. The endogenous expression of whole protein antigens in this way may harness the potent antigen processing capacity of DC to select the most appropriate epitopes for presentation on both class I and class II MHC, effectively by-passing the need for laborious identification of the epitopes involved. Furthermore, co-transfection of such cells with genes encoding FLIP (accession number: U97076) or bcl-2 (accession number: M16506) may prolong the life-span of esDC administered in vivo. Both molecules have been shown to exert a protective effect, actively interfering with the apoptotic pathways which normally limit DC survival, but in a manner that does not induce their transformation [Hockenbery et al. 1990]. By having their lifespan prolonged in this way, esDC presenting foreign or tumour-specific antigens may provide a chronic stimulus to the immune system. As an additional advantage, the need for adjuvants for the mounting of a powerful protective immune response may be reduced or removed. The potential for generating lymphoid DC, thought to be important in the maintenance of peripheral self-tolerance, may be exploited in the treatment of autoimmune disease which is characterized by loss of the tolerant state. Certain animal models for autoimmune disease will be useful in investigating the possibilities for treatment. Recently, Goulet and co-workers [1997] reported the isolation of ES cells from the MRL mouse strain susceptible to autoimmunity and demonstrated their germline competence. Such cells may prove useful for the production of esDC of the correct genetic background to permit the development of strategies for immune intervention. Alternatively or additionally, ES cells established from the diabetes-prone NOD mouse could provide useful DC for assessing the potential for immune intervention. A successfully produced ES cell line could be transfected with GAD-65 (accession number: L16980), an autoantigen known to be involved in the aetiology of insulin-dependent diabetes mellitus (IDDM), and induced to differentiate along the lymphoid route. Upon administration in vivo, such cells may actively seek out and tolerize T cells specific for the autoantigen, thereby limiting the extent and progression of tissue damage. Furthermore, by introducing the whole gene encoding GAD-65, all potential epitopes will be presented to the T-cell repertoire, overcoming problems associated with intramolecular determinant spreading [Lehmann et al. 1993]. A similar procedure could be carried out for tolerizing to other autoantigens. Recently, protocols have been published for the generation of ES cells in which both alleles of a gene have been targeted by homologous recombination, resulting in cells deficient in a given protein [Hakem et al., 1998]. This provides an approach for altering DC function by knocking out candidate genes such as the p40 subunit of IL-12 (accession number: M86671) or the p35 subunit of IL-12 (IL-12 is a hederodimer and at least two genes are involved in its expression). Since this cytokine is fundamental to the establishment of a Th1 response, responding T cells may default to a Th2 phenotype in its absence. Given that Th1 and Th2 cells are mutually antagonistic and that the latter are frequently protective in inflammatory autoimmune conditions [Liblau et al. 1995], IL-12 + esDC may prove effective in inducing immune deviation and modulating the outcome of an ongoing autoimmune response. Should the selection criteria for production of knockout ES cells according to the published protocols prove to be too stringent, alternative approaches to prevent expression or activity of target molecules can be employed. Such approaches include for example antisense constructs, ribozymes or the expression of dominant negative forms of molecules, where available. A dominant negative form of a molecule is an altered e.g. mutated form which blocks the function of the endogenous form of the molecule, for example by binding in its place. Examples of all of these approaches are present in the literature. Identification of Novel Targets for Immune Intervention The approaches to immune intervention, outlined above, require prior knowledge of specific genes involved in the immune response and the function they perform. Nevertheless, only a small proportion of the genes that control DC function have been elucidated. The protocols for the development of DC from ES cells in vitro as described herein may, therefore, be exploited for the identification of novel targets for immune modulation which may ultimately prove useful in a clinical setting. Several approaches to identifying new genes have recently been described, of which the serial analysis of gene expression (SAGE) is perhaps the most powerful [Valculescu et al., 1995]. This methodology permits those genes that are actively expressed by two populations of cells to be compared in a differential manner. It may, therefore, be possible to compare gene expression in embryoid bodies from ESF116, known to support DC development, and those from D3 which fails to do so. Such an approach may define genes involved in the early stages of haematopoiesis which control development of the DC lineage. Alternatively, purified populations of myeloid and lymphoid DC may be compared to elucidate the genes responsible for converting an immunostimulatory DC to one capable of inducing self-tolerance. While such an approach may highlight important new genes involved in the ontogeny and function of DC, there remains a significant gene-function gap, it being considerably easier to identify genes that contribute to a particular phenotype than to elucidate the function of the proteins they encode. As a way of addressing this deficiency, a number of laboratories have pioneered gene-trapping technology [Evans et al., 1997] which seeks to trap genes in an unbiased way and provide the potential for identifying their function. To this end, Zambrowicz et al. [1998] have generated an Omnibank of ES cells in which genes have been randomly targeted for inactivation. Using these cells, knockout mice may be generated which may be screened for specific defects which might betray the function of the targeted gene. Although the production of knockout mice is now well-established, the screening of is large numbers of genes in this way remains an immense undertaking which is likely to be limited by the many logistical constraints. By combining gene trapping technology with our own approach and established readouts for antigen processing and immunostimulation, we may be able to screen rapidly many new genes to identify those th... |
| 5th row | This is a continuation of application Ser. No. 13/442,923, filed Apr. 10, 2012, which is a continuation of application Ser. No. 12/817,320, filed Jun. 17, 2010, now U.S. Pat. No. 8,170,206, which is a continuation of application Ser. No. 11/824,803, filed Jul. 3, 2007, now U.S. Pat. No. 7,860,248, which is a continuation of application Ser. No. 11/359,928, filed Feb. 22, 2006, now U.S. Pat. No. 7,242,769, which is a continuation of application Ser. No. 09/872,509, filed Jun. 1, 2001, now U.S. Pat. No. 7,298,842, which is a continuation of application Ser. No. 09/059,776, filed Apr. 14, 1998, now U.S. Pat. No. 6,256,391, and which is entitled to the priority filing date of Japanese application P09-106136, filed Apr. 23, 1997, the entirety of which is incorporated herein by reference. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a block diagram showing an example of a construction of an information, processing system to which the present invention is applied; FIG. 2 is a block diagram showing an example of internal constructions of a DVD player, a personal computer and a magneto-optical disk apparatus shown in FIG. 1; FIG. 3 is a block diagram illustrating an authentication procedure performed in the information processing system of FIG. 1; FIG. 4 is a timing chart illustrating the authentication procedure illustrated in FIG. 3; FIG. 5 is a diagrammatic view illustrating a format of a node_unique_ID; FIG. 6 is a timing chart illustrating another authentication procedure; FIG. 7 is a similar view but illustrating a further authentication procedure; FIG. 8 is a similar view, but illustrating a still further authentication procedure; FIG. 9 is a similar view but illustrating a yet further authentication procedure; FIG. 10 is a block diagram illustrating an enciphering procedure; FIG. 11 is a block diagram showing an example of a construction of a 1394 interface used in the enciphering procedure of FIG. 10; FIG. 12 is a block diagram showing an example of a more detailed construction of the 1394 interface of FIG. 11; FIG. 13 is a block diagram showing an example of a more detailed construction of a linear feedback shift register shown in FIG. 12; FIG. 14 is a block diagram showing an example of a more detailed construction of the linear feedback shift register of FIG. 13; FIG. 15 is a block diagram showing an example of a construction of a 1394 interface used in the enciphering procedure of FIG. 10. FIG. 16 is a block diagram showing an example of a more detailed construction of the 1394 interface of FIG. 15; FIG. 17 is a block diagram showing an example of a construction of a 1394 interface used in the enciphering procedure of FIG. 10; FIG. 18 is a block diagram showing an example of a more detailed construction of the 1394 interface of FIG. 17; FIG. 19 is a block diagram showing an example of a construction of an application section used in the enciphering procedure of FIG. 10; FIG. 20 is a block diagram showing an example of a more detailed construction of the application section of FIG. 19; FIG. 21 is a block diagram showing another example of the construction of the 1394 interface used in the enciphering procedure of FIG. 10: FIG. 22 is a block diagram showing another example of the construction of the 1394 interface used in the enciphering procedure of FIG. 10; FIG. 23 is a block diagram showing another example of the construction of the 1394 interface used in the enciphering procedure of FIG. 10; and FIG. 24 is a block diagram showing another example of the construction of the application section used in the enciphering procedure of FIG. 10. BACKGROUND OF THE INVENTION 1. Field of the Invention This invention relates to an enciphering apparatus and method, a deciphering apparatus and method and an information processing apparatus and method, and more particularly to an enciphering apparatus and method, a deciphering apparatus and method and an information processing apparatus and method by which high security is assured. 2. Description of the Related Art Recently, a network is available which is composed of a plurality of electronic apparatus represented by AV apparatus, computers and so forth which are connected to each other by a bus so that various data may be communicated between them. Where a network of the type mentioned is employed, for example, data of a movie reproduced from a DVD (Digital Video Disk or Digital Versatile Disk) by a DVD player connected to the network can be transferred through the bus to and displayed by a display unit such as a television receiver or a monitor. Usually, it is licensed from the proprietor of copyright at a point of time when a DVD is purchased to display and enjoy a movie reproduced from the DVD on a display unit. However, it is not usually licensed from the proprietor of copyright to copy data reproduced from the DVD onto another recording medium and utilize the same. Thus, in order to prevent data sent out through the bus (network) from being copied illegally, it is a possible idea to encipher the data on the sending side and decipher the data on the receiving side. However, consumer electronics apparatus (CE apparatus) such as DVD players and television receivers are normally designed and produced for predetermined objects and are each produced such that it is impossible for a user to modify it or incorporate a different part into it to acquire or alter internal data (change of functions) of the apparatus. On the other hand, for example, in regard to personal computers, the architecture or circuitry is open to the public, and it is possible to add a board, or install various application software to add or alter various functions. Accordingly, in regard to a personal computer, it can be performed comparatively readily to directly access or alter data on an internal bus of the personal computer by adding predetermined hardware or applying a software program. This signifies that, by producing and applying application software, it can be performed readily, for example, to receive data transmitted as ciphered data from a DVD player to a television receiver and decipher or copy the received data by a personal computer. In other words, a personal computer has a weak connection between a link portion which effects communication via a bus and an application portion which prepares data to be transmitted and utilizes received data, and includes many portions which can be modified physically and logically by a user. In contrast, a CE apparatus has a strong connection between them and includes little portion which allows intervention of a user. SUMMARY OF THE INVENTION It is an object of the present invention to provide an enciphering, apparatus and method, a deciphering apparatus and method and an information processing apparatus and method by which illegal copying of data can be prevented with a higher degree of certainty. In order to attain the object described above, according to an aspect of the present invention to provide an enciphering apparatus, comprising enciphering means for enciphering data using a cryptographic key, first generating means for generating a first key, second generating means for generating a second key which is changed at a predetermined timing while the data is enciphered, and producing means for producing the cryptographic key using the first key and the second key. According to another aspect of the present invention, there is provided an enciphering method, comprising the steps of enciphering data using a cryptographic key, generating a first key, generating a second key which is changed at a predetermined timing while the data are enciphered, and producing the cryptographic key using the first key and the second key. With the enciphering apparatus and the enciphering method, since a cryptographic key is produced using a first key and a second key which is changed at a predetermined timing while data is enciphered, encipherment can be performed with a high degree of security. According to a further aspect of the present invention, there is provided a deciphering apparatus, comprising receiving means for receiving enciphered data, deciphering means for deciphering the received data using a cryptographic key, first generating means for generating a first key, second generating means for generating a second key which is changed at a predetermined timing while the data is deciphered, and producing means for producing the cryptographic key using the first key and the second key. According to a still further aspect of the present invention, there is provided a deciphering method, comprising the steps of receiving enciphered data, deciphering the received data using a cryptographic key, generating a first key, generating a second key which is changed at a predetermined timing while the data is deciphered, and producing the cryptographic key using the first key and the second key. With the deciphering apparatus and the deciphering method, since a cryptographic key is produced using a first key and a second key which is changed at a predetermined timing while data is deciphered, enciphered data can be deciphered with a higher degree of security. According to a yet further aspect of the present invention, there is provided an information processing system, comprising a plurality information processing apparatus connected to each other by a bus, the information processing apparatus including first information processing apparatus each having a function whose change is not open to a user, and second information processing apparatus each having a function whose change is open to a user, each of the first information processing apparatus including first receiving means for receiving, enciphered data, first deciphering means for deciphering the data received by the first receiving means using a cryptographic key, first generating means for generating a first key, second generating means for generating a second key which is changed at a predetermined timing while the data is deciphered, and first producing means for producing the cryptographic key using the first key generated by the first generating means and the second key generated by the second generating means, each of the second information processing apparatus including second receiving means for receiving enciphered data, third generating means for generating the first key, fourth generating means for generating the second key which is changed at a predetermined timing while the data is deciphered, second producing means for producing a first cryptographic key using one of the first key generated by the third generating means and the second key generated by the fourth generating means, third producing means for producing a second cryptographic key using the other of the first key generated by the third generating means and the second key generated by the fourth means, second deciphering means for deciphering the enciphered data received by the receiving means using the first cryptographic key, and third deciphering means for further deciphering the data deciphered by the second deciphering means using the second cryptographic key. According to a yet further aspect of the present invention, there is provided an information processing method for an information processing system composed of a plurality information processing apparatus connected to each other by a bus, the information processing apparatus including first information processing apparatus each having a function whose change is not open to a user, and second information processing apparatus each having a function whose change is open to a user, comprising the steps performed by each of the first information processing apparatus of receiving enciphered data, deciphering the data received in the receiving step using a cryptographic key, generating a first key, generating a second key which is changed at a predetermined timing while the data is deciphered, and producing the cryptographic key using the first key generated in the first generating step and the second key generated in the second generating step, and the steps performed by each of the second information processing apparatus of receiving enciphered data, generating the first key, generating the second key which is changed at a predetermined timing while, the data is deciphered, producing a first cryptographic key using one of the first key and the second key, producing a second cryptographic key using the other of the first key and the second key, deciphering the enciphered data received in the receiving step using the first cryptographic key, and deciphering the deciphered data further using the second cryptographic key. With the information processing system and the information processing method, since, in the first information processing apparatus which have functions whose change is not open to a user, a cryptographic key is produced using a first key and a second key which is changed at a predetermined timing while data is deciphered, but in the second information processing apparatus which have functions whose change is open to a user, a first cryptographic key is produced using one of a first key and a second key which is changed at a predetermined timing while data is deciphered, and then a second cryptographic key is produced using the other, whereafter the enciphered data is deciphered using the first cryptographic key, and the deciphered data is further deciphered using the second cryptographic key, the information processing apparatus and method has a higher degree of reliability than ever. According to a yet further aspect of the present invention, there is provided an information processing apparatus, comprising receiving means for receiving data transmitted thereto through a bus, producing means composed of a software program for producing a first cryptographic key and a second cryptographic key which is changed at a predetermined timing while the data is deciphered from the data received by the receiving means, first deciphering means for deciphering the enciphered data received by the receiving means using one of the first cryptographic key and the second cryptographic key produced by the producing means, and second deciphering means for deciphering and processing the data deciphered by the first deciphering means further using the other of the first cryptographic key and the second cryptographic key produced by the producing means. According to a yet further aspect of the present invention, there is provided an information processing method, comprising the steps of receiving data transmitted thereto through a bus, producing, from the received data, a first cryptographic key and a second cryptographic key which is changed at a predetermined timing while the data is deciphered, deciphering the received enciphered data using one of the first cryptographic key and the second cryptographic key, and deciphering the deciphered data further using the other of the first cryptographic key and the second cryptographic key. With the information processing apparatus and the information processing method, since a first cryptographic key and a second cryptographic key which is changed at a predetermined timing while data is deciphered are produced based on a software program, decipherment can be performed for each application program, and illegal copying can be prevented with a higher degree of accuracy. The above and other objects, features and advantages of the present invention will become apparent from the following description and the appended claims, taken in conjunction with the accompanying drawings in which like parts or elements are denoted by like reference characters. DESCRIPTION OF THE PREFERRED EMBODIMENTS Referring first to FIG. 1, there is shown an exemplary information processing system to which the present invention is applied. The information processing system shown includes a DVD player 1, a personal computer 2, an magneto-optical disk apparatus 3, a data broadcasting receiver 4, a monitor 5 and a television receiver 6 all connected to each other by an IEEE 1394 serial bus 11. Referring now FIG. 2, there are shown more detailed internal constructions of the DVD player 1, personal computer 2 and magneto-optical disk apparatus 3 of the information processing system shown in FIG. 1. The DVD player 1 is connected to the 1394 bus 11 by a 1394 interface 26. The DVD player 1 includes a CPU 21 which executes various processes in accordance with programs stored in a ROM 22. A RAM 23 is used to suitably stores data, programs and so forth necessary for the CPU 21 to execute various processes. An operation section 24 is formed from buttons, switches, a remote controller and so forth, and when it is operated by a user, it outputs a signal corresponding to the operation. A drive 25 drives a DVD not shown to reproduce data recorded on the DVD. An EEPROM (Electrically Erasable Programmable Read Only Memory) 27 stores information such as key information which must remain stored also after the power supply to the apparatus is turned off. An internal bus 28 connects the components to each other. The magneto-optical disk apparatus 3 includes a CPU 31, a ROM 32, a RAM 33, an operation section 34, a drive 35, a 1394 interface 36, an EEPROM 37 and an internal bus 38 which have similar functions to those of the DVD player 1 described above. Here, description of the similar components is omitted to avoid redundancy. It is to be noted, however, that the drive 35 drives not a DVD but a magneto-optical disk not shown to record or reproduce data onto or from the magneto-optical disk. The personal computer 2 is connected to the 1394 bus 11 via a 1394 interface 49. The personal computer 2 includes a CPU 41 which executes various processes in accordance with programs stored in a ROM 42, and a RAM 43 into which data, programs and so forth necessary for the CPU 41 to execute various processes are stored suitably. A keyboard 45 and a mouse 46 are connected to an input/output interface 44, and the input/output interface 44 outputs signals inputted thereto from the keyboard 45 and the mouse 46 to the CPU 41. Further, a hard disk drive (HDD) 47 is connected to the input/output interface 44 so that data, programs and so forth can be recorded onto and reproduced from a hard disk not shown by the hard disk driver 47. Further, an extended board 48 can be suitably mounted onto the input/output interface 44 so that a necessary function can be additionally provided to the personal computer 2. An EEPROM 50 is used to store information which must remain stored also after the power supply to the personal computer 2 is turned off such as information of various keys. An internal bus 51 is formed from, for example, a PCI (Peripheral Component Interconnect) bus, a local bus or the like and connects the components mentioned above to each other. It is to be noted that the internal bus 51 is open to the user so that the user can suitably receive data transmitted by the internal bus 51 by suitably connecting a predetermined board to the extended board 48 or by producing and installing a predetermined software program. In contrast, in any of consumer electronics (CE) apparatus such as the DVD player 1 and the magneto-optical disk apparatus 3, the internal bus 28 or the internal bus 38 is not open to a user and the user cannot acquire data transmitted in it unless special alteration is performed for it. Subsequently, a procedure of authentication performed between a source and a sink is described. Here, the authentication procedure is performed, for example, as seen in FIG. 3, between firmware 20 as one of software programs stored in advance in the ROM 22 of the DVD player 1 serving as a source and a license manager 62 as one of software programs stored in the ROM 42 of the personal computer 2 serving as a sink and processed by the CPU 41. FIG. 4 illustrates a procedure of authentication performed between the source (DVD player 1) and the sink (personal computer 2). A service key (service_key) and a function (hash) are stored in advance, in the EEPROM 27 of the DVD player 1. They are both provided to the user of the DVD player 1 from the proprietor of copyright, and the user stores them in the EEPROM 27 secretly. The service key is provided for each information provided by the proprietor of copyright and is common to systems which are constructed using the 1394 bus 11. It is to be noted that the system in the present specification signifies a general apparatus formed from a plurality of apparatus. The hash function is a function for outputting data of a fixed length such as 64 bits or 128 bits in response to an input of an arbitrary length, and is a function with which, when y (=hash(x)) is given, it is difficult to determine x, and also it is difficult to determine a set of x1 and x2 with which hash(x1)=hash(x2) is satisfied. As representative ones of one-directional hash functions, MD5, SHA and so forth are known. The one-directional hash function is explained in detail in Bruce Schneier, Applied Cryptography (Second Edition), Wiley. Meanwhile, for example, the personal computer 2 as a sink stores an identification number (ID) and a license key (license_key) given from the proprietor of copyright and peculiar to the personal computer 2 itself secretly in the EEPROM 50. The license key is a value obtained by applying the hash function to data (ID?service_key) of n+m bits obtained by connecting the ID of n bits and the service key of m bits. In particular, the license key is represented by the following expression: license_key= has(ID?service_key) For the ID, for example, a node_unique_ID prescribed in the standards for a 1394 bus can be used. The node_unique_ID is composed of, as seen from FIG. 5, 8 bytes (64 bits), wherein the first 3 bytes are managed by the IEEE and given from the IEEE to the individual maker of electronic apparatus. Meanwhile, the lower 5 bytes can be given by each maker to each apparatus provided to any user by the maker itself. Each maker applies, for example, numbers of the lower 5 bytes serially to individual apparatus with a single number applied to one apparatus, and if all available numbers for the 5 bytes are used up, then another node_unique_ID whose upper 3 bytes are different is given to the maker whereas a single number is applied to one apparatus with the lower 5 bytes. Accordingly, the node_unique_ID is different among different units irrespective of its maker and is unique to each unit. In step S 1, the firmware 20 of the DVD player 1 controls the 1394 interface 26 to request the personal computer 2 for an ID through the 1394 bus 11. The license manager 62 of the personal computer 2 receives the request for an ID in step S2. In particular, the 1394 interface 49 outputs, when it receives the signal of the request for an ID transmitted thereto from the DVD player 1 through the 1394 bus 11, the signal to the CPU 41. The license manager 62 of the CPU 41 reads out, when the request for an ID is received, the ID stored in the EEPROM 50 and transmits the ID from the 1394 bus 11 to the DVD player 1 through the 1394 interface 49 in step S3. In the DVD player 1, the ID is received by the 1394 interface 26 in step S4 and supplied to the firmware 20 which is being operated by the CPU 21. The firmware 20 couples, in step S5, the ID transmitted thereto from the personal computer 2 and the service key stored in the EEPROM 27 to produce data (ID?service_key) and applies a hash function as given by the following expression to the data to produce a key lk: lk=hash (ID?Service_key) Then, in step S 6, the firmware 20 produces a cryptographic key sk which is hereinafter described in detail. The cryptographic key sk is utilized as a session key in the DVD player 1 and the personal computer 2. Then, in step S 7, the firmware 20 enciphers the cryptographic key sk produced in step S6 using the key lk produced in step S5 as a key to obtain enciphered data (enciphered key) e. In other words, the firmware 20 calculates the following expression: e=Enc (lk,sk) where Enc(A, B) represents to encipher data B using a key A in a common key cryptography. Then, in step S 8, the firmware 20 transmits the enciphered data e produced in step S7 to the personal computer 2. In particular, the enciphered data e is transmitted from the 1394 interface 26 of the DVD player 1 to the personal computer 2 through the 1394 bus 11. In the personal computer 2, the enciphered data e is received by the 1394 interface 49 in step S9. The license manager 62 deciphers the enciphered data e received in this manner using the license key stored in the EEPROM 50 in accordance with the following expression to produce a deciphering key sk?: sk?=Dec (license_key,e). where Dec(A, B) represents to decipher data B using a key A in a common key cryptography. It is to be noted that, as an algorithm for encipherment in the common key cryptography, the DES is known. Also the common key cryptography is explained in detail in Applied Cryptography (Second Edition) mentioned hereinabove. The key lk produced in step S 5 by the DVD player 1 has a value equal to that (license_key) stored in the EEPROM 50 of the personal computer 2. In other words, the following expression is satisfied: lk =license_key Accordingly, the key sk? obtained by the decipherment in step S 10 by the personal computer 2 has a value equal to that of the cryptographic key sk produced in step S6 by the DVD player 1. In other words, the following expression is satisfied: sk?=sk In this manner, the keys sk and sk? which are equal to each other can be possessed commonly by both of the DVD player 1 (source) and the personal computer 2 (sink). Thus, either the key sk can be used as it is as a cryptographic key, or a pseudo-random number may be produced based on the key sk and used as a cryptographic key by both of the source and the sink. Since the license key is produced based on the ID peculiar to the apparatus and the service key corresponding to information to be provided as described above, another apparatus cannot produce the key sk or sk?. Further, any apparatus which is not authorized by the proprietor of copyright cannot produce the sk or sk? since it does not have a license key. Accordingly, when the DVD player 1 thereafter enciphers reproduction data using the cryptographic key sk and transmits resulting data to the personal computer 2, where the personal computer 2 has the license key obtained legally, since it has the cryptographic key sk?, it can decipher the enciphered reproduction data transmitted thereto from the DVD player 1. However, where the personal computer 2 is not legal, since it does not have the cryptographic key sk?, it cannot decipher the enciphered reproduction data transmitted thereto. In other words, since only a legal apparatus can produce the common cryptographic keys sk and sk?, authentication is performed as a result. Even if the license key of the single personal computer 2 is stolen, since the ID is different among different units, it is impossible for another apparatus to decipher enciphered data transmitted thereto from the DVD player 1 using the license key. Accordingly, the security is augmented. FIG. 6 illustrates an exemplary procedure when not only the personal computer 2 but also the magneto-optical disk apparatus 3 function as a sink with respect to a source (DVD player 1). In this instance, an ID 1 is stored as an ID and a license_key1 is stored as a license key in the EEPROM 50 of the personal computer 2 which serves as a sink1, but in the magneto-optical disk apparatus 3 which serves as a sink2, an ID2 is stored as an ID and a license_key2 is stored as a license key in the EEPROM 37. Processes in steps S 11 to S20 performed between the DVD player 1 (source) and the personal computer 2 (sink1) are substantially similar to the processes in steps S1 to S10 illustrated in FIG. 4. Therefore, description of the processes in steps S11 to S20 is omitted to avoid redundancy. After the DVD player 1 cooperates with the personal computer 2 to perform an authentication procedure in such a manner as described above, it requests, in step S21, the magneto-optical disk apparatus 3 for an ID. When the ID requesting signal is received via the 1394 interface 36 in step S22 by the magneto-optical disk apparatus 3, firmware 30 (FIG. 10) in the magneto-optical disk apparatus 3 reads out the ID (ID2) stored in the EEPROM 37 in step S23 and transmits the ID from the 1394 interface 36 to the DVD player 1 through the 1394 bus 11. The firmware 20 of the DVD player 1 receives the ID2 via the 1394 interface 26 in step S24 and produces a key lk2 based on the following expression in step S25: lk 2=hash(ID2?service_key) Further, the firmware 20 calculates the following expression in step S26 to encipher the key sk produced in step S16 using the key lk2 produced in step S25 to produce enciphered data e2: e 2=Enc(lk2,sk) Then, in step S 27, the firmware 20 transmits the enciphered data e2 from the 1394 interface 26 to the magneto-optical disk apparatus 3 through the 1394 bus 11. The magneto-optical disk apparatus 3 receives the enciphered data e2 via the 1394 interface 36 in step S28, and calculates the following expression in step S29 to produce a cryptographic key sk2?: sk 2?=Dec(license_key2,e2) The cryptographic keys sk 1? and sk2? are obtained by the personal computer 2 and the magneto-optical disk apparatus 3, respectively, in such a manner as described above. The values of them are an equal value to the cryptographic key sk of the DVD player 1. While, in the procedure of FIG. 6, the DVD player 1 requests the personal computer 2 and the magneto-optical disk apparatus 3 individually for an ID and processes the received IDs, where a request for an ID can be delivered by broadcast communication, such a procedure as illustrated in FIG. 7 can be performed. In particular, in the procedure of FIG. 7, the DVD player 1 as a source requests all sinks, which are, in the present procedure, the personal computer 2 and the magneto-optical disk apparatus 3, for an ID by broadcast communication. After the personal computer 2 and the magneto-optical disk apparatus 3 receive the signal of the request for transfer of an ID in steps S42 and S43, respectively, each of them reads out the ID1 or the ID2 stored in the EEPROM 50 or the EEPROM 37 and transfers it to the DVD player 1 in step S44 or step S45. The DVD player 1 receives the IDs in steps S46 and S47. The DVD player 1 produces a cryptographic key lk1 based on the following expression in step S48: lk 1=hash(ID1?service_key) Further, in step S 49, a cryptographic key lk2 is produced based on the following expression: lk 2=has(ID2?service_key) In the DVD player 1, a cryptographic key sk is produced further in step S50, and in step S51, the cryptographic key sk is enciphered as given by the following expression using the key lk1 as a key: e 1=Enc(lk1,sk) Further, in step S 52, the cryptographic key sk is enciphered in accordance with the following expression using the key lk2 as a key: e 2=Enc(lk2,sk) Furthermore, in step S 53, the values ID1, e1, ID2 and e2 thus obtained are coupled as given by the following expression to produce enciphered data e: e=ID 1?e1?ID2?e2 The encip... |
Common Values
| Value | Count | Frequency (%) |
| CROSS-REFERENCE TO RELATED APPLICATIONS This application is a continuation of U.S. application Ser. No. 12/567,718, entitled Steam Appliance, filed Sep. 25, 2009, which is herein incorporated by reference in its entirety. BRIEF DESCRIPTION OF THE DRAWINGS The accompanying drawings are not intended to be drawn to scale. For purposes of clarity, not every component may be labeled in every drawing. In the drawings: FIG. 1 is a side view of a steam appliance system according to one embodiment of the invention; FIG. 2 is a side view of a first portion of a connector according to one embodiment of the invention; FIG. 3 is a cross-sectional view of a second portion of a connector configured to engage with the first portion illustrated in FIG. 2; and FIG. 4 is an exploded perspective view of components of the second connector portion illustrated in FIG. 3. FIELD OF THE INVENTION The invention relates generally to steam appliances, and more specifically to a steam applicator that is connectable to a conduit but constructed and arranged be rotated without loosening or disengaging the connection. DISCUSSION OF THE RELATED ART Steam appliances are used in the home to apply steam to floors for cleaning and sanitizing. Various types of steam appliances are known, including canister steam appliances and self-contained steam mops for example. Canister steam appliances typically include a rollable steam generation unit, a hose to transfer the steam from the steam generation unit, a pole, and a mop head or other accessory which is connected to the end of the pole. Self-contained steam mops include a steam generation unit mounted directly on the pole. Handheld steam appliances typically include a container and a nozzle for discharging steam directly from the mouth of the container. SUMMARY Embodiments of the invention provided herein are directed to steam appliances in which a steam applicator is connectable to the steam appliance, but the steam applicator is permitted to rotate without loosening or disengaging the connection of the steam applicator to the steam appliance. According to one embodiment of the invention, a steam appliance includes a steam generation unit, a steam applicator, and a steam conduit configured to guide steam from the steam generation unit to a steam inlet for the steam applicator. The steam applicator is connectable to the steam conduit, and the steam applicator is rotatable relative to the steam conduit in either rotational direction without loosening the connection of the steam applicator to the steam conduit. According to another embodiment of the invention, a method of using a steam applicator having a handle with a end-to-end direction includes acts of grasping the handle with a first hand, grasping a steam conduit with a second hand, bringing a first threaded portion of the steam applicator into contact with a second threaded portion of the steam conduit, and connecting the steam applicator to the steam conduit. The method further includes using the steam applicator to apply steam to an object, and rotating the handle in either rotational direction about the end-to-end direction of the handle to rotate the steam applicator, wherein the rotation of the handle does not loosen the connection of the steam applicator to the steam conduit. Also included is a method of disconnecting the steam applicator from the steam conduit by simultaneously rotating the first threaded portion relative to the second threaded portion and applying an axial force between the conduit and the steam applicator, the axial force being sufficient to overcome a force applied by a resilient element, such that at least one of the first and second threaded portions is altered from a configuration in which the at least one threaded portion is rotatable relative to whichever of the steam applicator and the steam conduit that it is positioned on, to a configuration in which the at least one threaded portion is not rotatable relative to whichever of the steam applicator and the steam conduit that it is positioned on. According to a further embodiment of the invention, a steam appliance includes a steam generation unit, a steam applicator having a handle, a steam conduit to guide steam from the steam generation unit to the steam applicator, and means for mechanically connecting the steam conduit to the handle of the steam applicator. The handle is permitted to repeatedly rotate relative to the steam conduit in either rotation direction about an end-to-end direction of the handle without loosening the connection of the handle to the steam conduit. Various embodiments of the present invention provide certain advantages. Not all embodiments of the invention share the same advantages and those that do may not share them under all circumstances. Further features and advantages of the present invention, as well as the structure of various embodiments of the present invention are described in detail below with reference to the accompanying drawings. DETAILED DESCRIPTION Applicants have recognized the importance of providing a steam applicator assembly which can be freely rotated without compromising the connection of the applicator assembly to a steam conduit. The ability to rotate the steam applicator can be particularly important when the steam applicator assembly is a handheld assembly that is attached to a flexible hose or other flexible conduit because a user may wish to rotate the steam applicator without twisting or kinking the hose. It is also desirable to prevent unintentional disengagement of the steam applicator during rotation of the steam applicator to avoid steam loss and the inconvenience of reconnecting the steam applicator. According to some embodiments of the invention, a steam appliance permits a user to engage and disengage the steam applicator with the same type of motion and without detaching any components. In some embodiments, disconnecting the steam applicator requires two distinct motions. For example, a user may need to push the steam applicator toward the steam conduit and then twist the conduit to separate the steam conduit and the steam applicator. According to one embodiment of the invention, a steam applicator is connected to a flexible steam conduit with a threaded connector configuration which allows rotation of the steam applicator relative to the steam conduit during use without compromising the connection. The threaded connector includes an external thread portion and an internal thread portion. One of the thread portions, for example the internal thread portion, is positioned within an element such as a handle on the steam applicator. The internal thread portion is constructed and arranged to rotate within the handle. By allowing the internal thread portion to float within the handle, friction between the thread portions rotates the internal thread portion within the handle, thereby substantially preventing the complementary external thread portion from being fully twisted into or out of the internal thread portion. To successfully twist the external thread portion into or out of the internal thread portion, the user pushes the two thread portions toward each other, which temporarily fixes the internal thread portion to the handle, thereby permitting relative rotation of the two thread portions. A steam appliance system 100 including two attachable steam applicators 102, 104 is shown in FIG. 1. Steam applicators 102, 104 each may include a handle 107 which is permanently or detachably attached to the applicator. In the embodiment of FIG. 1, steam appliance system 100 includes a steam generation unit 108, a steam conduit 110, and attached steam applicator 102. Steam generation unit 108 may include any suitable type of steam generation system, for example a cool water reservoir 112 and an aluminum die-cast steam generator (not shown). In some embodiments, water may be heated to its boiling point within its reservoir to create steam. It should be noted that the method of steam generation is not intended to be a limiting aspect of the invention. In some embodiments, the steam generation unit 108 is handheld, while in other embodiments the steam generation unit may include a shoulder strap, or include wheels or other rollers. Steam conduit 110 is a flexible hose in some embodiments. Steam conduit 110 may be attachable to steam generation unit 108 with any suitable attachment 114, including a removable connector, such as a bayonet connector. One particular embodiment of a steam appliance which permits rotation a steam applicator without compromising the connection of the steam applicator to the steam appliance is shown in FIGS. 2-4. In this embodiment, a steam appliance includes an externally-threaded connector portion 202 attached to steam conduit 110. A hand grasp portion 206 is attached to steam conduit 110 and threaded connector portion 202 for the user to grip when attaching or detaching steam conduit 110 and handle 107. Steam conduit includes an elongated stem 208 to guide steam through handle 107 and to a steam outlet 212. O-rings 210 or other seal elements may be positioned on stem 208 to establish a seal with the steam applicator, whether that seal be within the handle of the steam applicator, or within the steam applicator itself. The stem and sealing aspects of the illustrated embodiment are not intended to be limiting. A stress release sleeve 214 may be included at the junction of steam conduit 110 and hand grasp portion 206 in some embodiments. An internally-threaded connector portion 302 with threads 304 is positioned within handle 107 in the embodiment illustrated in FIG. 3. Connector portion 302 is permitted to rotate within handle 107, and is also permitted to move axially between stops 306 and 308. Connector portion 302 is biased away from a lock element 310 by a coil spring 312. Instead of a spring, any suitable resilient element may be used to bias connector portion 302 away from lock element 310. For example, a compressible resilient foam gasket may be used in some embodiments. In still other embodiments, a constant force spring, an elastic band, or any other suitable tensioning device, may bias connector portion 302 away from locking element 310 by pulling on connector portion 302. When a user initially inserts externally-threaded connector portion 202 into internally-threaded connector portion 302, rotating the two portions relative to each other will not result in a mating of the threaded portions because connector portion 302 rotates with connector portion 202. However, when the user pushes connector portion 302 against locking element 310 by providing an axial force of at least a threshold force t to overcome the force provided by coil spring 312 connector portion is prevented from rotating by more than a small angle because locking tabs 314 on connector portion 302 are rotated into abutment with locking tabs 316 on the locking element 310. With locking element 310 prevented from rotating, connector portion 202 can be twisted into mating engagement with connector portion 302. Locking element 310 is prevented from moving axially away from connector portion 302 by a stop 318. In this manner, two distinct motions are required of the user to attach or remove a steam applicator from steam conduit 110. While in the illustrated embodiment the two distinct motions include an axial force and a twisting force acting simultaneously, other multiple distinct action configurations may be used. For example, in some embodiments, a ball and groove quick disconnect coupling is used to connect a steam conduit to a steam applicator. In such an embodiment, a first motion may include moving a locking collar, and a second motion may include pulling the handle of the steam applicator away from the steam conduit. Some embodiments may require two or more distinct motions to remove a steam applicator, while allowing attachment of a steam applicator with only a single motion. By requiring two or more distinct motions to remove a steam applicator, unintended disengagement or loosening of the steam applicator during use of the steam appliance may be prevented. For example, the user may rotate the steam applicator in either direction about an end-to-end direction of the steam application when cleaning surfaces, and it may be beneficial to avoid having the steam conduit rotate as a result of the steam applicator rotations. By allowing connector portion 302 to rotate relative to handle 107, handle 107 can rotate without twisting steam conduit 110 and with loosening the engagement of the two threaded connectors. For purposes herein, loosening a connection is intended to include compromising a connection. For example, in some embodiments, a connection may become less than fully engaged such that the connection is at risk of disengaging, yet the connection may not permit perceptible movement of the two connected components relative to one another. In some embodiments, one or more rotation stops may be included to limit the rotation angle of the steam applicator in either rotation direction (e.g., clockwise and counterclockwise about an end-to-end direction of the steam applicator). In such an embodiment, the steam applicator is permitted to rotate a certain amount, for example by permitting connector portion 302 to rotate, but the steam applicator rotation is prevented from further rotations by the rotation stops. The rotation stops may include one or more tabs (not shown) protruding from an interior wall of handle 107 between stops 306 and 308. In some embodiments, the steam applicator is permitted to rotate 180 degrees in either direction, and in some embodiments, the steam applicator is permitted to rotate 360 degrees in either direction. The embodiments described above allow for a tool-free attachment and removal of steam applicators from the steam appliance. In some embodiments, however, a tool may be used. While embodiments described herein are directed to rotations of a steam applicator or a handle about an end-to-end direction of the steam application or the handle, in some embodiments, pitch and/or yaw rotations may be permitted as well. A universal joint may be used in addition to, or instead of, the structures described herein. For purposes herein, the terms connect, connected, connection, attach, attached and attachment refer to direct connections and attachments, indirect connections and attachments, and operative connections and attachments. For example, steam applicator 102 is considered to be connected to steam conduit 110 even though steam applicator is directly connected to handle 107 which is, in turn, connected to steam conduit 110. Also for purposes herein, the terms connectable, attachable, removable, etc. refer both to components which can be connected, attached, removed, etc., and also refer to components which are connected, attached and removed. For ease of understanding, and without limiting the scope of the invention, the embodiments to which this disclosure is addressed are described above particularly in connection with a handheld portable steam appliance. It should be appreciated, however, that the present invention can be embodied in other types of steam appliances. Additionally, while the steam applicators described above employ steam pocket technology, other types of steam applicators may be used in conjunction with embodiments disclosed herein. Having thus described several aspects of at least one embodiment of this invention, it is to be appreciated various alterations, modifications, and improvements will readily occur to those skilled in the art. Such alterations, modifications, and improvements are intended to be part of this disclosure, and are intended to be within the spirit and scope of the invention. Accordingly, the foregoing description and drawings are by way of example only. | 1 | < 0.1% |
| BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWING FIG. 1 is a diagram schematically illustrating steps of mounting a semiconductor chip to a printed substrate according to one embodiment of the present invention; FIG. 2 is a schematic diagram illustrating a part of a printed substrate manufacturing equipment according to one embodiment of the present invention, that is, a part configured to deliver a film to be used as an underfill to a film carrying jig; and FIG. 3 is a schematic diagram illustrating a part of the printed substrate manufacturing equipment according to one embodiment of the present invention, that is, a part configured to apply the film to be used as the underfill to the printed substrate. INCORPORATION BY REFERENCE The present application claims priority from Japanese Application P2011-067147 filed on Mar. 25, 2011, the content of which is hereby incorporated by reference into this application. BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to printed substrate manufacturing equipment and manufacturing method, and more particularly relates to printed substrate manufacturing equipment and manufacturing method favorably used to mount a semiconductor chip onto a printed substrate. 2. Description of the Related Art In flip chip bonding in a printed substrate, a solder ball is adhered to a connection pad which is formed on the printed substrate and a semiconductor chip is mounted on the substrate via the solder ball. When the semiconductor chip is mounted on the printed substrate by the above-mentioned flip chip bonding method, a gap G is formed between the semiconductor chip and the printed substrate in accordance with the height of the solder ball which is adhered to the connection pad. Therefore, such a problem may occur that the supporting force of the semiconductor chip is reduced and hence a crack is generated in a solder ring part of the solder ball. In particular, when the temperature is greatly changed, thermal stress may be exerted on the solder ball and the crack may be generated in the solder ball due to the thermal stress because thermal expansion coefficients of the semiconductor chip and the printed substrate are different from each other. Thus, it has been practiced so far to inject an underfill liquid which is a liquid substance into the gap G generated between the semiconductor chip and the printed substrate by using a dispenser in order to stably support the semiconductor chip as disclosed, for example, in Japanese Patent Application Laid-Open No. 2010-118634. Since the underfill liquid is injected into the gap G, it is desirable to prevent the liquid from leaking to the outside and hence a spill prevention dam is formed on an edge of the board. In a printed substrate described in Japanese Patent Application Laid-Open No. 2010-118634, a dispenser is used to form a spill prevention dam. Hitherto, a space between respective bumps has been wide enough to use the dispenser. However, the space between the bumps is reduced as the chip is refined and it becomes difficult to inject the underfill liquid by using the dispenser. Thus, formation of the underfill is difficult, which makes it also difficult to prevent generation of a crack due to thermal stress exerted between the semiconductor chip and the substrate. Thus, a substitutive method for the method of injecting the underfill liquid using the dispenser is searched for. BRIEF SUMMARY OF THE INVENTION The present invention has been made in view of the drawbacks of the above mentioned related art and an object of the present invention is to fix a printed substrate and a semiconductor chip to each other by filling a gap between them so as to obtain the same effect as that obtained when an underfill liquid is used. Another object is to implement a highly accurate printed substrate that prevents generation of a crack. In order to solve the above mentioned problems, the present invention provides a printed substrate manufacturing method of forming solder bumps on a plurality of electrode parts of a printed substrate and loading a semiconductor chip on the printed substrate via the plurality of solder bumps, including preparing a thermoplastic film to be used as an underfill that covers a surface of the printed substrate on which the solder bumps are formed, wherein parts of the film corresponding to the solder bumps are removed and a peripheral edge of a part of the film on which the semiconductor chip will be loaded has a protruded form, covering the printed substrate with the film and thereafter applying the film onto the board, loading the semiconductor chip on the printed substrate and carrying the board into a reflow furnace and applying heat and pressure to fuse the solder bumps in the reflow furnace. In the above mentioned printed substrate manufacturing method, preferably, in preparing the film, after the film which is in a rolled-up state has been cut into a section of a predetermined size, the film so cut is carried to a film drilling unit using a film carrying jig, drilling is performed on a part of the film corresponding to each solder bump formed on the printed substrate by the film drilling unit, and then the film is inverted together with the film carrying jig. In order to solve the above mentioned problems, the present invention also provides a printed substrate manufacturing equipment, including a film supply unit on which a thermoplastic film to be used as an underfill is wound in roll, a film drilling unit for drilling a part of the film supplied from the film supply unit corresponding to the position of a solder bump formed on a printed substrate, a film inversion unit for inverting the film together with a film carrying jig that holds the film and a film bonding unit for bonding the inverted film onto the printed substrate, wherein the film bonding unit includes an upper table for holding the inverted film carrying jig and film, a lower table on which the printed substrate is placed and which includes a heater for heating the printed substrate, and a driving device for vertically moving the upper table and the lower table. Preferably, the above mentioned printed substrate manufacturing device further includes a reflow furnace into which a semiconductor chip which is loaded on the printed substrate to which the film has been bonded by the film bonding unit is carried to fuse the solder bump to fix the semiconductor chip to the printed substrate. DETAILED DESCRIPTION OF THE INVENTION Printed substrate manufacturing equipment and manufacturing method according to the present invention will be described with reference to the accompanying drawings. FIG. 1 is a diagram for describing one embodiment of a manufacturing method for a printed substrate 33 according to the present invention, illustrating respective steps of mounting a semiconductor chip 41 to the printed substrate 33. Although not illustrated in FIG. 1, solder bumps 39 are printed on a surface of the printed substrate 33 by using a solder ball printer and reflow soldering is performed to fix the bumps onto the surface of the printed substrate 33 in a pre-process of manufacturing. As illustrated in portion (a) of FIG. 1, the printed substrate 33 with the solder bumps 39 formed is carried into an underfill formation unit and is loaded on a lower table 34 (step S1). When the printed substrate 33 is loaded on the lower table 34, an underfill film (hereinafter, referred to as a film as the case may be) 30 on which drilling is performed in advance by a CVD (Chemical Vapor Deposition) device after the form of each solder bump 39 is supplied from a not-illustrated underfill film supply device. A protrusion (protruded part) 40 is formed on an end (for example, a peripheral edge) of the film 30. The protrusion 40 is formed so as to prevent the semiconductor chip 41 from moving on the printed substrate 33 regardless of application of vibration or the like to the printed substrate 33, when it is intended to move the semiconductor chip 41 in a state that is loaded on the printed substrate 33. The film 30 is 5 to 20 ?m in thickness and thermoplastic. The film 30 is made adhesive with heat to adhere the semiconductor chip 41 to the printed substrate 33. Marks for alignment are made on the film 30 and the printed substrate 33. An underfill film formation unit (for example, a film bonding device) 50 includes an imaging camera (for example, a two-field camera with upper and lower fields) 32 for detecting these marks and takes a picture of the position of each mark by the camera 32. The picture that the camera 32 has taken is sent to a not-illustrated control unit and is subjected to image processing by the control unit. Then, an amount of misalignment between the mark positions is obtained and a lower table 34 is horizontally moved to align the film 30 with the printed substrate 33. After alignment of the film 30 with the printed substrate 33 has been completed as illustrated in portion (b) of FIG. 1, the film 30 is lowered toward the surface of the printed substrate 33. Then, the printed substrate 33 is covered with the film 30 except parts corresponding to the solder bumps 39 (step S2). The semiconductor chip 41 is loaded on the solder bumps 39 after the printed substrate 33 has been covered with the film 30 as illustrated in portion (c) of FIG. 1 (step S3). Pictures of alignment marks on the semiconductor chip 41 and the solder bumps 39 are taken by the camera 32 also when the semiconductor chip 41 is to be aligned with the solder bumps 39. Then, an amount of misalignment between them is measured as in the case in alignment of the film 30 with the printed substrate 33 and a grip of the semiconductor chip 41 is horizontally moved in accordance with the amount of misalignment to align the semiconductor chip 41 with the solder bumps 39. If the printed substrate 33 is moved after the semiconductor chip 41 has been mounted on it, the possibility of occurrence of misalignment will be increased because the semiconductor chip 41 is simply placed on the solder bumps 39. Thus, the protruded part is formed on the end of the film 30 on the side on which the semiconductor chip 41 is to be loaded. As an alternative, the protruded part may be formed when drilling is performed on the film 30. After the semiconductor chip 41 has been mounted on the printed substrate 33 and a mounted state thereof has been inspected, the printed substrate 33 is carried to a reflow furnace. The underfill film 30 is pressed downward in a direction of an arrow in the reflow furnace as illustrated in portion (d) of FIG. 1. Heating is performed simultaneously with pressing. The printed substrate 33 and the semiconductor chip 41 are adhered and fixed to each other by heating and pressing (HP) the film 30 (step S4). After fixing of the semiconductor chip 41 onto the printed substrate 33 has been completed, the printed substrate 33 is carried to a process of inspection. FIG. 2 illustrates a forming device 45 for the underfill film (film) 30. In an example illustrated in FIG. 2, the film 30 is formed as a sheet-shaped roll. A film roll 11 includes a cover film 12 and the underfill film 30. The cover film 12 and the underfill film 30 are laminated in order from within. A guide roll 13 is disposed below the film roll 11 in order to carry the film 30 from the film roll 11 onto a carrying surface. The guide roll 13 is used to peel off the cover film 12. The peeled-off cover film 12 is taken up on a take-up roll 14 which is disposed adjacent to the film roll 11. Drive units for the film roll 11 and the take-up roll 14 include a not-illustrated torque adjuster respectively, for adjusting torque in accordance with the residual quantity of the film 30. The torque is adjusted by the torque adjuster, by which it is allowed to carry the film 30 in a state that its tension is maintained constant. A leading end holding member 15 and a trailing end holding member 16 for carrying the film 30 in a state that predetermined areas of the leading and trailing ends of the film 30 are sucked and adsorbed to them are disposed under the guide roll 13. A vacuum chamber is disposed in the leading end holding member 15 and an adsorption hole is formed in its upper surface. The vacuum chamber is connected to a not-illustrated vacuum pump. When the vacuum pump is driven, the leading end of the film is sucked and adsorbed to the upper surface of the leading end holding member 15. That is, the film 30 is held on the leading end holding member 15 by using a vacuum adsorption mechanism. The leading end holding member 15 is supported on a movable part 21 of a ball screw 20 which is disposed under the leading end holding member 15. The ball screw 20 is directly connected to a servo motor 19. The leading end holding member 15 which is supported on the movable part 21 of the ball screw 20 is moved in a lateral direction (a film carrying direction) by driving the servo motor 19. An air cylinder 17 is connected to the movable part 21. The air cylinder 17 is allowed to carry the leading end of the film 30 to a position where the film 30 is adjacent to one of a pair of pressing rollers 23 that configure a pressing unit for pressing the film 30. A vacuum chamber is disposed in the trailing end holding member 16 and an adsorption hole is formed in its upper surface as in the case of the leading end holding member 15. A groove which extends in a width direction is formed in the member 16. The groove is also used as a cutter pedestal when the film 30 will be cut in the width direction by a cutter mechanism 18. The cutter mechanism 18 is disposed above the trailing end holding member 16 and is configured to be moved in the width direction by a rodless cylinder or the like. The cutter mechanism 18 is used to cut the film 30 in the width direction. Since the movable part 21 of the ball screw 20 supports the leading end holding member 15, the film 30 is carried with accuracy. In addition, since a coupling member 22 is rotated by driving a rotary actuator disposed on the movable part 21, it is allowed to retreat the trailing end holding member 16 downward from the film carrying surface. Each pressing roller 23 is configured by covering an outer periphery of a metal roll with highly heat-resistant rubber (silicon rubber or the like) so as to have a thickness of about 1.2 mm. When a voltage is applied to the film 30 from an electrode 26 included in a static electricity generator 28, the pressing roller 23 holds the film 30 on its surface by electrostatic adsorption. Therefore, if the rubber that covers the outer peripheral of the roller 23 is silicon rubber, its electric resistance will be increased. However, since the outer periphery covering rubber has such a thin thickness as about 1.2 mm, its influence on the electrostatic adsorption is little. It goes without saying that the effect of electrostatic adsorption will be increased by using heat-resistant conductive rubber. The pair of pressing rollers 23 are vertically disposed so as to pinch a film carrying jig 24 which is carried on a carrier roller 25 from above and from below. A not-illustrated air cylinder is coupled to each of the vertically disposed pair of pressing rollers 23 and the pressing rollers 23 are vertically moved by driving the air cylinder. Here, a metal part of each pressing roller 23 is grounded. Next, a film bonding operation will be described. In preparation for bonding of the film 30, the film 30 is manually drawn out from the film roll 11 and is delivered to the guide roll 13. The guide roll 13 peels off the cover film 12 as described above. The peeled-off cover film 12 is taken up on the take-up roll 14. The remaining film 30 is drawn out until it reaches the leading end of the trailing end holding member 16 and its rear surface side is sucked and adsorbed to the leading end holding member 15 and the trailing end holding member 16. In the above mentioned case, a motor which is the drive unit connected to the film roll 11 and the take-up roll 14 is operated to exert a constant tension on the film 30. In the above-mentioned state, the groove part in the trailing end holding member 16 is positioned such that a cutting blade of the cutter mechanism 18 passes along it. Then, the cutter mechanism 18 is moved in the width direction to cut the film 30. When cutting of the film 30 has been completed, sucking and adsorbing force of the trailing end holding member 16 that has adsorbed the film 30 so far is released and a cut-off piece of the film 30 is discarded. In the above-mentioned case, the film 30 is sucked and adsorbed to the leading end holding member 15 in a state that the leading end of the film 30 is protruded beyond the leading end of the leading end holding member 15 by about 10 mm, by which preparation for the operation of bonding the film 30 is completed. In a state that preparation for application of the film 30 has been completed, both the pressing rollers 23 which are positioned on and under the substrate carrying surface are at upper positions and are rotating in a substrate carrying direction in a state that the rollers 23 are heated by built-in heaters. An upper surface of the lower pressing roller 23 is in contact with the film carrying jig 24 to carry the film carrying jig 24 from the left side toward the right side in an example illustrated in FIG. 2. In the operation of bonding the film 30, first, the servo motor 19 is operated to move the movable part 21 of the ball screw 20 to the neighbourhood of the pressing rollers 23. When a rotary actuator disposed on the trailing end holding member 16 is driven, the coupling member 22 rotates to retreat the trailing end holding member 16 downward from the film carrying surface. Next, the air cylinder 17 is operated to move the leading end holding member 15 until the leading end of the film 30 reaches a position around the center of the upper surface of the upper pressing roller 23. After the film 30 has been situated at the above-mentioned predetermined position, a high voltage is applied from a not-illustrated static electricity generation source to the electrode 26. In the above mentioned case, the leading end of the film 30 is situated between the electrode 26 and the upper pressing roller 23. Thus, a film leading end part which is protruded beyond the leading end holding member 15 is charged and adsorbed to the grounded upper pressing roller 23. The upper pressing roller 23 is rotated in a carrying direction of the film carrying jig 24 and carries the adsorbed film 30 downward (toward the film carrying jig 24). When sucking and adsorbing force of the leading end holding member 15 is released, the film 30 is carried toward the printed substrate 33 with rotation of the upper pressing roller 23. Then, the air cylinder 17 and the movable part 21 are operated to return the leading end holding member 15 that has delivered the film 30 to the pressing roller 23 to a position under the guide roll 13. At the same time, the rotary actuator is driven to rotate the coupling member 22 so as to also return the retreated trailing end holding member 16 to the position of the film carrying surface. After the film 30 has been carried to a position (where the film 30 is brought into contact with the surface of the carried film carrying jig 24) directly under the upper pressing roller 23, rotation of the pressing rollers 23 is stopped. Then, the film 30 which is positioned above the leading end holding member 15 and the trailing end holding member 16 is held in a state that it is sucked and adsorbed to the respective holding members 15 and 16 at its leading and trailing ends. The cutter mechanism 18 is driven to cut the film 30 in the width direction. In the above-mentioned case, positions of the cutter mechanism 18 and the trailing end holding member 16 are adjusted such that the cut film 30 has a length which is long enough to be bonded to the printed substrate 33. As an alternative, the cutter mechanism 18, the leading end holding member 15 and the trailing end holding member 16 may be operated in synchronization with carrying of the film 30 without stopping the rotation of the pressing rollers 23 so as to cut the film 30 in an adsorptive-held state. The film carrying jig 24 is formed longer than the printed substrate 33 to which the film 30 will be actually bonded. After the film 30 has been cut to a predetermined length, the carrier roller 25 carries the film carrying jig 24 to a film bonding position (where the film will be bonded to the substrate). After the film carrying jig 24 has reached the film bonding position, a heightwise position of the lower pressing roller 23 is left as it is and only the upper pressing roller 23 is lowered (toward the lower pressing roller 23). As a result, the film 30 comes into contact with the surface of the film carrying jig 24 and then pressing is started. In the above-mentioned process, the film 30 is carried to the pressing rollers 23 simultaneously with carrying of the film carrying jig 24. However, since the trailing end holding member 16 is also moved toward the pressing rollers 23 in synchronization with carrying of the film 30, the tension exerted on the film is made constant. The film 30 is gradually pressed onto the film carrying jig 24 with rotation of the pressing rollers 23. On the other hand, when the trailing end holding member 16 to which the film 30 is adsorbed reaches the vicinity of the pressing rollers 23, a high voltage is applied to the electrode 26 of the static electricity generator 28 as in the case that the leading end of the film 30 is delivered from the leading end holding member 15 to the pressing roller 23. When the high voltage is applied to the electrode 26, the trailing end of the film 30 which is situated under the electrode 26 is charged and electrostatically adsorbed to the pressing roller 23. After the trailing end of the film 30 has been wholly delivered to the pressing roller 23, the sucking and adsorbing force of the trailing end holding member 16 is released. Then, the coupling member 22 is rotated to retreat the member 16 downward. On the other hand, the leading end holding member 15 is in a state that the leading end of a film 30 to be bonded next is sucked and adsorbed to it and is moved to the vicinity of the pressing roller 23 in a state that the film 30 is stuck and adsorbed to it. Since the trailing end of the film 30 is electrostatically adsorbed to the pressing roller 23, close contact of the film 30 with the film carrying jig 24 is allowed without letting the film 30 hang down from the surface of the film carrying jig 24. Thus, a film-bonding part may not be crumpled and any bubble may not enter it in pressing. Since the lower pressing roller 23 is grounded, the static electricity of the film 30 which is held on the upper pressing roller 23 is discharged when the film 30 comes into contact with the film carrying jig 24. After the entire surface of the film 30 has been pressed onto the surface of the film carrying jig 24, the upper pressing roller 23 is moved upward to deliver the next film 30 from the leading end holding member 15 to the upper pressing roller 23. After the leading end of the film 30 has been delivered to the upper pressing roller 23, the leading end holding member 15 moves to a position under the guide roll 13. At the same time, the trailing end holding member 16 which is in a retreated state is also returned to the position of the film carrying surface. As a result, a series of processes of the film bonding operation is completed. In the above mentioned embodiment, the leading and trailing ends of the film 30 are electrostatically adsorbed to the holding members 15 and 16 in order to deliver the film 30 to the pressing roller 23. As an alternative, the entire surface of the film 30 may be electrostatically charged to be adsorbed to the pressing roller 23. In addition, as a substitution for the vacuum adsorption mechanism which is used as the film holding mechanism included within the leading end holding member 15 and the trailing end holding member 16, an electrostatic adsorption holding mechanism may be used as in the case of the unit for making the film 30 adsorb to the pressing roller 23. The film 30 which is attached onto the film carrying jig 24 is sent to a not-illustrated drilling unit in which, then, drilling is performed on a part corresponding to the electrode part (the part corresponding to the part of forming the solder bump 39) on the printed substrate 33. Drilling is performed by a not-illustrated drilling machine. Before performing drilling, a protrusion is formed on an end of the film 30 by using a press machine. Owing to formation of the protrusion, the semiconductor chip 41 may not be moved with vibration or the like when the printed substrate 33 is to be moved simply by placing the semiconductor chip 41 on the printed substrate 30 without fixing it to the substrate. As an alternative, the protrusion may be formed when the film 30 is bonded onto the printed substrate 33. The drilled film 30 is carried to the film bonding device 50 in order to load the drilled film 30 on the printed substrate 33. FIG. 3 illustrates a schematic configuration of the film bonding device 50. In the film bonding device 50, the lower table 34 on which the printed substrate 33 will be loaded is disposed on a base 31. The lower table 34 includes a not-illustrated XY? table for moving the lower table 34 in a horizontal plane and an XY? table driving mechanism 36. Supports are disposed on four corners of the base 31 and an upper table support beam 37 for holding an upper table 35 is attached onto the supports. A driving device 38 for vertically moving the upper table 35 is disposed on the support beam 37. The upper table 35 is attached to the driving device 38. The two-field camera 32 with upper and lower fields is disposed between the upper table 35 and the lower table 34 to be horizontally movable. Before the film carrying jig 24 with the film 30 attached is carried into the film bonding device 50, a surface of the film 30 to be held is inverted together with the film carrying jig 24 by a not-illustrated inverting device. The film carrying jig 24 is carried into the film bonding device 50 in an inverted state. Then, the film carrying jig 24 is held under the upper table 35 which is disposed in opposition to the lower table 34 on which the printed substrate 33 is loaded with the film surface turned downward. In the above mentioned case, a negative pressure is applied to a not-illustrated surface of the upper table 35 to hold the film 30 under the upper table 35 by vacuum adsorption together with the film carrying jig 24. Pictures of alignment marks which are formed in advance on the surface of the film 30 and the surface of the printed substrate 33 are taken by the two-field camera 32 with upper and lower fields. A not-illustrated control unit performs image processing on the taken pictures to obtain an amount of misalignment between the alignment marks on the surfaces of the film 30 and the substrate 33. The lower table 34 is horizontally moved for alignment on the basis of the obtained misalignment amount. Since the lower table 34 includes a heater, it is allowed to heat the printed substrate 33 to a predetermined temperature. When the printed substrate 33 is loaded on the lower table 34, the heater is turned on to warm the printed substrate 33. After the pictures of the alignment marks have been taken, the two-field camera 32 with upper and lower fields is retreated from surfaces of the upper table 35 and lower table 34. At the completion of alignment, the table vertically driving mechanism 38 is operated to lower the upper table 35 with the film 30 supported. The film 30 is bonded onto the surface of the printed substrate 33 while applying a predetermined pressure onto the surface of the printed substrate 33. That is, heat and pressure are applied to temporarily fix the underfill film (film) 30 onto the surface of the printed substrate 33 except the electrode part of the printed substrate 33. In the above mentioned description, a process of forming the protrusion 40 on the end (the part corresponding to an end (for example, a peripheral edge) of the semiconductor chip) is performed before the process of drilling the film 30 is performed. As an alternative, the protrusion to which the end of the semiconductor chip 41 is fixed may be formed when performing the process of bonding the film 30 onto the printed substrate 33. At the completion of bonding of the film 30, the flow proceeds to a process of mounting the semiconductor chip 41 on the printed substrate 33. In mounting the semiconductor chip 41 on the printed substrate 33, the position of the electrode of the semiconductor chip 41 is measured in advance by using the camera 32. The semiconductor chip 41 is mounted on the surface of the printed substrate 33 with the underfill film 30 formed by using an existing chip mounter with robot hand. The printed substrate 33 with the semiconductor chip 42 mounted is carried into the reflow furnace in which, then, a soldering chip is fused to fixedly bond the semiconductor chip 42 to the printed substrate 33. Since the semiconductor chip 41 is not fixed to the printed substrate in carrying the substrate 33 into the reflow furnace, the protrusion 40 is formed on the end of the underfill film 30 to hold the end of the semiconductor chip 41 so as to avoid movement of the semiconductor chip 41. In the above mentioned embodiment, before the semiconductor chip is pressed onto the printed substrate, the underfill film is formed after the form of the printed substrate from which the electrode part is eliminated and the underfill film so formed is bonded onto the surface of the printed substrate to mount the semiconductor chip in a predetermined position, in place of an existing method of mounting a semiconductor chip on a printed substrate and then injecting an underfill liquid into between the printed substrate and the semiconductor chip. Owing to the above mentioned arrangement, it may become possible to cope with a reduction in space between electrodes which is caused by refinement. That is, it may become possible to firmly fix the semiconductor chip to the printed substrate regardless of presence of such a narrow space between the printed substrate and the semiconductor chip that a capillary phenomenon which is utilized when a liquefied underfill is used may not occur. According to the present invention, since the underfill is formed by a plastic film, it may become possible to fix the substrate and the semiconductor chip to each other so as to obtain the same effect as that obtained when an underfill liquid is used. In addition, since it may become possible to surely fix the semiconductor chip and the printed substrate to each other with the underfill film, it may become possible to avoid generation of a crack due to thermal stress or the like. | 1 | < 0.1% |
| CROSS-REFERENCE TO RELATED APPLICATIONS This application is a continuation of U.S. patent application Ser. No. 13/222,929, filed Aug. 31, 2011, (now granted as U.S. Pat. No. 8,512,657), which is a continuation-in-part of U.S. patent application Ser. No. 12/712,681, filed on Feb. 25, 2010, (now granted as U.S. Pat. No. 8,012,439), which claims priority to GB Patent Application Nos. 0903262.4, filed on Feb. 26, 2009, and 0922612.7, filed on Dec. 24, 2009, and this application is a continuation-in-part of U.S. patent application Ser. No. 13/203,631, filed on Aug. 26, 2011, (now granted as U.S. Pat. No. 8,608,820), as the national stage application of International Application No. PCT/GB2010/050347, filed on Feb. 26, 2010, which claims priority to GB Patent Application Nos. 0903262.4, filed on Feb. 26, 2009, and 0922612.7, filed on Dec. 24, 2009, all of which are incorporated herein by reference in their entireties. BRIEF DESCRIPTION OF THE DRAWINGS In order that the invention may be more fully understood, reference is made to the accompanying drawings wherein: FIG. 1 is a graph showing the size distributions of PM in the exhaust gas of a diesel engine. For comparison, a gasoline size distribution is shown at FIG. 4 of SAE 1999-01-3530; FIGS. 2A-C show schematic drawings of three embodiments of washcoated porous filter substrates according to the invention; FIG. 3 is a schematic graph of mercury porosimetry relating the pore size distribution of a porous filter substrate, a porous washcoat layer and a porous filter substrate including a porous surface washcoat layer; FIG. 4 is a Table setting out a matrix of wallflow filter substrate pore size vs. washcoat loading indicating the suitability of the coated wallflow filter for use in a vehicular gasoline exhaust gas aftertreatment system; FIG. 5 is a graph showing the results of a Soot Loading Back Pressure study comparing backpressure against soot loading for 5.66 inch×6 inch SiC wallflow filters coated with two different oxidation catalyst washcoat loadings (g/in3) and a bare filter (all not according to the invention) with a Fe/beta zeolite selective catalytic reduction (SCR) catalyst (according to the invention) at a comparable washcoat loading; FIG. 6 is a graph comparing the backpressure in the same Soot Loading Back Pressure test for a Cu/SSZ-13 zeolite (a small pore zeolite) catalyst and a Fe/Beta zeolite (a large pore zeolite) SCR catalyst; and FIG. 7 is a bar chart comparing the particulate number emissions (particulate number per kilometer) from a 2.0 liter Euro 5 compliant light duty diesel vehicle fitted with standard diesel oxidation catalyst followed by a 3.0 liter SiC filter at 23 ?m nominal mean pore size coated with a Fe/Beta zeolite SCR catalyst for meeting the Euro 5/6 particle number emission limit of 6×1011 km?1 (UN/ECE Particulate Measurement Programme (PMP)) with the same system containing a bare filter. FIELD OF THE INVENTION The present invention relates to a filter for use in treating particulate matter (PM) in exhaust gas derived from any combustion process, such as from a compression ignition engine or from a positive ignition engine. In an embodiment, the filter is used to treat PM in exhaust gas derived from any combustion process where it is not possible to remove PM from the exhaust gas by build-up of PM (so-called cake filtration) or by a combination of depth filtration and cake filtration. The combustion process is typically that of a vehicular engine. In particular, an embodiment of the invention relates to a filter for use in treating PM derived from a vehicular positive ignition engine, particularly stoichiometrically operated positive ignition engines but also lean-burn positive ignition engines. Another embodiment of the invention relates to a filter for use in treating PM and oxides of nitrogen derived from a compression ignition engine. BACKGROUND OF THE INVENTION Positive ignition engines cause combustion of a hydrocarbon and air mixture using spark ignition. Contrastingly, compression ignition engines cause combustion of a hydrocarbon by injecting the hydrocarbon into compressed air and can be fuelled by diesel fuel, biodiesel fuel, blends of diesel and biodiesel fuels and compressed natural gas. Positive ignition engines can be fuelled by gasoline fuel, gasoline fuel blended with oxygenates including methanol and/or ethanol, liquid petroleum gas or compressed natural gas. Ambient PM is divided by most authors into the following categories based on their aerodynamic diameter (the aerodynamic diameter is defined as the diameter of a 1 g/cm 3 density sphere of the same settling velocity in air as the measured particle): (i) PM-10particles of an aerodynamic diameter of less than 10 ?m; (ii) Fine particles of diameters below 2.5 ?m (PM-2.5); (iii) Ultrafine particles of diameters below 0.1 ?m (or 100 nm); and (iv) Nanoparticles, characterised by diameters of less than 50 nm. Since the mid-1990's, particle size distributions of particulates exhausted from internal combustion engines have received increasing attention due to possible adverse health effects of fine and ultrafine particles. Concentrations of PM-10 particulates in ambient air are regulated by law in the USA. A new, additional ambient air quality standard for PM-2.5 was introduced in the USA in 1997 as a result of health studies that indicated a strong correlation between human mortality and the concentration of fine particles below 2.5 ?m. Interest has now shifted towards nanoparticles generated by diesel and gasoline engines because they are understood to penetrate more deeply into human lungs than particulates of greater size and consequently they are believed to be more harmful than larger particles, extrapolated from the findings of studies into particulates in the 2.5-10.0 ?m range. Size distributions of diesel particulates have a well-established bimodal character that correspond to the particle nucleation and agglomeration mechanisms, with the corresponding particle types referred to as the nuclei mode and the accumulation mode respectively (see FIG. 1). As can be seen from FIG. 1, in the nuclei mode, diesel PM is composed of numerous small particles holding very little mass. Nearly all diesel particulates have sizes of significantly less than 1 ?m, i.e. they comprise a mixture of fine, i.e. falling under the 1997 US law, ultrafine and nanoparticles. Nuclei mode particles are believed to be composed mostly of volatile condensates (hydrocarbons, sulfuric acid, nitric acid etc.) and contain little solid material, such as ash and carbon. Accumulation mode particles are understood to comprise solids (carbon, metallic ash etc.) intermixed with condensates and adsorbed material (heavy hydrocarbons, sulfur species, nitrogen oxide derivatives etc.) Coarse mode particles are not believed to be generated in the diesel combustion process and may be formed through mechanisms such as deposition and subsequent re-entrainment of particulate material from the walls of an engine cylinder, exhaust system, or the particulate sampling system. The relationship between these modes is shown in FIG. 1. The composition of nucleating particles may change with engine operating conditions, environmental condition (particularly temperature and humidity), dilution and sampling system conditions. Laboratory work and theory have shown that most of the nuclei mode formation and growth occur in the low dilution ratio range. In this range, gas to particle conversion of volatile particle precursors, like heavy hydrocarbons and sulfuric acid, leads to simultaneous nucleation and growth of the nuclei mode and adsorption onto existing particles in the accumulation mode. Laboratory tests (see e.g. SAE 980525 and SAE 2001-01-0201) have shown that nuclei mode formation increases strongly with decreasing air dilution temperature but there is conflicting evidence on whether humidity has an influence. Generally, low temperature, low dilution ratios, high humidity and long residence times favour nanoparticles formation and growth. Studies have shown that nanoparticles consist mainly of volatile material like heavy hydrocarbons and sulfuric acid with evidence of solid fraction only at very high loads. Contrastingly, engine-out size distributions of gasoline particulates in steady state operation show a unimodal distribution with a peak of about 60-80nm (see e.g. FIG. 4 in SAE 1999-01-3530). By comparison with diesel size distribution, gasoline PM is predominantly ultrafine with negligible accumulation and coarse mode. Particulate collection of diesel particulates in a diesel particulate filter is based on the principle of separating gas-borne particulates from the gas phase using a porous barrier. Diesel filters can be defined as deep-bed filters and/or surface-type filters. In deep-bed filters, the mean pore size of filter media is bigger than the mean diameter of collected particles. The particles are deposited on the media through a combination of depth filtration mechanisms, including diffusional deposition (Brownian motion), inertial deposition (impaction) and flow-line interception (Brownian motion or inertia). In surface-type filters, the pore diameter of the filter media is less than the diameter of the PM, so PM is separated by sieving. Separation is done by a build-up of collected diesel PM itself, which build-up is commonly referred to as filtration cake and the process as cake filtration. It is understood that diesel particulate filters, such as ceramic wallflow monoliths, may work through a combination of depth and surface filtration: a filtration cake develops at higher soot loads when the depth filtration capacity is saturated and a particulate layer starts covering the filtration surface. Depth filtration is characterized by somewhat lower filtration efficiency and lower pressure drop than the cake filtration. WO 03/011437 discloses a gasoline engine having an exhaust system comprising means for trapping PM from the exhaust gas and a catalyst for catalysing the oxidation of the PM by carbon dioxide and/or water in the exhaust gas, which catalyst comprising a supported alkali metal. The means for trapping PM is suitable for trapping PM of particle range 10-100 nm, and can be a wallflow filter made from a ceramic material of appropriate pore size such as cordierite coated with the catalyst, a metal oxide foam supporting the catalyst, a wire mesh, a diesel wallflow filter designed for diesel applications, an electrophoretic trap or a thermophoretic trap (see e.g. GB-A-2350804). WO 2008/136232 A1 discloses a honeycomb filter having a cell wall composed of a porous cell wall base material and, provided on its inflow side only or on its inflow and outflow sides, a surface layer and satisfying the following requirements (1) to (5) is used as a diesel particulate filter: (1) the peak pore diameter of the surface layer is identical with or smaller than the average pore diameter of the cell wall base material, and the porosity of the surface layer is larger than that of the cell wall base material; (2) with respect to the surface layer, the peak pore diameter is from 0.3 to less than 20 ?m, and the porosity is from 60 to less than 95% (measured by mercury penetration method); (3) the thickness (L1) of the surface layer is from 0.5 to less than 30% of the thickness (L2) of the cell wall; (4) the mass of the surface layer per filtration area is from 0.01 to less than 6 mg/cm 2; and (5) with respect to the cell wall base material, the average pore diameter is from 10 to less than 60 ?m, and the porosity is from 40 to less than 65%. See also SAE paper no. 2009-01-0292. Other techniques suggested in the art for separating gasoline PM from the gas phase include vortex recovery. In the United States, no similar emission standards have been set. However, the State of California Air Resources Board (CARB) recently published a paper entitled Preliminary Discussion PaperAmendments to California's Low-Emission Vehicle [LEV] Regulations for Criteria PollutantsLEV III (release date 8 th Feb. 2010) in which a new PM standard of between 2 and 4 mg PM/mile (1.25-2.50 mg PM/km (currently 10 mg PM/mile (6.25 mg PM/km))) is proposed, the paper commenting that: Staff has received input from a number of manufacturers suggesting that a standard of 3 mg PM/mile (1.88 mg PM/km) can be met for gasoline direct injection engines without requiring the use of particulate filters. Additionally, the paper states that since the PM mass and count emissions appear to be correlated: Although a mandatory number standard is not being considered at this time, an optional PM number standard of about 1012 particles/mile [6.2511 particles/km] is being considered (which could be chosen by manufacturers instead of the PM mass standard). However, since neither the PM standard nor the PM number standard has been set by CARB yet, it is too soon to know whether particulate filtration will be necessary for the Californian or US vehicle market generally. It is nevertheless possible that certain vehicle manufacturers will choose filters in order to provide a margin of safety on any positive ignition engine design options selected to meet whatever standards are eventually set. The new Euro 6 emission standard presents a number of challenging design problems for meeting gasoline emission standards. In particular, how to design a filter, or an exhaust system including a filter, for reducing the number of PM gasoline (positive ignition) emissions, yet at the same time meeting the emission standards for non-PM pollutants such as one or more of oxides of nitrogen (NO x), carbon monoxide (CO) and unburned hydrocarbons (HC), all at an acceptable back pressure, e.g. as measured by maximum on-cycle backpressure on the EU drive cycle. It is envisaged that a minimum of particle reduction for a three-way catalysed particulate filter to meet the Euro 6 PM number standard relative to an equivalent flowthrough catalyst is ?50%. Additionally, while some backpressure increase for a three-way catalysed wallflow filter relative to an equivalent flowthrough catalyst is inevitable, in our experience peak backpressure over the MVEG-B drive cycle (average over three tests from fresh) for a majority of passenger vehicles should be limited to <200 mbar, such as <180 mbar, <150 mbar and preferably <120 mbar e.g. <100 mbar. PM generated by positive ignition engines has a significantly higher proportion of ultrafine, with negligible accumulation and coarse mode compared with that produced by diesel (compression ignition) engines, and this presents challenges to removing it from positive ignition engine exhaust gas in order to prevent its emission to atmosphere. In particular, since a majority of PM derived from a positive ignition engine is relatively small compared with the size distribution for diesel PM, it is not practically possible to use a filter substrate that promotes positive ignition PM surface-type cake filtration because the relatively low mean pore size of the filter substrate that would be required would produce impractically high backpressure in the system. Furthermore, generally it is not possible to use a conventional wallflow filter, designed for trapping diesel PM, for promoting surface-type filtration of PM from a positive ignition engine in order to meet relevant emission standards because there is generally less PM in positive ignition exhaust gas, so formation of a soot cake is less likely; and positive ignition exhaust gas temperatures are generally higher, which can lead to faster removal of PM by oxidation, thus preventing increased PM removal by cake filtration. Depth filtration of positive ignition PM in a conventional diesel wallflow filter is also difficult because the PM is significantly smaller than the pore size of the filter medium. Hence, in normal operation, an uncoated conventional diesel wallflow filter will have a lower filtration efficiency when used with a positive ignition engine than a compression ignition engine. Another difficulty is combining filtration efficiency with a washcoat loading, e.g. of catalyst for meeting emission standards for non-PM pollutants, at acceptable backpressures. Diesel wallflow particulate filters in commercially available vehicles today have a mean pore size of about 13 ?m. However, we have found that washcoating a filter of this type at a sufficient catalyst loading such as is described in US 2006/0133969 to achieve required gasoline (positive ignition) emission standards can cause unacceptable backpres sure. In order to reduce filter backpressure it is possible to reduce the length of the substrate. However, there is a finite level below which the backpressure increases as the filter length is reduced. Suitable filter lengths for filters according to embodiments of the present invention are from 2-12 inches long, preferably 3-6 inches long. Cross sections can be circular and in our development work we have used 4.66 and 5.66 inch diameter filters. However, cross-section can also be dictated by space on a vehicle into which the filter is required to fit. So for filters located in the so-called close coupled position, e.g. within 50 cm of the engine exhaust manifold where space is at a premium, elliptical or oval filter cross sections can be contemplated. As would be expected, backpressure also increases with washcoat loading and soot loading. There have been a number of recent efforts to combine three-way catalysts with filters for meeting the Euro 6 emission standards. U.S. 2009/0193796 discloses a three-way conversion catalyst coated onto a particulate trap. The Examples disclose e.g. a soot filter having a catalytic material prepared using two coats: an inlet coat and an outlet coat. The mean pore size of the soot filter substrate used is not mentioned. The inlet coat contains alumina, an oxygen storage component (OSC) and rhodium all at a total loading of 0.17 g in ?3; the outlet coat includes alumina, an OSC and palladium, all at a total loading of 0.42 g in?3. However, we believe that the three-way catalyst washcoat loading of <0.5 g in?3 provides insufficient three-way activity to meet the required emission standards alone, i.e. the claimed filter appears to be designed for inclusion in a system for location downstream of a three-way catalyst comprising a flowthrough substrate monolith. WO 2009/043390 discloses a catalytically active particulate filter comprising a filter element and a catalytically active coating composed of two layers. The first layer is in contact with the in-flowing exhaust gas while the second layer is in contact with the out-flowing exhaust gas. Both layers contain aluminium oxide. The first layer contains palladium, the second layer contains an oxygen-storing mixed cerium/zirconium oxide in addition to rhodium. In Examples, a wallflow filter substrate of unspecified mean pore size is coated with a first layer at a loading of approximately 31 g/l and a second layer at a loading of approximately 30 g/l. That is, the washcoat loading is less than 1.00 g in ?3. For a majority of vehicle applications, this coated filter is unlikely to be able to meet the required emission standards alone. A difficulty in coating a filter with a catalyst composition is to balance a desired catalytic activity, which generally increases with washcoat loading, with the backpressure that is caused by the filter in use (increased washcoat loading generally increases backpressure) and filtration efficiency (backpressure can be reduced by adopting wider mean pore size and higher porosity substrates at the expense of filtration efficiency). SUMMARY OF THE INVENTION According to an embodiment of the invention, we have now discovered, very surprisingly, that it is possible to adapt a relatively porous particulate filtersuch as a particulate filter adapted for a diesel applicationso that it can be used to trap e.g. ultrafine positive ignition PM at an acceptable pressure drop and backpressure. In particular, our inventors have determined that a washcoat that hinders access of the PM to a porous structure of a filter substrate can beneficially promote surface filtration substantially at the expense of depth filtration to the extent that cake filtration of PM derived from a positive ignition engine is promoted or enhanced. Early indications suggest that positive ignition PM combusts in oxygen at lower temperatures than diesel PM. Investigations are continuing, but the invention makes use of this observation by providing means for trapping the positive ignition PM for combustion in oxygen. According to one aspect, the invention provides a filter for filtering particulate matter (PM) from exhaust gas emitted from an engine, such as a compression ignition engine or a positive ignition engine, e.g. a vehicular positive ignition engine such as a stoichiometrically-operated positive ignition engine or a lean burn positive ignition engine, which filter comprising a porous substrate having inlet surfaces and outlet surfaces, wherein the inlet surfaces are separated from the outlet surfaces by a porous structure containing pores, e.g. surface pores, of a first mean pore size, wherein the porous substrate is coated with a washcoat comprising a plurality of solid particles wherein the porous structure of the washcoated porous substrate contains pores of a second mean pore size, and wherein the second mean pore size is less than the first mean pore size. DETAILED DESCRIPTION OF THE INVENTION Early indications are that at least some embodiments of the present invention directed to use with a positive ignition engine are capable of reducing positive ignition engine particle number emissions by >30% such as >50% e.g. >80% or even >90% at acceptable backpressure. Mean pore size can be determined by mercury porosimetry. It will be understood that the benefit of the invention is substantially independent of the porosity of the substrate. Porosity is a measure of the percentage of void space in a porous substrate and is related to backpressure in an exhaust system: generally, the lower the porosity, the higher the backpressure. However, the porosity of filters for use in the present embodiments of the invention are typically >40% or >50% and porosities of 45-75% such as 50-65% or 55-60% can be used with advantage. The mean pore size of the washcoated porous substrate is important for filtration. So, it is possible to have a porous substrate of relatively high porosity that is a poor filter because the mean pore size is also relatively high. The porous substrate can be a metal, such as a sintered metal, or a ceramic, e.g. silicon carbide, cordierite, aluminium nitride, silicon nitride, aluminium titanate, alumina, cordierite, mullite e.g., acicular mullite (see e.g. WO 01/16050), pollucite, a thermet such as Al 2O3/Fe, Al2O3/Ni or B4C/Fe, or composites comprising segments of any two or more thereof. In a preferred embodiment, the filter is a wallflow filter comprising a ceramic porous filter substrate having a plurality of inlet channels and a plurality of outlet channels, wherein each inlet channel and each outlet channel is defined in part by a ceramic wall of porous structure, wherein each inlet channel is separated from an outlet channel by a ceramic wall of porous structure. This filter arrangement is also disclosed in SAE 810114, and reference can be made to this document for further details. Alternatively, the filter can be a foam, or a so-called partial filter, such as those disclosed in EP 1057519 or WO 01/080978. Reasons motivating the coating of a wallflow filter for a diesel application are typically different from that of embodiments of the present invention directed to use with a positive ignition engine. In diesel applications, a washcoat is employed to introduce catalytic components to the filter substrate, e.g. catalysts for oxidising NO to NO 2, yet a significant problem is to avoid backpressure issues as soot is accumulated. Accordingly, a balance is struck between the desired catalytic activity and acceptable backpressure. Contrastingly, a primary motivating factor for washcoating a porous substrate for use of embodiments of the present invention directed to use with a positive ignition engine is to achieve both a desired filtration efficiency and catalytic activity. In one embodiment, the first mean pore size e.g. of surface pores of the porous structure of the porous filter substrate is from 8 to 45 ?m, for example 8 to 25 ?m, 10 to 20 ?m or 10 to 15 ?m. In particular embodiments, the first mean pore size is >18 ?m such as from 15 to 45 ?m, 20 to 45 ?m e.g. 20 to 30 ?m, or 25 to 45 ?m. In embodiments, the filter has a washcoat loading of >0.25 g in ?3, such as >0.5g in?3 or ?0.80 g in?3, e.g. 0.80 to 3.00 g in?3. In preferred embodiments, the washcoat loading is >1.00 g in?3 such as ?1.2 g in?3, >1.5 g in?3, >1.6 g in?3 or >2.00 g in ?3 or for example 1.6 to 2.4 g in?3. In particular combinations of filter mean pore size and washcoat loading the filter combines a desirable level of particulate filtration and catalytic activity at acceptable backpressure. In a first, preferred embodiment, the filter comprises a surface washcoat, wherein a washcoat layer substantially covers surface pores of the porous structure and the pores of the washcoated porous substrate are defined in part by spaces between the particles (interparticle pores) in the washcoat. That is, substantially no washcoat enters the porous structure of the porous substrate. Methods of making surface coated porous filter substrates include introducing a polymer, e.g. poly vinyl alcohol (PVA), into the porous structure, applying a washcoat to the porous filter substrate including the polymer and drying, then calcining the coated substrate to burn out the polymer. A schematic representation of the first embodiment is shown in FIG. 2A. Methods of coating porous filter substrates are known to the skilled person and include, without limitation, the method disclosed in WO 99/47260, i.e. a method of coating a monolithic support, comprising the steps of (a) locating a containment means on top of a support, (b) dosing a pre-determined quantity of a liquid component into said containment means, either in the order (a) then (b) or (b) then (a), and (c) by applying pressure or vacuum, drawing said liquid component into at least a portion of the support, and retaining substantially all of said quantity within the support. Such process steps can be repeated from another end of the monolithic support following drying of the first coating with optional firing/calcination. In this first embodiment, an average interparticle pore size of the porous washcoat is 5.0 nm to 5.0 ?m, such as 0.1-1.0 ?m. A D90 of solid washcoat particles in this first, surface coating embodiment can be greater than the mean pore size of the porous filter substrate and can be in the range 10 to 40 ?m, such as 15 to 30 ?m or 12 to 25 ?m. D90 as used herein defines the particle size distribution in a washcoat wherein 90% of the particles present have a diameter within the range specified. Alternatively, in embodiments, the mean size of the solid washcoat particles is in the range 1 to 20 ?m. It will be understood that the broader the range of particle sizes in the washcoat, the more likely that washcoat may enter the porous structure of the porous substrate. The term substantially no washcoat enters the porous structure of the substrate should therefore be interpreted accordingly. According to a second embodiment, the washcoat can be coated on inlet and/or outlet surfaces and also within the porous structure of the porous substrate. We believe that a surface coating around a pore opening at the inlet and/or outlet surfaces, thereby narrowing the e.g. surface pore size of a bare filter substrate, promotes interaction of the gas phase including PM without substantially restricting the pore volume, so not giving rise to significant increases in back pressure. That is, the pores at a surface of the porous structure comprise a pore opening and the washcoat causes a narrowing of substantially all the pore openings. A schematic representation of the second embodiment is shown in FIG. 2B. Methods of making a filter according to the second embodiment can involve appropriate formulation of the washcoat known to the person skilled in the art including adjusting viscosity and surface wetting characteristics and application of an appropriate vacuum following coating of the porous substrate (see also WO 99/47260). In the first and second embodiments, wherein at least part of the washcoat is coated on inlet and/or outlet surfaces of the porous substrate, the washcoat can be coated on the inlet surfaces, the outlet surfaces or on both the inlet and the outlet surfaces. Additionally either one or both of the inlet and outlet surfaces can include a plurality of washcoat layers, wherein each washcoat layer within the plurality of layers can be the same or different, e.g. the mean pore size in a first layer can be different from that of a second layer. In embodiments, washcoat intended for coating on outlet surfaces is not necessarily the same as for inlet surfaces. Where both inlet and outlet surfaces are coated, the washcoat formulations can be the same or different. Where both the inlet and the outlet surfaces are washcoated, the mean pore size of washcoat on the inlet surfaces can be different from the mean pore size of washcoat on the outlet surfaces. For example, the mean pore size of washcoat on the inlet surfaces can be less than the mean pore size of washcoat on the outlet surfaces. In the latter case, a mean pore size of washcoat on the outlet surfaces can be greater than a mean pore size of the porous substrate. Whilst it is possible for the mean pore size of a washcoat applied to inlet surfaces to be greater than the mean pore size of the porous substrate, it is advantageous to have washcoat having smaller pores than the porous substrate in washcoat on inlet surfaces to prevent or reduce any combustion ash or debris entering the porous structure. According to a third embodiment, the washcoat sits substantially within, i.e. permeates, the porous structure of the porous substrate. A schematic representation of this third embodiment is shown in FIG. 2C. Methods of making a filter according to the third embodiment include the appropriate formulation of the washcoat known to the person skilled in the art including viscosity adjustment, selection of low wetting characteristics and application of an appropriate vacuum following washcoating of the porous substrate (see also WO 99/47260). Alternatively, the porous substrate can be soaked in an appropriate solution of salts and the resulting product dried and calcined. EP 1663458 discloses a SCR filter, wherein the filter is a wallflow monolith and wherein an SCR catalyst composition permeates walls of the wallflow monolith. The specification discloses generally that the walls of the wallflow filter can contain thereon or therein (i.e. not both) one or more catalytic materials. According to the disclosure, permeate, when used to describe the dispersion of a catalyst slurry on the wallflow monolith substrate, means the catalyst composition is dispersed throughout the wall of the substrate. In the... | 1 | < 0.1% |
| ????? ??????????????????????????????????????????????????? ???????????????? ?????????????? ????????????????????????????? ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ???????????????????? ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ??????? ??????? ????? ??????? ???? ??????? ????????? ??????????? ????????????? ???????????????? ?????? ????????????? ?????????????? ???????????????? ?????????????? ?????????? ????? ????? ???????????????????????? ???????????????????????????????? ??????????????????????????????????? ???????????????????????????????? ?????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ????????????????????????????????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????????????? ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ??????????????????????????????????????????????????????????????????????????????????????????????????????? ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ?????? ??????????????????????????????? ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????????? ????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????2????????????????????????????????????????????????????????????????????? ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ?????? ?????????????????????????? ?????????????????????????? ??????????????????????????????????????????????????????????????? ??????????????????????????????????????????????????????? ?????? ?????????????????????????? ?????????????????????????? ?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ????????????????????????????????????????????????????????????? ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? ?????????????????????????????????????????????????????????????????????? ??????????????????????????????????????????????????????????????????????????????????????????? ??????????????????????????????????????????????????????????????????????????? ?????????????????????????????????????????????????????????????? ????????????????????????????????????? | BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is an overall view of a low back pain treatment tool according to Embodiment 1 of the present invention. FIG. 2 is a developed view of the low back pain treatment tool according to Embodiment 1 of the present invention. FIG. 3 is an overall view of a low back pain treatment tool according to Embodiment 2 of the present invention. FIG. 4 is an overall view of a low back pain treatment tool according to Embodiment 3 of the present invention. FIG. 5 is a schematic view showing a case where a wood hand/arm holding portion shown in Embodiment 1 of the present invention is used on the back of a recipient. FIG. 6 is a schematic view showing a case where the wood hand/arm holding portion shown in Embodiment 1 of the present invention is used as an armrest. FIG. 7 is a schematic view for explaining a case where the wood hand/arm holding portion shown in Embodiment 1 of the present invention is used in front of the recipient, with his/her chest and abdomen pressed against a posture holding surface. | TECHNICAL FIELD The present invention relates to a low back pain treatment tool by means of correction of the sacrum, ilium, coccyx, or the like, or more specifically, by means of correction of the pelvis constituted thereby. BACKGROUND ART Pelvis correction is the most common method of relieving low back pain. As a conventional method for pelvis correction, there has been available a treatment method which uses a belt or traction device for fastening the pelvis. A temporary effect can be obtained by compressing only the pelvis using such a device, but the effect does not last very long: for example, the pain comes back after a predetermined period of time elapses since the end of the use of the belt or the like. Examples of such a device include the one that uses a geared motor (Patent Document 1) and the one that requires a recipient to perform light exercise (Patent Document 2). These devices should be used on a recipient who is in a sitting position, a supine position, or the like, and are not designed for correcting the pelvis while he/she raises his/her body up, or more specifically, is in a standing position which is a stable state for the lumbar vertebra. In addition, the use of a mechanical device such as a motor may lead to excessive correction depending on how it is used. PRIOR ART DOCUMENT Patent Document Patent Document 1: Japanese Unexamined Patent Application Publication No. 2010-188171 Patent Document 2: Japanese Unexamined Patent Application Publication No. 8-126718 SUMMARY OF THE INVENTION Problems to be Solved by the Invention The followings are the problems to be solved. 1. Only a temporary effect can be obtained by compressing the pelvis. 2. The pelvis is not corrected while a recipient is in a standing position which is a stable state for the lumbar vertebra. 3. A device which uses a motor may provide excessive correction. 4. A device which requires light exercise lacks in convenience, and limits users who can use it. In consideration of the above problems, it is an object of the present invention to provide a low back pain treatment tool which can correct the pelvis while a recipient is in a standing position, and which safely and properly corrects the pelvis by pressing the coccyx using the weight of the recipient. Means for Solving the Problem As described in claim 1, the present invention is a low back pain treatment tool comprising: a cylindrical casing elongated in a longitudinal direction; a coccyx contact treatment member which is slidably placed through an elastic member in an axial direction of the cylindrical casing; a coccyx contact buffering member which is provided on an upper end of the coccyx contact treatment member; a posture holding member having a posture holding surface in a longitudinal direction, which faces the cylindrical casing; and a handle fixed to the posture holding member. In addition, as described in claim 2, the present invention is the low back pain treatment tool according to claim 1, wherein the cylindrical casing is fixed and supported on the posture holding member by fixing a horizontal seat plate vertically with respect to the posture holding surface and coupling a lower end of the cylindrical casing to an upper surface of the horizontal seat plate. Further, as described in claim 3, the present invention is the low back pain treatment tool according to claim 1, wherein the cylindrical casing is fixed and supported on the posture holding member by fixing the posture holding member on a horizontal base plate, fixing a pair of left and right side plates orthogonally to a horizontal surface of the base plate and the posture holding surface, and attaching a horizontal seat plate between the side plates. Still further, as described in claim 4, the present invention is a low back pain treatment tool comprising: a cylindrical casing elongated in a longitudinal direction; a coccyx contact treatment member which is slidably placed through an elastic member in an axial direction of the cylindrical casing; a coccyx contact buffering member which is provided on an upper end of the coccyx contact treatment member; a posture holding member having a posture holding surface in a longitudinal direction, which faces the cylindrical casing; a handle fixed to the posture holding member; a horizontal seat plate which fixes and supports the cylindrical casing on the posture holding member by being fixed vertically with respect to the posture holding surface and coupling a lower end of the cylindrical casing to an upper surface of the horizontal seat plate; a horizontal base plate which fixes the posture holding member; a pair of left and right side plates which are fixed orthogonally to a horizontal surface of the base plate and the posture holding surface, and which support left and right sides of the horizontal base plate respectively; corner portions formed by an outer surface of either of the side plates, the posture holding surface, and a horizontal surface of the base plate; and rectangular parallelepiped foot rest blocks which are detachably placed at the corner portions. Effects of the Invention According to the invention set forth in claim 1, riding on the coccyx contact treatment member of the low back pain treatment tool in a standing position can restore the downward movement of the spine by upward vertical compression from immediately below the coccyx using the weight of the recipient. Treating a recipient in a standing position can allow positional correction of the sacrum, ilium, coccyx, or the like, or more specifically, correction of the pelvis constituted thereby, in a stable state for the lumbar vertebra, making it possible to continuously relieve low back pain. By vertically vibrating the coccyx contact treatment member which is slidably placed through the elastic member, while riding on it, a recipient can finely adjust the position of the coccyx contact treatment member at the pelvis, so that he/she can achieve pelvis correction at a proper position. According to the invention set forth in claim 2, the cylinder casing is fixed and supported on the posture holding member by fixing the cylinder casing on the upper surface of the horizontal seat plate provided at a proper height, the length of the cylinder casing can be reduced. This prevents excessive moment force from being applied to the bolt which is located at the basal portion of the cylinder casing to fix it, thereby reducing the occurrence of failures. In addition, shorter length of the cylinder casing can save on costs. According to the invention set forth in claim 3, by providing the pair of left and right side surface plates fixed orthogonally to the horizontal seat plate and the posture holding surface of the posture holding member, the orientation of the horizontal seat plate can be kept constant even under load of the weight of the recipient. According to the invention set forth in claim 4, the rectangular parallelepiped foot rest blocks are stably provided in place at the corner portions, which are formed by three surfaces consisting of the outer surface of either of the side plates, the horizontal surface of the base plate, and the posture holding surface, so that the blocks can simultaneously come into contact with the surfaces. Thereby the recipient can more easily apply his/her weight to the coccyx contact treatment member in a standing position while riding on the treatment tool. More specifically, he/she can thereby appropriately select and easily adjust the height at which he/she can take his/her feet off the foot rest blocks while riding on the treatment tool, and can also make height adjustment in accordance with his/her height, before he/she uses the treatment tool. | BEST MODES FOR CARRYING OUT THE INVENTION (Embodiment 1) Embodiment 1 of the present invention will be described below with reference to FIGS. 1 and 2. With a cylindrical casing 7 placed so that its axial direction is along the vertical direction, an inner cylindrical casing 8 and a coccyx contact treatment member 9a, each having a smaller diameter than that of the casing 7, are inserted thereinto. In this case, a coil spring as an elastic member 10 is provided below the inner cylindrical casing 8, and then the inner cylindrical casing 8 and the coccyx contact treatment member 9a are arranged so that they can slide vertically relative to the casing 7. With such an arrangement, the coccyx contact treatment member 9a is placed so that it can slide in the axial direction of the casing 7 through the elastic member 10. The coccyx contact treatment member 9a has a cylindrical shape, is configured so that its diameter can be changed in accordance with the body size of a recipient, and has a flat surface to be contacted by the recipient. It should be noted, however, that a coccyx contact treatment member 9b having projections on the surface to be contacted by the recipient, may be used depending on the symptoms of low back pain of the recipient. A sponge is provided as a coccyx contact buffering member 11 in a center of a recipient-side end face of the coccyx contact treatment member 9a or 9b to avoid excessive compression of the coccyx of the recipient. A base for supporting the cylindrical casing 7 is constituted by a horizontal seat plate 6, a pair of side plates 3 provided on the left and right sides of the horizontal seat plate 6, and a base plate 5. The cylindrical casing 7 is fixed to the horizontal seat plate 6, which is a constitute element of the base, with bolts 12, washers 13, and nuts 14. A posture holding member 2 which is used by a recipient to hold his/her posture when he/she rides on the coccyx contact treatment member 9a has a posture holding surface of a plate-like shape elongated in the vertical direction, and is provided adjacent to the cylindrical casing 7 to be fixed to the base plate 5, side plates 3, and horizontal seat plate 6. A handle which is used by a recipient when he/she rides on the coccyx contact buffering member 11 is fixed to the posture holding member 2. Rectangular parallelepiped foot rest blocks 15 for a recipient are placed at corner portions formed by three surfaces consisting of the outer surface of either of the side plates 3, the posture holding surface of the posture holding member 2, and the horizontal surface of the base plate, so that the blocks can simultaneously come into contact with the surfaces. A method of using a low back pain treatment tool 1 according to the above-mentioned embodiment will be described with reference to FIG. 5. FIG. 5 is a view showing a case where a hand/arm holding portion 4 as a handle is used so that the back of a recipient comes into contact with the posture holding member 2. The recipient straddles the cylindrical casing 7 of the low back pain treatment tool 1 to place his/her coccyx on the coccyx contact buffering member 11. At this time, the recipient spreads his/her legs by about the breadth of his/her shoulders in a standing position. With his/her back against the posture holding member 2, the recipient then stretches his/her arms backward over the hand/arm holding portion 4 as a handle, bends his/her arms so that the handle is located on the inside of his/her elbows, and takes his/her forearms toward the front of him/her from below the handle. Thereby, the recipient can stably keep himself/herself in a standing position. Depending on the symptoms of his/her low back pain, he/she may correct his/her pelvis and relieve his/her pain by using the low back pain treatment tool 1 for five minutes per use and about two times per day. The foot rest blocks 15 have a rectangular parallelepiped shape, and hence can be easily positioned at the corner portions formed by the three surfaces consisting of the outer surface of either of the side plates 3, the posture holding surface of the posture holding member 2, and the horizontal surface of the base plate 5, while simultaneously coming into contact with the three surfaces. Thereby the recipient can more easily apply his/her weight to the coccyx contact treatment member 11 in a standing position while riding on the treatment tool. More specifically, he/she can thereby appropriately select and easily adjust the height at which he/she can take his/her feet off the foot rest blocks while riding on the treatment tool, and can also make height adjustment in accordance with his/her height by stacking two or more foot rest blocks 15 or replacing the foot rest blocks 15 with ones of different heights, before he/she uses the treatment tool. The coccyx contact treatment member 9a is slidably placed through the elastic member, and therefore, when the recipient places his/her coccyx on the coccyx contact buffering member 11, he/she finely adjusts the position of the coccyx contact treatment member 9a by vertically vibrating the coccyx contact treatment member 9a while riding on it. FIG. 6 is a view showing a case where the low back pain treatment tool according to the present invention is used with hand/arm holding portions 4 as handles being used as armrests. FIG. 7 is a view showing a case where the low back pain treatment tool according to the present invention is used with the chest and abdomen of a recipient pressed against the posture holding member 2. (Embodiment 2) Embodiment 2 of the present invention will be described with reference to FIG. 3. The internal configuration of a cylindrical casing 7 is the same as that in Embodiment 1. In this embodiment, the cylindrical casing 7 is directly fixed to a base plate 5, which is a constituent element of a base, with bolts 12, washers 13, and nuts 14. Longer longitudinal length of the cylindrical casing 7 reduces the number of components and allows simpler configuration as compared with Embodiment 1. (Embodiment 3) Embodiment 3 of the present invention will be described with reference to FIG. 4. The internal configuration of a cylindrical casing 7 is the same as that in Embodiment 1. In this embodiment, a base for supporting a cylindrical casing 7 is constituted by a horizontal seat plate 6 and a base plate 5. The cylindrical casing 7 is fixed to the horizontal seat plate 6, which is a constitute element of the base, with bolts 12, washers 13, and nuts 14. The horizontal seat plate 6 is fixed to a posture holding member 2 with shelf supports 17, and the posture holding member 2 is fixed to the base plate 5 with bolts. In this embodiment, it is only required to fix the horizontal seat plate 6 to the posture holding member 2, and therefore, as in the second embodiment, the number of components is smaller and simpler configuration is possible than in Embodiment 1. The upper end faces of the cylindrical casing 7 and the coccyx contact treatment member 9a are circular so as not to injure a recipient in FIG. 1, but are not limited to this, and may be elliptic for example. Further, in FIG. 1, the coccyx contact treatment member 9a is separated from an inner cylindrical casing 8 in consideration of the possibility that a recipient may change the shape of the coccyx contact treatment member 9a. However, no problem arises even if these components are integrated Again in FIG. 1, the coccyx contact treatment member 9a is smaller in diameter than the cylindrical casing 7, so that the coccyx contact treatment member 9a is placed inside the cylindrical casing 7. However, the present invention is not limited to this configuration, and the coccyx contact treatment member 9a may cover the cylindrical casing 7. The elastic member 10 can be changed in accordance with the weight or symptoms of the recipient, and a coil spring is used in FIG. 2, but a leaf spring or rubber may be used as the elastic member 10. The coccyx contact treatment member 9a or 9b comes into contact with a recipient, and hence is preferably made of wood. However, depending on the symptoms of the recipient, the coccyx contact treatment member 9a or 9b may be made of rubber which is softer than wood, or aluminum which is harder than wood. The horizontal seat plate 6 and the cylindrical casing 7 are fixed with bolts in FIG. 2. However, the present invention is not limited to this, and they may be fixed, for example, with a wedge or by fitting. The hand/arm holding portion 4 which is used as a handle in FIGS. 5 and 6 is rodlike. However, the shape of the hand/arm holding portion 4 is not limited to this, and may be platelike. Referring to FIG. 3, the hand/arm holding portion 4 is coupled to the posture holding member 2 so as to allow height adjustment. DESCRIPTION OF REFERENCE NUMERALS 1 : Low back pain treatment tool 2 : Posture holding plate 3 : Side plate 4 : Hand/arm holding portion 5 : Base plate 6 : Horizontal seat plate 7 : Cylindrical casing 8 : Inner cylindrical casing 9 a: Coccyx contact treatment member 9 b: Coccyx contact treatment member having projections 10 : Elastic member 11 : Coccyx contact buffering member 12 : Casing fixing bolt 13 : Casing fixing washer 14 : Casing fixing nut 15 : Foot rest block 16 : Human body 17 : Shelf support | 1 | < 0.1% |
| BRIEF DESCRIPTION OF THE DRAWINGS The present invention will become more fully understood from the detailed description given hereinbelow and the accompanying drawings which are given by way of illustration only, and thus are not limitative of the present invention, and wherein: FIG. 1 is a whole configuration diagram showing the configuration of an electric clutch; FIG. 2 is a block diagram showing the whole configuration of a fail detecting device for a rotation angle sensor according to one embodiment of the present invention; FIG. 3 is an enlarged diagram of a cam; FIG. 4 is an explanatory diagram of the configuration of the cam; FIG. 5 is a graph showing the output characteristic of an angle sensor; FIG. 6 is a graph showing the sensor output of the angle sensor when the cam continuously rotates; FIG. 7 is a flowchart showing the procedure of angle sensor fail detection processing according to one embodiment of the present invention; and FIG. 8 is a sub-flowchart showing the procedure of sensor value comparison processing. CROSS-REFERENCE TO RELATED APPLICATIONS The present application claims priority under 35 USC 119 to Japanese Patent Application No. 2010-068476 filed Mar. 25, 2011 the entire contents of which are hereby incorporated by reference. BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a fail detecting device for a rotation angle sensor. More particularly to a fail detecting device for a rotation angle sensor for detecting the fail state of the rotation angle sensor that detects the rotation angle of an object to be detected. 2. Description of Background Art Conventionally, there has been known a configuration in which a plurality of rotation angle sensors are provided in a rotation angle detecting system to detect the rotation angle of a rotating body as preparation for the occurrence of a fail such as breakdown in the rotation angle sensor. Japanese Patent Laid-open No. 2005-265768 discloses a configuration in a rotation angle detecting system to detect the rotation angle of a ball bearing configured with a bearing ring composed of inner ring and outer ring. A plurality of spherical rolling elements rotate along the bearing ring with a cage that separates the rolling elements. More specifically, in this configuration, at least two rotation angle sensors formed of Hall elements are provided to detect the rotation angle of the cage. However, in the technique described in Japanese Patent Laid-open No. 2005-265768, although a fail can be easily detected by comparing the respective sensor outputs even when a fail such as breakdown has occurred in any sensor, there is a problem that the increase in the number of sensors causes an increase in the number of parts and an increase in the complexity of arithmetic processing, and so forth. SUMMARY AND OBJECTS OF THE INVENTION An object of an embodiment of the present invention is to solve the above-described problem of the related art and provide a fail detecting device for a rotation angle sensor, capable of surely detecting a fail of the rotation angle sensor even if the number of rotation angle sensors that deal with an object to be detected is one. To achieve the above-described object, according to an embodiment of the present invention, in a fail detecting device for a rotation angle sensor, having a cam ( 25) that has a cam surface in which an actuating surface (A, B) that reciprocates a push rod (35) and a non-actuating surface (C, D, E) that does not reciprocate the push rod (35) are continuously formed, an angle sensor (21) formed of an endless rotary potentiometer that detects the rotation angle of the cam (25) and has an output voltage (S) increasing in proportion to the rotation angle in a range of 360 degrees, and a controller (50) that detects a fail state of the angle sensor (21), the cam (25) is configured so as to be driven to rotate in one direction by an electric motor (1) controlled by the controller (50) to reciprocate the push rod (35). The output voltage (S) of the angle sensor (21) is set so that a region equal to or lower than a first predetermined voltage (V1) and a region equal to or higher than a second predetermined voltage (V2) higher than the first predetermined voltage (V1) are recognized as a dead zone (D). The controller (50) is configured so as to drive the rotation of the cam (25) to a predetermined position in the non-actuating surface (C, D, E) at a constant speed in transition of the cam surface of the cam (25) abutting against the push rod (35) from the side of the actuating surface (A, B) to the side of the non-actuating surface (C, D, E). The angle sensor (21) is configured so that the dead zone (D) is disposed at a position in the non-actuating surface (C, D, E) of the cam (25) and in an area in front of the predetermined position. According to an embodiment of the present invention, the controller ( 50) measures an elapsed time from transition of the cam surface to the dead zone (D) by a timer (54) and determines that the rotation angle sensor (21) is in the fail state if the output voltage (S) corresponding to the dead zone (D) is detected although an estimated time of passage through the dead zone (D) has elapsed. According to an embodiment of the present invention, the controller ( 50) measures an elapsed time from transition of the cam surface from the actuating surface (B) to the non-actuating surface (C) by a timer (54) and determines that the rotation angle sensor (21) is in the fail state if the output voltage (S) corresponding to the dead zone (D) is detected although an estimated time of passage through the dead zone (D) has elapsed. According to an embodiment of the present invention, the controller ( 50) stores the output voltage (S) of timing to transition to the dead zone (D) as a saved value (V2) and determines that the rotation angle sensor (21) is in the fail state if the output voltage (S) is the same as the saved value (V2) although an estimated time of passage through the dead zone (D) has elapsed and a predetermined time has elapsed in this state. According to an embodiment of the present invention, the controller ( 50) determines that the rotation angle sensor (21) is in the fail state if the output voltage (S) is outside a range between upper and lower limits set in advance although an estimated time of passage through the dead zone (D) has elapsed and a predetermined time has elapsed in this state. According to an embodiment of the present invention, the controller ( 50) stores the sensor value (S) of timing to transition to the dead zone (D) as a saved value (V2) and determines that the rotation angle sensor (21) is in the fail state if the output voltage (S) is not a value corresponding to the predetermined position in the non-actuating surface (E) although an estimated time of passage through the dead zone (D) has elapsed. According to an embodiment of the present invention, the cam is configured so as to be driven to rotate in one direction by the electric motor controlled by the controller and reciprocate the push rod. The output voltage of the angle sensor is set so that the region equal to or lower than the first predetermined voltage and the region equal to or higher than the second predetermined voltage higher than the first predetermined voltage are recognized as the dead zone. The controller is configured so as to drive rotation of the cam to a predetermined position in the non-actuating surface at a constant speed in the transition of the cam surface of the cam abutting against the push rod from the actuating surface side to the non-actuating surface side. The angle sensor is configured so that the dead zone is disposed at a position in the non-actuating surface of the cam and in an area in front of the predetermined position. Therefore, the predetermined time to reach to the predetermined position after the passage through the dead zone of the angle sensor in the transition of the cam from the actuating surface side to the non-actuating surface side is obtained in advance. Thus, for example if no change is observed in the sensor output although the predetermined time has elapsed from the entry into the dead zone, this can be determined to be the fail state of the angle sensor. This allows detection of the fail state of the rotation angle sensor even if the number of rotation angle sensors corresponding to the push rod is one, and thus can suppress increase in the number of parts and the cost. According to an embodiment of the present invention, the controller measures the elapsed time from the transition of the cam surface to the dead zone by the timer and determines that the rotation angle sensor is in the fail state if the output voltage corresponding to the dead zone is detected although the estimated time of the passage through the dead zone has elapsed. Thus, the time measurement by the timer is started at the timing of the transition to the dead zone. This enhances the reliability of the time measurement for detecting the dead zone passage. According to an embodiment of the present invention, the controller measures the elapsed time from the transition of the cam surface from the actuating surface to the non-actuating surface by the timer and determines that the rotation angle sensor is in the fail state if the output voltage corresponding to the dead zone is detected although the estimated time of the passage through the dead zone has elapsed. Thus, the time measurement by the timer is started at the timing of the transition of the cam surface from the actuating surface side to the non-actuating surface side. This enhances the reliability of the time measurement for detecting the dead zone passage. According to an embodiment of the present invention, the controller stores the output voltage of the timing to transition to the dead zone as the saved value and determines that the rotation angle sensor is in the fail state if the output voltage is the same as the saved value although the estimated time of the passage through the dead zone has elapsed and the predetermined time has elapsed in this state. Thus, the determination as to the fail state can be accurately made by comparison between the stored saved value and the present output voltage. According to an embodiment of the present invention, the controller determines that the rotation angle sensor is in the fail state if the output voltage is outside the range between the upper and lower limits set in advance although the estimated time of the passage through the dead zone has elapsed and the predetermined time has elapsed in this state. Thus, the determination as to the fail state can be accurately made by comparison between the upper and lower limits set in advance and the present output voltage. According to an embodiment of the present invention, the controller stores the sensor value of the timing to transition to the dead zone as the saved value and determines that the rotation angle sensor is in the fail state if the output voltage is not a value corresponding to the predetermined position in the non-actuating surface although the estimated time of the passage through the dead zone has elapsed. Thus, the determination as to the fail state can be accurately made based on the output voltage at a position except for the dead zone. Further scope of applicability of the present invention will become apparent from the detailed description given hereinafter. However, it should be understood that the detailed description and specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS Preferred embodiments of the present invention will be described in detail below with reference to the drawings. FIG. 1 is a whole configuration diagram of an electric clutch 30 according to one embodiment of the present invention. The electric clutch 30 is e.g. a mechanism that is disposed between engine and transmission of a motorcycle or the like for controlling the disconnection and connection of the rotational driving force. The normally-open electric clutch 30 driven by an electric motor 1 is based on a double-spring system including a push spring 39 and a return spring 43 having spring rates different from each other as biasing members to bias the clutch in the open (disengagement) direction. The electric clutch 30 is so configured that a cam shaft 23 on which a cam 25 is provided is driven to rotate to an arbitrary angle by the rotational driving force of the electric motor 1 to thereby reciprocate a push rod 35 abutting against the cam 25 and drive disengagement and engagement of the clutch. The electric motor 1 has a rotor 4 formed integrally with an output shaft 5 and a stator 3 fixed to the inner circumference of a motor housing 2. A bearing 7 that pivotally supports the output shaft 5 is fitted into a base part 6 that seals the opening of the motor housing 2. A gear 8 formed at an end of the output shaft 5 is meshed with a first intermediate gear 9 that is pivotally supported by bearings 10 and 11 and is composed of two gears integrally formed. The rotational driving force transmitted to the first intermediate gear 9 is transmitted to an input gear 20 spline-fitted into the cam shaft 23 via a second intermediate gear 12 pivotally supported by bearings 13 and 14 and a third intermediate gear 16 pivotally supported by bearings 17 and 18. In the second intermediate gear 12, a tool attachment shaft 15 for allowing attachment of an emergency tool (not shown) to manually rotate the second intermediate gear 12 is provided. At the upper end of the cam shaft 23 in the diagram, a rotation angle sensor (hereinafter, it will be often referred to simply as the angle sensor) 21 formed of a potentiometer to detect the rotation angle of the cam shaft 23 is provided. The cam shaft 23 is pivotally supported by a bearing 19 disposed close to the input gear 20 and bearings 24 and 26 disposed on both sides of the cam 25 in such a manner as to be freely rotatable. In the present embodiment, an oil seal 22 is disposed at substantially the intermediate part of the cam shaft 23. This allows e.g. a layout in which the mechanism from the electric clutch 30 to the cam 25 is housed in the crankcase of the engine whereas the mechanism from the electric motor 1 to the intermediate part of the cam shaft 23 is disposed outside the crankcase. The electric clutch 30 is attached to one end of a main shaft 48 as the input shaft of the transmission (not shown). A primary driven gear 45 that is pivotally supported on the main shaft 48 in such a manner as to be freely rotatable and to which the rotational driving force is transmitted from the crankshaft (not shown) is connected to a clutch outer 41 via plural annular dampers 46. A bearing 47 of the main shaft 48 is disposed on the left side of the primary driven gear 45 in the diagram. When the electric clutch 30 becomes the engaged state, the rotational driving force of the clutch outer 41 is transmitted to the main shaft 48 via a clutch inner 44. More specifically, when the push rod 35 is pushed to the left side in the diagram by the rotational driving force of the electric motor 1, a first push plate 36 is pressed via a bearing 34. The push spring 39 composed of a plurality of coil springs is disposed between the first push plate 36 and a second push plate 38. The return spring 43 composed of plural coil springs is disposed between the second push plate 38 and the clutch inner 44. The second push plate 38 is slid in the left direction in the diagram against the biasing force of both springs 39 and 43. Thereby, the clutch engagement operation is carried out. The second push plate 38 is engaged with the clutch inner 44 in such a manner so as to give a predetermined preload to the return spring 43 and is fixed to the main shaft 48 by a nut 33 with the intermediary of a washer 32 to restrict the range of the slide in the right direction in the diagram. Furthermore, the range of the slide of the first push plate 36 in the right direction in the diagram is restricted by a circlip 37. When the second push plate 38 is slid in the left direction in the diagram, a clutch plate 42 is pressed in the left direction in the diagram by an annular pressing member 40 fixed to the second push plate 38. Thereby, the electric clutch 30 is switched from the disengaged state to the engaged state. FIG. 2 is a block diagram showing the whole configuration of the fail detecting device for a rotation angle sensor according to one embodiment of the present invention. The same numeral as that in the above description denotes the same or equivalent part. A controller 50 includes a sensor output recognizer 51 that recognizes the sensor output of the angle sensor 21, a sensor fail determiner 52 that determines the fail state of the angle sensor 21, a motor controller 53 that controls the electric motor 1, and a timer 54 that measures various predetermined times. The sensor output recognizer 51 inputs the sensor output of the angle sensor 21 to the sensor fail determiner 52. The motor controller 53 inputs the control state of the electric motor 1 to the sensor fail determiner 52. The sensor fail determiner 52 detects the fail state of the angle sensor 21 based on the control state of the electric motor 1 and the measurement result of the timer 54 in addition to the sensor output from the angle sensor 21. FIG. 3 is an enlarged diagram of the cam 25. FIG. 4 is an explanatory diagram of the configuration of the cam 25. The cam 25 rotates integrally with the cam shaft 23 driven to rotate by the electric motor 1 to thereby reciprocate the push rod 35 that is supported so as to be capable of reciprocation in the left and right directions in the diagram. In the cam 25, a continuous cam surface composed of cam surfaces 25a to 25e is formed. The cam 25 according to the present embodiment is driven by the electric motor 1 in such a manner so as to rotate only in the anticlockwise direction. Thereby, the cam surface abutting against the push rod 35 changes in the order of the cam surface 25a?25b?25c?25d?25e in association with the rotation of the cam 25. In the present embodiment, the cam surface 25a that drives the clutch in the engagement direction is set as engagement area A. The cam surface 25b that drives the clutch in the disengagement direction is set as disengagement area B. The cam surface 25c that keeps the disengaged state of the clutch is set as bridge area C. The cam surface 25d that similarly keeps the disengaged state of the clutch is set as dead zone D. The cam surface 25e that similarly keeps the disengaged state of the clutch is set as standby area E. The disengagement area B is formed so that the rising (lift amount) of the cam surface 25b is small, and is configured so that the clutch can be rapidly switched from the state of being engaged by the cam surface 25a to the disengaged state by merely driving the electric motor 1 by a slight angle. The cam surfaces 25c, 25d, and 25e can be formed by a single circular arc. In the present embodiment, the engagement area A and the disengagement area B will be collectively referred to as the actuating surface of the clutch. Furthermore, the bridge area C, the dead zone D, and the standby area E will be collectively referred to as the non-actuating surface of the clutch. The area that includes the position corresponding to 0 degrees as the rotation angle of the cam 25 and ranges between an angle ?1 and an angle ?2 is defined as the dead zone D. The area from the angle ?1 to 90 degrees is defined as the standby area E. The area from 90 degrees to 180 degrees is defined as the engagement area A. The area from 180 degrees to 270 degrees is defined as the disengagement area B. The area from 270 degrees to the angle ?2 is defined as the bridge area C. In the present embodiment, in the transition of the cam 25 from the actuating surface to the non-actuating surface, the cam 25 is driven to rotate to a predetermined position in the non-actuating surface at a constant speed to prepare for the next clutch engagement operation. More specifically, in the transition of the cam 25 from the actuating surface to the non-actuating surface, i.e. in the transition from the disengagement area B to the bridge area C, the cam 25 is driven to rotate to a predetermined position in the standby area E at a constant speed. Due to this feature, the passage through the dead zone D located between the bridge area C and the standby area E is carried out at the constant speed necessarily. The processing of driving the rotation of the cam 25 at a constant speed is started simultaneously with the detection of the boundary between the disengagement area B and the bridge area C and can be executed for a predetermined time in which the cam 25 can be surely rotated to the standby area E. The cam 25 may be stopped at a predetermined position in the standby area E based on the output of the angle sensor 21 after the processing is started simultaneously with detection of the boundary between the disengagement area B and the bridge area C. FIG. 5 is a graph showing the output characteristic of the angle sensor 21. FIG. 6 is a graph showing the sensor output of the angle sensor when the continuously rotates. As described above, the angle sensor 21 is an endless rotary potentiometer whose sensor output (output voltage) S increases in proportion to the rotation angle in the range of 360 degrees. More specifically, the sensor output S is 0 when the angle is 0 degrees. The sensor output S increases in proportion to the angle of rotation and 5 V as the maximum voltage is generated when the angle is 360 degrees. Therefore, if the cam 25 continuously rotates in one direction, a voltage waveform having such a form as to connect 0 V and 5 V is continuously output as shown in FIG. 6. In the present embodiment, among the sensor outputs from 0 V to 5 V, only center values that can be expected to provide high accuracy are used as the effective sensor value and the other part is set as the dead zone. More specifically, the range from 0 degrees to the angle ? 1 corresponding to a sensor output V1 (first predetermined voltage) is set as a dead zone D1 and the range from the angle ?2 corresponding to a sensor output V2 (second predetermined voltage) to 360 degrees is set as a dead zone D2. The dead zones D1 and D2 will be collectively referred to as the dead zone D. The fail detecting device for a rotation angle sensor according to the present invention is characterized in that the dead zone D of the angle sensor 21 is disposed on the non-actuating surface side of the cam 25 and in front of the position to which the cam 25 is driven to rotate at a constant speed in the transition from the disengagement area B to the bridge area C as shown in FIG. 4. Due to this feature, in the transition of the cam 25 from the actuating surface to the non-actuating surface, the passage through the dead zone D is carried out at the constant speed necessarily. Furthermore, because the cam 25 is necessarily rotated to the predetermined position at the constant speed in the transition of the cam 25 from the actuating surface to the non-actuating surface, the position of the cam 25 can be predicted by time measurement by the timer 54. In view of the above-described characteristic, even an angle detecting system having only one angle sensor 21 can easily detect the fail state of the angle sensor 21. For example, the transition from the bridge area C to the dead zone D can be detected due to the reaching of the sensor output S to V2. Thus, if time measurement by the timer 54 is started in response to this transition, it can be determined that a fail has occurred in the angle sensor 21 based on a phenomenon that the sensor output still remains within the sensor output range corresponding to the dead zone D even after the elapse of a predetermined time. Furthermore, the motor controller 53 recognizes the drive signal to the electric motor 1. Thus, if the sensor output corresponding to the standby area E is not output as designed even after the end of the period in which the cam 25 is driven to the standby area E after the passage through the dead zone D at a constant speed, this can be determined to be the fail state of the angle sensor 21. Moreover, also if no change is observed in the sensor output although the electric motor 1 is being driven, this can be determined to be the fail state of the angle sensor 21. The above-described fail determination is made by the sensor fail determiner 52 shown in FIG. 2. FIG. 7 is a flowchart showing the procedure of angle sensor fail detection processing according to one embodiment of the present invention. FIG. 8 is a sub-flowchart showing the procedure of sensor value comparison processing. In a step S1, whether or not the clutch has been disengaged is determined. This determination can be made based on whether or not the sensor output S of the angle sensor 21 has become the value corresponding to the disengagement area B of the cam 25. Furthermore, it is also possible to detect whether or not the clutch has been disengaged based on the rotation speed ratio between the crankshaft and the transmission shaft. If the positive determination is made in the step S 1, the processing proceeds to a step S2, where a sensor saved value before the entry into the dead zone D is recorded. This saved value is the sensor output S detected at the boundary of the bridge area C and the dead zone D of the cam 25. In the present embodiment, the saved value is V2 detected at the angle ?2. In a subsequent step S 3, whether or not the cam 25 is moving to the standby area E is determined. This determination is made based on whether or not control of driving the rotation of the cam 25 to a predetermined position in the standby area E at a constant speed by the motor controller 53 is being carried out. The predetermined position in the standby area E can be arbitrarily set in advance. If the positive determination is made in the step S 3, the processing proceeds to a step S4, where whether or not the estimated time of the dead zone passage has elapsed is determined. This determination can be made because the cam 25 is driven to rotate to a predetermined position in the standby area E at a constant speed in the transition from the disengagement area B to the bridge area C and time measurement by the timer 54 is started at a predetermined timing. The estimated time of the passage through the dead zone D can be calculated in advance based on the rotation speed of the cam 25. By starting the time measurement in response to detection of the boundary between the disengagement area B and the bridge area C of the cam 25 and by starting the time measurement in response to detection of the boundary between the bridge area C and the dead zone D, the completion timing of the passage through the dead zone D can be detected based on the output of the timer 54. If the positive determination is made in the step S 4, the processing proceeds to a step S5, where the sensor value comparison processing is executed. Details of this processing will be described later. If the negative determination is made in the step S1, S3, or S4, the series of control is ended directly. FIG. 8 illustrates the sub-flow showing the procedure of the sensor value comparison processing in the above-described step S5. In a step S10, whether or not the sensor value is equal to or smaller than the set upper limit is determined. In this determination, it is determined whether or not the sensor output S sticks to the upper limit (e.g. 5 V) because any fail has occurred in the angle sensor 21. If the positive determination is made in the step S10, the processing proceeds to a step S11, where whether or not the sensor value is equal to or larger than the set lower limit is determined. In this determination, it is determined whether or not the sensor output S sticks to the lower limit (e.g. 0 V) because any fail has occurred in the angle sensor 21. Next, if a positive determination is made in step S 11, the processing proceeds to step S12, where whether or not the sensor value is in an unequal relationship with the sensor saved value is determined. This determination is made based on a prediction that the sensor output S should be a value different from the sensor saved value V2 after the passage through the dead zone D. Subsequently, if the positive determination is made in the step S 12, the processing proceeds to a step S13, where whether or not the sensor value is a value in the range corresponding to the standby area is determined. This determination is made based on a prediction that the sensor output S should be a value output in the standby area E after the passage through the dead zone D. If the positive determination is made in the step S13, it is determined that the angle sensor 21 is normally operating, so that the series of control is ended. It is also possible to make the determination as to the fail state based on whether or not the sensor value is a value output in the dead zone. This determination is based on a prediction that the sensor output S should not be a value output in the dead zone D after the passage through the dead zone D. If a negative determination is made in the step S 10, S11, S12, or S13, the processing proceeds to a step S14, where a fail detection mode starts based on a determination that possibly any fail has occurred in the angle sensor 21. In the fail detection mode, time measurement by the timer 54 is started. In a step S15, it is determined whether or not a predetermined time has elapsed from the start of the fail detection mode, i.e. from the appearance of suspicion of a fail. If the positive determination is made in step S15, the processing proceeds to step S16, where it is determined that the angle sensor 21 is in the fail state. As described above, in the fail detecting device for a rotation angle sensor according to the present invention, the cam 25 is driven to rotate to a predetermined position in the standby area E at a constant speed in the transition of the cam 25 from the actuating surface to the non-actuating surface, i.e. in the transition from the disengagement area B to the bridge area C. Furthermore, the angle sensor 21 is so configured that the dead zone D is disposed at a position in the non-actuating surfaces C, D, and E of the cam 25 and in the area in front of the predetermined position. Therefore, the predetermined time to reach to the predetermined position after the passage through the dead zone of the angle sensor in the transition of the cam from the actuating surface side to the non-actuating surface side is obtained in advance. Thus, for example if no change is observed in the sensor output although the predetermined time has elapsed from the entry into the dead zone, this can be determined to be the fail state of the angle sensor. This allows even a rotation angle detecting system having only one angle sensor to detect the fail state of the angle sensor and thus can suppress increase in the ... | 1 | < 0.1% |
| DESCRIPTION OF DRAWINGS FIG. 1 shows a network of base stations and wireless clients in a wireless communications system. FIG. 2 illustrates a sending sliding window mechanism. FIG. 3 illustrates an example MAC packet format. FIG. 4 illustrates a receiving sliding window mechanism. FIG. 5 is a conceptual diagram of a system that acknowledges packets using a sequence number and a bit mask. FIG. 6 is a flow chart of an example process for performing adaptive data unit transmission and acknowledgment. FIG. 7 is a block diagram of an example system for performing adaptive data unit transmission and acknowledgment. FIG. 8 is a block diagram of computing devices that may be used to implement the systems and methods described in this document, as either a client or as a server or plurality of servers. CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. application Ser. No. 12/815,997 filed on Jun. 15, 2010, entitled Adaptive Data Unit Transmission and Acknowledgement, the entire contents of which are hereby incorporated by reference. TECHNICAL FIELD This document generally describes techniques, methods, systems, and mechanisms for performing adaptive data unit transmission and acknowledgment. BACKGROUND The present disclosure generally relates to electronically transmitting data between computing devices. Modern wireless data communication systems provide bandwidth for use by rich computing applications on mobile devices. For example, users of wireless devices such as smart phones can make telephone calls, receive emails, and even receive full motion audio/video broadcasts on their mobile devices. Every time a great new service is offered, users of wireless devices consume data associated with the service, requiring more and more bandwidth. As a result, the airwaves are filled with data going to and from an increasing number of wireless computing devices that each require growing amounts of data. A data packet transmitted in such a wireless communication system may not always be received by an intended recipient computing device. Interfering signals from other computing devices or from natural phenomena may overpower the portion of the signal that includes the data packet so that the entire data packet, or portions thereof, are unintelligible to the receiving device or include errors. Similarly, either the transmitting or receiving device may temporarily move behind an obstruction, so that communication signals between the devices are blocked for a temporary period of time. Because data packets are sometimes not received, a device that receives a packet may send an acknowledgment back to the transmitting device in order to let the transmitting device know that the packet was received. If the transmitting device does not receive an acknowledgment for a particular packet within a time period, the transmitting device may retransmit the particular packet. SUMMARY This document generally describes adaptive data unit transmission and acknowledgment. In general, two computerized devices (e.g., a mobile smartphone and an access point interface) that communicate over a wired or wireless network may employ sliding window mechanisms to assemble packets for transmission to each other, and to reassemble received packets. Each individual byte in a sending sliding window may be associated with a flag that indicates whether or not an acknowledgment from the other device has been received for the byte. Bytes that have not been acknowledged after a given period of time may be reassembled into new packets and retransmitted to the other computerized device. A computerized device may continue to retransmit each byte in the sliding window until the byte has either been acknowledged or retransmitted a maximum number of times. The maximum number of retransmissions that are attempted for each byte may depend on a type of information represented by the byte. For example, if the byte represents voice information, then the maximum number of retransmissions may be a low number (e.g., 2) because the quality of a voice signal may not be very important but latency would be significant. On the other hand, if the byte represents encrypted banking communications, the maximum number of retransmissions may be very high (e.g., 26) because the quality of the communication may be very important, but latency would not be as significant of a concern. Each computerized device may acknowledge received packets by sending two values to the device that transmitted the packets. A first value can identify a packet (e.g., a most recently-received packet or a most recently-received and acknowledged packet). A second value can represent a bit-mask. Each bit in the bit mask may identify whether or not a single packet that is in an offset relationship to the identified packet has been received. For example, the bits in the bit mask may represent an adjacent sequence of transmitted packets. The sequence of transmitted packets may include or may not include the identified packet. The sequence of packets may be associated with a pre-defined relationship to the identified packet (e.g., the sequence of packets that were transmitted immediately after the identified packet). In general, one aspect of the subject matter described in this specification can be embodied in a method for adaptive data unit transmission. The method includes filling, by a sending computerized device, a sliding window with data units that are to be transmitted to a receiving computerized device. The sliding window includes, among multiple data units, a data unit that is designated as being positioned at a sliding window start position and a data unit that is designated as being positioned at a sliding window end position. The method includes storing, for each particular one of the multiple data units in the sliding window, a value that represents a maximum number of times that the particular data unit is to be transmitted. The stored value is different among at least two of the data units in the sliding window. The method includes selecting, from the sliding window, data units to be assembled into a packet, and transmitting an assembled packet of the selected data units to the receiving computerized device. The method includes determining that that the data unit that is designated as being positioned at the sliding window start position has been transmitted a particular number of times that is based off of the value that represents the maximum number of times that the particular data unit can be transmitted and, in response, designating a different data unit as being positioned at the sliding window start position. Another aspect of the subject matter described in this specification can be embodied in a computer-implemented method for receiving data unit acknowledgments. The method includes filling, by a sending computerized device, a sliding window with data units that are to be transmitted to a receiving computerized device. The sliding window includes, among multiple data units, a data unit that is designated as being positioned at a sliding window start position and a data unit that is designated as being positioned at a sliding window end position. The method includes selecting, from the sliding window, data units to be assembled into a packet, and transmitting the assembled packet of selected data units to the receiving computerized device. The method includes receiving, at the sending computerized device and from the receiving computerized device: (i) an identification of a packet that was transmitted from the sending computerized device to the receiving computerized device, and (ii) a mask that identifies whether each of a sequential group of packets transmitted from the sending computerize device is acknowledged by the receiving computerized device. In yet another aspect, the subject matter described in this specification can be embodied in a computer-implemented. The method includes filling, by a sending computerized device, a sliding window with data units that are to be transmitted to a receiving computerized device. The sliding window includes, among multiple data units, a data unit that is designated as being positioned at a sliding window start position and a data unit that is designated as being positioned at a sliding window end position. The method includes storing, for each particular one of the multiple data units in the sliding window, a value that represents a maximum number of times that the particular data unit is to be transmitted. The stored value is different among at least two of the data units in the sliding window. The method includes selecting, from the sliding window, data units to be assembled into a packet, and transmitting an assembled packet of the selected data units to the receiving computerized device. The method includes determining that that the data unit that is designated as being positioned at the sliding window start position has been transmitted a particular number of times that is based off of the value that represents the maximum number of times that the particular data unit can be transmitted and, in response, designating a different data unit as being positioned at the sliding window start position. The method includes receiving, at the sending computerized device and from the receiving computerized device: (i) an identification of a packet that was transmitted from the sending computerized device to the receiving computerized device, and (ii) a mask that identifies whether each of a sequential group of packets is acknowledged by the receiving computerized device. These and other implementations can optionally include one or more of the following features. Designating the different data unit as being positioned at the sliding window start position may include shrinking a number of data units in the sliding window such that the data unit being positioned originally at the sliding window start position is no longer included in the sliding window and will no longer be selected from the sliding window for transmission to the receiving computerized device. The method can include storing, for each particular one of the multiple data units in the sliding window, a value representing a number of times that the particular data unit has been transmitted from the sending computerized device to the receiving computerized device. Filling the sliding window with data units can include determining that a number of data units in the sliding window is below a first predetermined threshold number of data units, and selecting data units to include in the sliding window from a packet of a higher layer Open System Interconnection model until the sliding window exceeds a second predetermined threshold number of data units. The maximum number of transmissions may be a number of retransmissions of the particular data unit. The sliding window may be filled with data units selected from packets of a higher layer Open System Interconnection model. The method may include setting, for each specific data unit in the sliding window, the value that represents the maximum number of times that the specific data unit can be transmitted based on a priority of a packet in the higher layer that the data unit is selected from. All data units in the sliding window that are selected from a same higher layer packet may have a same value that represents the maximum number of times. The data unit may be a byte. The method may include receiving, at the sending computerized device and from the receiving computerized device, an acknowledgment of packets that the receiving computerized device both received from the sending computerized device and that satisfied an error-checking algorithm. The acknowledgment may include: (i) an identification of a packet previously received at the receiving computerized device, and (ii) a mask that includes multiple bits, each bit representing an acknowledgment or non-acknowledgment of a different packet. Selecting data units to be assembled into a packet may include not selecting data units that have been acknowledged and not selecting data units that have been transmitted the particular number of times that is based off of the value that represents the maximum number of times that the data unit can be transmitted. The method may include transmitting the assembled packet from the sending computerized device to the receiving computerized device. The transmitted packet may include a sequence number of the packet that is independent of the position of the data units selected from in the sliding window. The transmitted packet may include an identification that a data unit selected from the sliding window represents a start of a packet from a higher layer Open System Interconnection model, and may identify which of the selected data units represents the start of the packet from the higher layer. The mask may identify with a single bit, for each specific packet in the group, whether the specific packet is acknowledged. The identification of the packet and the mask may be included in a single packet that is received at the sending computerized device and from the receiving computerized device. The single packet may not include identifications for at least some of the packets in the sequential group. The identification of the packet may be an identifier that is independent from a position of the packet in the sliding window. The method may include storing at the sending computerized device, for each of the multiple data units in the sliding window that was acknowledged by the receiving computerized device, an indication that the data unit was acknowledged. An acknowledgment of a packet may indicate both that the packet was received by the receiving computerized device and satisfied an error-checking algorithm at the receiving computerized device. The method may include determining, by the receiving computerized device, that multiple packets transmitted by the sending computerized device and received at the receiving computerized device satisfy an error checking algorithm. The method may include transmitting, to the sending computerized device, an acknowledgment of the received packets, wherein the transmission includes: (i) an identification of a most recently received of the multiple packets, and (ii) a mask that identifies for each individual one of a sequential group of packets received before the identified packet, whether the individual packet was received and satisfied an error checking algorithm. Particular embodiments can be implemented, in certain instances, to realize one or more of the following advantages. An overhead of packets that are generated at a particular layer in an OSI model may be reduced because a size of an acknowledgment that is sent in the packets is reduced in size. The acknowledgment mechanism may be robust because packets may be acknowledged multiple times. Further, the sending and receiving sliding windows may vary in size (e.g., the start position may be independent from the end position) based on when portions of data are acknowledged. The sliding window may have no limitation on window size. Also, the number of transmissions of a particular data portion in a sliding window may be adjusted for each data portion. Additionally, the sequence number of a transmitted packet and the position of bytes in a sliding window may be separate. Thus, the sequence number may depend on the maximum number of in-flight packets instead of the sliding window size, thereby potentially reducing the number of overhead bytes in a packet used to identify the packet. The details of one or more embodiments are set forth in the accompanying drawings and the description below. Other features, objects, and advantages will be apparent from the description and drawings, and from the claims. Like reference symbols in the various drawings indicate like elements. DETAILED DESCRIPTION This document describes techniques, methods, systems, and mechanisms for performing adaptive data unit transmission and acknowledgment. In general, a wireless communication system may include two computerized devices that communicate with each other by wirelessly transmitting packets of data from one device to the other. The two devices may include mechanisms for acknowledging received packets and for retransmitting packets that have not been acknowledged as having been received. A mobile telephone may transmit packets of data to a base station. Some of the packets, however, may not arrive at the base station because the mobile telephone enters a tunnel, because signals from other mobile telephones interfere with the signals transmitted by the mobile telephone, or because of a variety of other problems. For these reasons, the base station may need to transmit to the mobile telephone an acknowledgment for each packet or portion of data that the base station has correctly received from the mobile telephone. For example, the base station may receive from the mobile telephone hundreds of packets of information, where each packet includes a sequence number that identifies the packet and distinguishes the packet from all other packets that are transmitted over a given time period (e.g., because the numbers may be reused eventually). For each of the received packets, the base station may perform a cyclic redundancy check (CRC) to determine if the received packet includes any transmission errors. For each packet that is received and that passes the CRC, the base station may store an indication that the base station should send an acknowledgment of the received packet to the mobile telephone. When the base station transmits a packet of information to the mobile telephone, the packet may include information that identifies the packet that the base station most recently acknowledged. The packet transmitted by the base station to the mobile device may also include a mask (e.g., a sequence of bits) that identifies whether packets that have sequence numbers before the most recently acknowledged packet have been themselves acknowledged. Each previous packet can be identified as acknowledged or non-acknowledged with a single bit in the mask. For example, the mask may identify whether or not four packets with sequence numbers immediately before the most recently acknowledged packet have been themselves acknowledged. Thus, if the most recently acknowledged packet has a sequence number of 68, while the base station has also acknowledged packets with sequence numbers of 66 and 65, the mask may be 0110 (0 for sequence no. 67, 1 for sequence no. 66, 1 for sequence no. 65, and 0 for sequence no. 64). Each packet that is transmitted by either the mobile telephone or the base station may include the identification of the most recently acknowledged packet and a corresponding mask. When the mobile telephone or base station assembles packets for transmission to the other device, bytes for which an acknowledgment has not been received from the other device may be retransmitted. For example, the packets may be assembled at the MAC layer from bytes that are not acknowledged in a sliding window mechanism that operates in a cyclical buffer. The number of times that a particular packet or portion of data is retransmitted can vary based on the type of data. The bytes that are in the sliding window may be filled with data that is from a higher layer in the Open System Interconnection (OSI) model. Data from the packet in the higher layer OSI model may be used to determine how many times to retransmit bytes that are from the higher layer packet. For example, a data table may identify a number of retransmissions for particular types of higher layer packets based on a particular symbol or sequence of characters in a header or body of a higher layer packet. The symbol or sequence of characters may identify a type of the information in the higher layer packet. The sliding window may grow in size as the window is filled with data from the higher layer (e.g., the end position in the window may move forward in the buffer). Conversely, as data is either acknowledged or retransmitted a maximum number of times, the window may shrink (e.g., the start position may move forward in the buffer). The bytes selected from the sliding window for MAC layer packets may not include bytes that have been retransmitted the maximum number of times. As the mobile telephone receives the acknowledgments (e.g., the indication of the most recently acknowledged byte and the mask) from the base station, the mobile telephone may store an indication of the acknowledged bytes (e.g., the bytes that are in packets that have been acknowledged). The first device may also store an indication of how many times non-acknowledged data portions have been transmitted and a maximum number of transmissions for each byte based on a type of the data that the byte represents. FIG. 1 shows an example network of base stations and wireless client devices in a wireless communications system. At a high level, the network 100 is like most broad-based wireless data networks, where various types of computing devices connect to a network via base stations that are geographically spread apart. The devices may be mobile, and thus may be able to transition from one base station to another as they are moved. The coverage of the base stations may overlap in some locations, so that the system 100 may include mechanisms for determining which base station, among a plurality of base stations that could serve a computing device, should serve the computing device. The network 100, in this example, includes base stations 102 and 104 that are configured to communicate with multiple wireless client devices using a multiple-input multiple-output (MIMO) communication system. An actual network may include many more base stations, but two are illustrated in FIG. 1 for purposes of clarity and simplification. In some implementations, each of the base stations 102 and 104 include arrays of antennas 122 and 124. The radio antennas couple electromagnetic energy from one medium, space, for example, to another, such as wire, coaxial cable, or a waveguide. In some implementations, a base station communicates with multiple client devices on the same time-frequency resource through spatial separation with the antenna arrays, a practice known as spatial division multiple access (SDMA). In SDMA, an antenna array can form multiple spatial channels to allow several communication links to share the same time-frequency resources. SDMA architecture can enable the channeling of radio signals based on a client device's location. The benefits of multiplexing users in the spatial domain can include extending the range of communication possible between a client device and a base station, and receiving less destructive effects of multipath signals (e.g., those signals that bounce off buildings). In some implementations, the base station 102 uses the antenna array 122 to communicate with multiple client devices 110, 114, and 116, using a single swath of spectrum that is treated as a single frequency band. The swath of spectrum, however, may include non-contiguous portions of the electromagnetic spectrum. The array of antennas 122 and the client devices 110, 114, and 116 may operate within this swath of spectrum. In some implementations, the base stations 102 and 104 communicate with client devices over the so-called television white-space frequencies. In some implementations, the base stations 102 and 104 can communicate over the range of frequencies between about 50 MHz to about 700 MHz. In some implementations, the base stations 102 and 104 can communicate over the range of frequencies between about 54 MHz to about 806 MHz. In some implementations, the base stations 102 and 104 can communicate over the range of frequencies between about 698 MHz to about 806 MHz. In some implementations, the base stations operate over frequencies from UHF channels 21-35 (512-602 MHz) and channels 39-51 (620-698 MHz). The base station and wireless devices may treat both sets of UHF channels as a single swath of spectrum. Additionally, the base stations 102 and 104 can employ dynamic time division multiple access (TDMA) protocol in order to communicate with multiple wireless client devices over a single frequency and within a single spatial channel. The TDMA protocol allocates slices of time during which certain of the devices in a spatial channel will transmit and/or receive information, while the other devices wait their turn. In some implementations, the combination of SDMA and TDMA allows each base station 102 and 104 to communicate with approximately 10,000 client devices. The antenna array for each base station 102 and 104 may include 40 antennas. The network 100 may be designed to be a low signal-to-interference ratio (SIR) system. A low SIR system can be a system where the ratio of the strength of signals received at the base station and at client devices to the strength of undesired signals (noise and interference) is low. Thus, signals will not be transmitted with as much power as in a high SIR system. A low SIR system can reduce interference to neighboring cells. In some implementations, the described system regularly operates below 0 dbm and may be able to operate down to ?15 dbm. A system designed to be low SIR can be more robust against interference from devices that are under the network's control. Thus, viewing a specific client device in a MIMO system can be much easier in a low SIR system as the interference from one spatial degree of freedom to another is reduced. Further, with less potential of interference from other spatial degrees of freedom, the channel estimations do not need to be as accurate. Additionally, a low SIR system is more robust to interference from devices that are not under the network's control. This benefit is especially important when using unlicensed spectrum where devices may use the spectrum without permission (e.g., when operating in the unlicensed TV whitespace spectrum). The base stations 102 and 104 are configured to communicate with a variety of wireless devices. For example, the base station 102 can communicate with personal computers, laptop computers (e.g. computer 110), cellular phones (e.g. telephone 114), including smart phones (e.g. smart phone 116), personal digital assistants (PDAs), pagers, video game consoles, and other wireless computing devices such as netbooks. The network can be designed to leverage TCP/IP as much as possible so that voice, data, etc. is encoded in IP. Each of the base stations 102 and 104 can communicate with client devices located within a geographic area around the respective base station, where the area is nominally defined as a circle, but may vary from a circle because of signal interference (e.g., weather, geographic barriers, buildings, etc.). For example, the base station 102 can communicate with devices within a geographic area 106 and the base station 104 can communicate with devices within a geographic area 108. In some implementations, each base station 102 and 104 can communicate with client devices located within a designated radius of each base station (e.g. a 12 km radius). In some implementations, the size of a geographic area for a base station depends on the transmission power of the base station. In some implementations, a particular client device can be located simultaneously within geographic coverage areas for multiple base stations. For example, a wireless device 112 is located within the geographic area 106 and the geographic area 108. In such circumstances, the wireless device 112 is capable of communicating with the base station 102 or the base station 104 (or it could communicate with both). In some implementations, the wireless device 112 can elect to associate with the base station 102 or 104 that has the strongest signal at the location of the wireless device 112. In some implementations, the wireless device 112 can elect to associate with the base station 102 or 104 that has the best signal-to-noise ratio. As noted above, the base stations 102 and 104 can use a time division multiple access (TDMA) protocol to communicate with multiple client devices over a single frequency band. Communications within this structure can occur in repeating structures known as frames of information, where each frame may have a defined structure. Frames are constructs whose defined structure is understood by both wireless devices and base stations, so that each device knows when it is allowed to communicate and what data should be communicated during a particular time slice. During portions of a frame, a client device may be permitted to transmit, receive, or wait and listen. The general structure and function of frames is well-known. Transmission time in the network 100 can be divided into uplink and downlink times. In some implementations, the amount of time devoted to uplink and downlink can be equal. In other implementations, time can be split between uplink and downlink times using a relatively arbitrary ratio. For example, two thirds of time can be allocated for uplink time and one third of time can be allocated for downlink time. FIG. 2 illustrates a sending sliding window mechanism. The sending sliding window 202 may be implemented on a computerized device as part of a packet exchange procedure for generating packets for wireless communication with another device. In some examples, the described procedure discusses a bi-directional transmission protocol that can be used in the data link layer as well as in the TCP (transport layer). Thus, two devices that are in wireless communication with each other may each employ the sending sliding window 202 for generating packets for transmitting to other devices. The sending sliding window mechanism may fill the sending sliding window 202 with data portions from IP packets, effectively splitting the IP packets into smaller packets that have a size that is based on the physical-layer data rate. The selection of data portions for each smaller packet may be based on which data portions in the sliding window have not been acknowledged and have not been retransmitted a maximum number of times. The smaller packets are passed to a lower layer in an ISO model or transmitted to a receiving device, where the received packets are reassembled into the larger IP packets. More specifically, the sending sliding window 202 is filled with data portions from upper-layer packets that are stored in queue 228. Queue 228 includes multiple IP packets 206a-f that each include multiple bytes (e.g., bytes 230a-d). The IP packets may be provided for wireless transmission to other computerized devices by several different computer programs. Each computer program may have different packet error rate and delay requirements. For example, error-free voice communication may not be prioritized as highly as is timely communication for voice-related transmissions. On the other hand, communications from an email application may not need to be as timely, but should be as accurate as possible. The sliding window 202 may be defined by a start position 208, end position 212, and current position 210 (all in the cyclic buffer 204). The start position 208 (a.k.a. the start offset for the window in the buffer) may designate the first byte of data in the sliding window, while the end positio... | 1 | < 0.1% |
| BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a perspective view of a battery according to an embodiment of the present invention; FIG. 2 is a front sectional view of the battery according to the embodiment of the present invention; FIG. 3 is a perspective view, seen from above, of a cover shown in FIG. 1; FIG. 4 is an exploded perspective view, seen from above, of the battery shown in FIG. 3; FIG. 5 is an enlarged view of a portion A shown in FIG. 2; FIG. 6 is an enlarged view of a portion B shown in FIG. 2; FIG. 7 is an exploded perspective view, seen from below, of the cover shown in FIG. 1; FIG. 8 is an exploded sectional view of FIG. 5; FIG. 9 is a sectional view showing a state where a positive external terminal is assembled to the cover from the state shown in FIG. 8; and FIG. 10 is a sectional view showing a state where a current collector is further assembled from the state shown in FIG. 9. CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority from Japanese Patent Application Nos. 2011-135166 and 2012-111398, the disclosure of which are incorporated herein by reference in their entireties. BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to an electric storage element and a production method thereof. 2. Description of the Related Art JP 2009-087727 A and JP 2009-087728 A each disclose a conventional battery configured such that each of a body and a distal end of a shaft of an external terminal is sequentially inserted into a through hole provided in a cover and a shaft through hole provided in an insulator with a gasket being interposed therebetween, and is then inserted into a shaft through hole provided in a first plate, and thereafter the distal end of the shaft is caulked, so that the cover, the insulator, and the first plate are held and integrated by the external terminal. Furthermore, JP 2009-087693 A discloses a configuration in which a rivet portion of a rivet is caulked so as to press a projecting contact body of a current collector, and then the rivet portion and the current collector are welded by laser beams to form a welded portion. However, in the configuration disclosed in JP 2009-087727 A and JP 2009-087728 A, the cover, the insulator, and the first plate are simply held and integrated by the external terminal. In addition, the gasket and the insulator are essentially provided in order to keep air tightness in the battery. Such a configuration leads to increase of the number of components and complicated production steps, thereby resulting in increase of production costs. JP 2009-087693 A merely refers to a feature in the configuration, that the rivet portion and the current collector are welded by laser beams, and the object thereof is to simply achieve a rigid fixed state. Furthermore, JP 2009-087693 A neither describes nor suggests air tightness. SUMMARY OF THE INVENTION It is an object of the present invention to provide an electric storage element and a production method thereof. Such an electric storage element has excellent air tightness and strong connection at a portion connected with an external terminal, and realizes high assembling performance, even in a simple configuration. According to a first aspect of the invention, an electric storage element includes a casing, an external terminal having a surface exposed outward from the casing, a current collector provided inside the casing and connected to the external terminal, and an electrode assembly provided inside the casing and connected to the current collector, wherein the casing has a through hole, and the external terminal includes a flange in contact with an outer surface of the casing, and a first shaft extending from the flange to be inserted into the through hole in the casing and welded thereto. This configuration has a welded portion where the first shaft as part of the external terminal is fitted into the through hole in the casing. Therefore, it is possible to secure sufficient air tightness with no need for any extra sealing member. According to a second aspect of the invention, the external terminal further includes a second shaft that has a diameter smaller than that of the first shaft, and extends from the first shaft to be fixed to the current collector. When the second shaft as part of the external terminal is simply fixed to the current collector, the casing and the current collector are integrated with each other with no need for any extra component or work, and electrical connection is achieved between the current collector and the casing. Moreover, the second shaft is smaller in diameter than the first shaft. Accordingly, the first shaft is easily inserted into the through hole in the casing to be welded thereto, while the work is not disturbed by the second shaft. According to a third aspect of the invention, the first shaft is inserted into the through hole in the casing, and with the flange being in contact with the outer surface of the casing, a stepped portion from the second shaft has a height substantially flush with an inner surface of the casing. This configuration further facilitates the work of welding the first shaft. The casing may comprise a battery case having an open surface, and a cover closing the opening of the battery case. The through hole of the casing may be provided in the cover. According to a fourth aspect of the invention, the cover has an engagement receiver swelled outward, and the current collector has a fitting portion that is located in corresponding one of the engagement receivers and has a through hole into which the first shaft is inserted to be welded thereto. According to a fifth aspect of the invention, the external terminal is a positive external terminal, and electrically connects the cover and the current collector when the current collector is fixed to the cover. The positive external terminal equalizes potential of the cover and that of the current collector, with no need for extra work such as welding in order to electrically connect the cover with the current collector. According to a seventh aspect of the invention, the first shaft is inserted into the through hole in the casing, and a contact portion therebetween is welded over the entire periphery. The contact portion therebetween is welded over the entire periphery, so that the strength at the contact portion is increased to keep an excellent support state. The electric storage element may be produced in the following manner. There is provided a method of producing an electric storage element including a casing, an external terminal having a surface exposed outward from the casing, a current collector provided inside the casing and connected to the external terminal, and an electrode assembly provided inside the casing and connected to the current collector, wherein the casing is configured by a battery case having an open surface and a cover closing the opening of the battery case, and the external terminal includes a flange, a first shaft extending from the flange, and a second shaft having a diameter smaller than that of the first shaft and extending from the first shaft. The method includes inserting the first shaft of the external terminal into a through hole provided in the cover, welding the first shaft of the external terminal to the through hole in the cover, inserting the second shaft of the external terminal into a through hole provided in the current collector, and caulking the second shaft of the external terminal so as to hold the cover and the current collector between the flange of the external terminal and the caulked second shaft. According to the present invention, the external terminal is provided with the first shaft, which is fitted into the through hole in the casing and is welded thereto, so as to integrate the current collector with the casing. Therefore, it is possible to secure air tightness at the portion connected with the external terminal as well as achieve electrical connection between the current collector and the casing, with no need for any extra component. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT Hereinafter, an embodiment of the present invention will be described with reference to the accompanying drawings. In the following description, terms indicating specific directions and positions (including above, below, side, end, and the like) are used as necessary. These terms are used just for the purpose of easier understanding of the invention with reference to the drawings, and these terms should not restrict by their meanings the technical scope of the present invention. Moreover, the following description provides merely an essential example, and should not be intended to restrict the present invention, application targets, or usage thereof. FIG. 1 shows a nonaqueous electrolyte secondary battery that exemplifies an electrochemical cell. As shown in FIG. 2, in the nonaqueous electrolyte secondary battery, a battery case 1 houses an electrode assembly 2 and is sealed with a cover 3. In this example, the battery case 1 and the cover 3 configure a casing. The battery case 1 has a rectangular parallelepiped shape with an open upper surface, and is made of aluminum, an aluminum alloy, or the like. Although not illustrated in detail, the electrode assembly 2 includes a positive electrode 4 made of aluminum foil, a negative electrode 5 made of copper foil, and a separator 6 made of a porous resin film and interposed between the positive electrode 4 and the negative electrode 5, similarly to a conventional electrode assembly. Each of these members has a belt shape, and the positive electrode 4 and the negative electrode 5 are each wound into a flat shape so as to be housed in the battery case 1 in a state where the positive electrode 4 and the negative electrode 5 are displaced from each other at the opposite ends in the width direction of the separator 6. As to be described later, a positive current collector 18 is connected to the positive electrode 4 with a clip 7 being interposed therebetween, and a negative current collector 19 is connected to the negative electrode 5 with a clip 7 being interposed therebetween. As shown in FIGS. 3 and 4, the cover 3 is made of a metal plate in a long rectangular shape in a planar view, and is provided, in the center thereof, with an opening 8 that has a substantially elliptical shape and is formed to be stepped from the upper surface. A metal safety valve 9 is attached into the opening 8. The safety valve 9 is provided with a thin portion in a substantially H letter shape. The thin portion is torn in a case of abnormal increase in internal pressure, so that the pressure can be decreased. The cover 3 has an end provided with a liquid injection hole 10 having a small diameter, and the liquid injection hole 10 is configured to be closed by a plug 11 after liquid is injected. The cover 3 is provided, at the two ends, with a first engagement receiver 12A and a second engagement receiver 12B, respectively. The first and second engagement receivers 12A and 12B each have a rectangular shape in a planar view and are swelled upward. The cover 3 has a lower surface provided with a guide recess 12b. Moreover, a through hole 12c is provided in the center of a ceiling surface configuring each engagement recess 12a. A current collector 13 and an external terminal 14 are attached directly to the first engagement receiver 12A. On the other hand, another current collector 13 and another external terminal 14 are attached to the second engagement receiver 12B with an upper gasket 15 and a lower gasket 16 being interposed therebetween, respectively. The cover 3 is provided, in the vicinity of inside the engagement receiver 12B in the longitudinal direction of the cover 3, with lock projections 17 that project upward from two positions in the width direction of the cover 3. Each of the lock projections 17 has a cylindrical shape provided with a bottom, and is formed at the same time when the cover 3 is pressed. The upper gasket 15, which is to be described later, is locked to the respective lock projections 17, so as to achieve positioning in a rotational direction. The current collectors 13 are provided as the positive current collector 18 made of aluminum and the negative current collector 19 made of copper. Each of the current collectors 13 is formed by pressing a long metal plate, so as to be provided with a connection receiver 20 and legs 21 that extend from respective ends of the connection receiver 20. The connection receiver 20 is configured by a fitting portion 22 that is located in the engagement recess 12a of the cover 3 and a seat 23 that is formed continuously from the fitting portion 22. The fitting portion 22 is made flat and is provided with a through hole 22a in the center thereof. The fitting portion 22 has a peripheral edge provided with a guide edge 24 that is located on three sides and extends perpendicularly from the fitting portion 22. The remaining side of the peripheral edge of the fitting portion 22 configures a continuous portion 25 that extends longer than the guide edge 24 so as to be provided continuously to the seat 23. The guide edge 24 and the continuous portion 25 sufficiently enhance rigidity of the connection receiver 20 of each of the current collectors 13. The legs 21 extend perpendicularly from the two opposite edges of the seat 23 so as to be located along both side surfaces of the electrode assembly 2. The legs 21 are connected to the positive electrode 4 or the negative electrode 5 of the electrode assembly 2 with the clip 7 (see FIG. 2) being interposed therebetween. Positional deviation can be prevented by the clip 7 that is held between the opposite inner surfaces of the battery case 1. The external terminals 14 are provided as a positive external terminal 28 and a negative external terminal 29. Each of the external terminals 14 is configured by a flat plate 30 and a shaft 31 extending downward from the center of the lower surface of the flat plate 30. A bus bar (not shown) is connected by welding to the upper surface (exposed surface) of the flat plate 30. The positive external terminal 28 is made of a conductive material such as aluminum and has a rivet shape and includes a flange 32, a first shaft 33, and a second shaft 34. The flange 32 has a rectangular shape in a planar view. The first shaft 33 projects from the center of the flange 32, and the second shaft 34 has a diameter smaller than that of the first shaft 33 and projects from the center of the first shaft 33. The first shaft 33 is sized to have an outer diameter so as to be located in the through hole 12c in the first engagement receiver 12A provided on the cover 3 with no or substantially no gap being formed therein. The first shaft 33 is formed to have a height such that a stepped portion 35 between the first shaft 33 and the second shaft 34 is substantially flush with the inner surface of the cover 3 in a state where the first shaft 33 is inserted into the through hole 12c and the flange 32 is in contact with the outer surface of the cover 3. The first shaft 33 is inserted into the through hole 12c in the cover 3, and the contact portion therebetween is welded over the entire periphery in this state (by laser welding, micro TIG welding, or the like). Accordingly, the positive external terminal 28 can be attached to the cover 3 so as to sufficiently enhance air tightness, with no need for any extra member. The second shaft 34 is sized to have an outer diameter so as to be inserted into the through hole 22a in the current collector 13, preferably with no or substantially no gap being formed therebetween. The second shaft 34 is inserted into the through hole 22a in the current collector 13 and is caulked in a state where the inner surface (lower surface) of the engagement recess 12a configuring the first engagement receiver 12A on the cover 3 is in surface contact with the upper surface of the current collector 13. In this configuration, the current collector 13 is fixed by the positive external terminal 28 welded to the cover 3, such that the current collector 13 is in intimate contact with the engagement recess 12a in the cover 3. In this state, the welded portion between the outer peripheral edge of the first shaft 33 and the inner peripheral edge of the through hole 12c in the cover 3 is completely covered with the fitting portion 22 of the positive current collector 18. Therefore, the welded portion can be kept in a favorable state. On the other hand, the entire negative external terminal 29 is made of copper, and the flat plate 30 and the shaft 31 are formed integrally with each other. The upper gasket 15 is made of a synthetic resin, such that the inner space of a frame having a rectangular shape in a planar view is divided by a partition 36 into an upper terminal holding recess 37 and a lower attachment recess 38. Tongue pieces 39 extend laterally from one of sides configuring an edge of a lower opening. Provided in the center of the partition 36 is a cylindrical portion 36a that extends downward from the ceiling surface. The cylindrical portion 36a is inserted into the through hole 12c in the second engagement receiver 12B and is fitted into a through hole 40a provided in the lower gasket 16. Lock holes 39a are provided in the two tongue pieces 39, into which the lock projections 17 on the cover 3 are inserted, respectively. The upper gasket 15 is provided along the second engagement receiver 12B that is located on the cover 3 and has a rectangular shape in a planar view, so that positional deviation of the upper gasket 15 can be prevented in the rotational direction by simply mounting the upper gasket 15 on the engagement receiver 12B. In addition, the lock projections 17 are inserted respectively into the lock holes 39a, so as to securely prevent such positional deviation in the rotational direction. The lower gasket 16 is made of a synthetic resin, has a rectangular plate shape in a planar view, and is provided, in the center thereof, with a through hole 16a. The lower gasket 16 is located in the engagement recess 12a configuring the engagement receiver 12B, so as to seal the through hole 12c provided therein. Reference is made next to a method of assembling a battery having the configuration described so far. At the engagement receiver 12A on the cover 3, as shown in FIG. 8, the second shaft 34 of the positive external terminal 28 is inserted into the through hole 12c from the outer surface (upper surface) of the engagement recess 12a, and as shown in FIG. 9, the flange 32 is brought into contact with the outer surface of the engagement recess 12a. In this state, the first shaft 33 is located in the through hole 12c, and the stepped portion 35 at the boundary between the first shaft 33 and the second shaft 34 is made substantially flush with the lower surface of the cover 3. Then, the adjacent (contact) portion between the outer peripheral surface of the first shaft 33 and the inner peripheral surface of the through hole 12c is sealed by laser welding or the like. Accordingly, the positive external terminal 28 is integrated to the cover 3, and also improved is air tightness in the through hole 12c, into which the first shaft 33 is inserted. The sealed portion is not the peripheral edge where the second shaft 34 projects, but the peripheral edge of the through hole 12c in the cover 3, in other words, a flat surface. This configuration facilitates the sealing work even by welding (in the case of laser welding, laser beams can be applied easily). Moreover, the sealed portion can be made flat with no projection being formed (even with any projection, the sealed portion can be refined easily). As shown in FIG. 10, the fitting portion 22 of the connection receiver 20 configuring the current collector 13 is located in the engagement recess 12a in the first engagement receiver 12A, and the second shaft 34 of the positive external terminal 28 is inserted into the through hole 22a. The second shaft 34 is then caulked, so that, as shown in FIG. 5, the cover 3 and the fitting portion 22 of the current collector 13 are pressed against each other and are kept electrically connected to each other. At the second engagement receiver 12B on the cover 3, as shown in FIG. 6, the attachment recess 38 in the upper gasket 15 is attached to cover the swelled portion due to provision of the engagement recess 12a. In this state, the cylindrical portion 36a of the upper gasket 15 is attached into the through hole 12c in the cover 3, and the lock projections 17 on the cover 3 are locked into the lock holes 39a provided in the tongue pieces 39 of the upper gasket 15, respectively. The lower gasket 16 and the fitting portion 22 of the current collector 13 are sequentially located in the engagement recess 12a in the cover 3, and the shaft 31 of the negative external terminal 29 is inserted into the cylindrical portion 36a of the upper gasket 15, the through hole 16a in the lower gasket 16, and the through hole 22a in the fitting portion 22 of the current collector 13. Thereafter, the shaft 31 of the negative external terminal 29 is caulked, so that the upper gasket 15, the cover 3, the lower gasket 16, and the current collector 13 are held so as to be sandwiched thereby. On the other hand, the separator 6 is located between the positive electrode 4 and the negative electrode 5, and the positive electrode 4 and the negative electrode 5 are each wound into a flat shape in a state where the positive electrode 4 and the negative electrode 5 are displaced from each other at the opposite ends in the width direction of the separator 6, thereby to form the electrode assembly 2. The electrode assembly 2 thus formed is located between the legs 21 of the respective current collectors 13 that are fixed to the cover 3, and each of the positive electrode 4 and the negative electrode 5 is electrically connected with the corresponding legs 21 by means of the corresponding clip 7. The electrode assembly 2 thus connected to the legs 21 is housed in the battery case 1 together with a nonaqueous electrolyte. Thereafter, the edge of the opening of the battery case 1 and the cover 3 are sealed to each other by welding, so that a complete battery is obtained. It is noted that the present invention is not limited to the configuration described in the above embodiment, but can be modified in various manners. For example, in the above embodiment, the current collector 13 is caulked and fixed, by the positive external terminal 28, to the engagement recess 12a provided in the cover 3. Alternatively, the current collector 13 may be caulked and fixed, by the positive external terminal 28, to the cover 3 having a flat shape provided with no engagement recess 12a. Furthermore, the above embodiment refers to the battery as an example of an electric storage element. Alternatively, the present invention is applicable in a similar manner to a capacitor or the like. The structures of the external terminals 14 for the battery according to the present invention may be applied to various batteries such as a lithium ion battery and a lead storage battery. | 1 | < 0.1% |
| BRIEF DESCRIPTION OF THE DRAWINGS Many aspects of the disclosure can be better understood with reference to the following drawings. The components in the drawings are not necessarily to scale, emphasis instead being placed upon clearly illustrating the principles of the present disclosure. Moreover, in the drawings, like reference numerals designate corresponding parts throughout the several views. While several embodiments are described in connection with these drawings, the disclosure is not limited to the embodiments disclosed herein. On the contrary, the intent is to cover all alternatives, modifications, and equivalents. FIG. 1 is a system diagram illustrating an example of an equipment enclosure system. FIG. 2 is a system diagram illustrating an example of an equipment enclosure system. FIG. 3 is a system diagram illustrating an oblique projection of an example of an equipment enclosure system. FIG. 4 is a view diagram illustrating examples of raised contact nodes. FIG. 5 is a flow diagram illustrating a method of manufacturing an equipment enclosure system. FIG. 6 is a system diagram illustrating an oblique projection of an example of a modular visualization display panel. TECHNICAL FIELD Aspects of the disclosure are related to the field of equipment enclosures and enclosure interfacing, and in particular, electrostatic discharge (ESD) protection in modular equipment. TECHNICAL BACKGROUND Equipment enclosures are typically employed to encase electronic components, such as circuit card assemblies, printed circuit boards, discrete electrical components, or other electrical equipment. The equipment enclosures provide protection from the surrounding environment, such as dust, dirt, vibration, electrical interference, or other environmental protection. Also, when electronic equipment is used in human-equipment environments, such as when a human operator must interact with the equipment, electrostatic discharge (ESD) events can occur. ESD events can include static electrical discharges from a human operator or handler of electronic equipment to the equipment itself, among other events. The ESD energy typically follows a path to an electrical ground from the ESD source, such as a finger or clothing. However, the ESD energy may pass through sensitive electrical components, such as integrated circuits, along the path to electrical ground, either causing temporary disruption or permanently damaging the sensitive equipment. In modular equipment, such as when multiple equipment enclosures are stacked to form the equipment, gaps can exist between the enclosures or modules which can allow ESD energy to be transported along unpredictable or undesirable routes. Conductive gaskets, foams, or meshes can aid in sealing the gaps between modules. However, these gaskets add manufacturing costs and extra parts to equipment assemblies, and can be unsuited for certain environmental or industrial conditions. Overview What is disclosed is a modular visualization display panel. The modular visualization display panel includes a first module having at least one surface and a connection to electrical ground. The modular visualization display panel also includes a second module having at least one surface with a plurality of raised contact nodes arranged on the one surface of the second module such that when in contact with the one surface of the first module electrostatic discharge energy is directed over at least one of the raised contact nodes to the one surface of the first module. What is also disclosed is a visualization display panel module which includes a first module having at least one surface, and a plurality of raised contact nodes arranged on the one surface of the first module such that when in contact with a surface of a second module electrostatic discharge energy is directed over at least one of the raised contact nodes to the one surface of the second module. What is also disclosed is a method of manufacturing a modular visualization display panel. The method includes forming a first casing from a first metal to enclose electronic circuits, where the first casing comprises a first mating surface and a plurality of raised protrusions extending beyond the first mating surface. The method also includes forming a second casing from a second metal, where the second casing comprises a second mating surface. The method also includes coupling the first mating surface of the first casing to the second mating surface of the second casing through the raised protrusions, where the raised protrusions contact the second mating surface to discharge electrostatic discharge energy thereto DETAILED DESCRIPTION FIGS. 1 and 2 are system diagrams illustrating equipment enclosure system 100. Equipment enclosure system 100 could comprise a modular equipment enclosure system, such as a modular visualization display panel, human-machine interface equipment, computer system enclosure, control panel enclosure system, graphics terminal, operator panel, operator interface, or industrial computer, among other modular equipment enclosures. FIGS. 1 and 2 include first module 110, second module 120, and raised contact nodes 130-132. FIG. 2 also includes ESD source 140, electrostatic discharge 142, and discharge paths 150. First module 110 includes at least one surface and a connection to electrical ground 115. The one surface of first module 110 in this example is the surface shown facing second module 120, although other surfaces could be referenced. Electrical ground 115 includes an electrical connection to a ground potential for electrical equipment associated with first module 110 or second module 120. Electrical ground 115 could include a chassis ground, digital ground, analog signal ground, neutral lead, common lead, or other electric reference potential connection. Second module 120 also includes at least one surface. The one surface of second module 120 in this example is the surface shown facing first module 110, although other surfaces could be referenced. The one surface of second module 120 includes raised contact nodes 130-132 arranged on the one surface of second module 120 such that when in contact with the one surface of first module 110, electrostatic discharge (ESD) energy is directed over at least one of raised contact nodes 130-132 to the one surface of first module 110. Although raised contact nodes 130-132 are arranged on the one surface of second module 120 in this example, it should be understood that raised contact nodes 130-132 could instead be arranged on the one surface of first module 110 in other examples, including combinations of arrangements thereof. First module 110 and second module 120 could each be comprised of a conductive material, such as a metal composition. In other examples, first module 110 or second module 120 could be partly comprised of a non-conductive material, and the one surface of each module is comprised of a conductive material. First module 110 and second module 120 could each enclose electrical circuits, circuit card assemblies, printed circuit boards, subassemblies, user-accessible ports, displays, user-interface equipment, or other electrical or mechanical equipment. Either of first module 110 and second module 120 could act as a Faraday cage surrounding electronic components. Although first module 110 and second module 120 are shown in FIGS. 1 and 2 in a two-dimensional side view representation for clarity, it should be understood that first module 110 and second module 120 could have been shown as three-dimensional enclosures, such as casings, equipment chassis, or other equipment enclosures, with raised contact nodes 130-132 arranged along a seam or edge of first module 110 or second module 120. Raised contact nodes 130-132 each comprise raised protrusions or bumps above the one surface of second module 120, disposed on the one surface of second module 120. In some examples, raised contact nodes 130-132 are each formed from the same material as the one surface of second module 120, such as being machined from the same piece of material or formed in the same casting. In typical examples, raised contact nodes 130-132 each comprise a conductive material, such as a metal composition. The conductive material could be of the same composition as the one surface of second module 120, the same composition as the one surface of first module 110, or of a different composition. It should be understood that the shape of raised contact nodes 130-132 shown in FIGS. 1 and 2 is merely representative of the raised protrusions above the one surface of second module 120. Other shapes could be employed for each of raised contact nodes 130-132, such as a polyhedron, pyramid, dome, round, oblate spheroid, half-ovate, ellipsoid, hemisphere, spike, tapered, teardrop, or portions thereof. FIG. 2 includes ESD source 140, as represented by a finger. Other sources of ESD energy could be employed, such as clothing, equipment, peripheral connectors, peripheral equipment, or other environmental sources. ESD source 140 discharges electrical energy as an electrostatic discharge 142 into equipment enclosure system 100. The first point where the ESD energy is transferred into equipment enclosure system 100 is on second module 120. Exemplary discharge paths are shown in FIG. 1, namely discharge paths 150. In this example, the ESD energy is discharged along discharge paths 150 through second module 120, over raised contact nodes 130-131, and to first module 110. Since first module 110 is connected to electrical ground 115, the ESD energy is eventually discharged to electrical ground 115 once conducted to first module 110. It should be understood that other electrostatic discharge paths could have been taken by electrostatic discharge 142, and discharge paths 150 are merely representative of possible paths through at least one of raised contact nodes 130-132. ESD energy may follow the outer surface of enclosure 120 to raised contact nodes 130-132. Typically, ESD energy will follow the path of least resistance to a lower voltage potential, such as electrical ground 115. Without raised contact nodes 130-132, the ESD energy of electrostatic discharge 142 would find an undesirable, unpredictable path to electrical ground 115 or to other ground potentials. This undesirable path could include a path through electronic circuits, or elements thereof, such as decoupling capacitors, integrated circuits, transient protection circuitry, printed circuit boards, printed circuit board mounting elements such as standoffs and screws, or other undesirable paths. However, with the addition of conductive bumps, such as raised contact nodes 130-132, the ESD energy of electrostatic discharge 142 is directed through second module 120 and along at least one of raised contact nodes 130-132 through discharge paths 150 to electrical ground 115. The elements of electronic circuits of first module 110 or second module 120 are thus protected from ESD energy. The enclosure-to-enclosure discharge pathway is shown in this example, and thus sensitive electronic circuitry is not traversed with excess ESD energy. In other examples, the ESD energy may only be partially carried by surfaces of the enclosures or modules, and individual internal electrical components may still receive some exposure to ESD energy. However, individual internal electrical components would instead be only exposed to less than the total ESD energy of electrostatic discharge 142 due to multiple discharge paths by placement of raised contact nodes. For example, individual ones of discharge paths 150 could traverse electrical circuitry of second module 120 or first module 110. However, since the total ESD energy is dispersed across multiple ones of raised contact nodes 130-132, individual components in the electrical circuitry may only see a portion of the total ESD energy. Further examples are discussed herein. FIG. 3 is a system diagram illustrating an oblique projection of equipment enclosure system 300. Equipment enclosure system 300 is a modular equipment enclosure system, which includes logic module 310 and communication module 320. Logic module 310 and communication module 320 join together in a stackable configuration, where each module mates with the other along a mating surface, namely first mating surface 311 for logic module 310 and second mating surface 321 for communication module 320. Portions of logic module 310 and communication module 320 could overlap each other when joined in some examples. Although two modules are shown in FIG. 3, equipment enclosure system 300 could include further stacked modules or different modules, such as a display module, user interface module, machine interface module, control panel, or other modules. Also, although logic module 310 and communication module 320 are shown a distance apart in FIG. 3, both modules would be joined closely to each other in normal usage. The semi-exploded view in FIG. 3 is employed for clarity. In this example, logic module 310 includes electronic logic portions, such as processing system portions or user-interface portions and includes peripheral port 312. Peripheral port 312 is a user-accessible connection for a peripheral device, such as for connecting a keyboard, mouse, storage device, or other peripheral for use with logic module 310. In this example, peripheral connector 340 is intended to mate with peripheral port 312. Peripheral port 312 could be a universal-serial bus (USB) port, Ethernet port, flash memory interface, mass storage device interface, serial port, video port, audio port, or other data input or output port. In typical examples, peripheral port 312 includes a conductive surround or shield portion which allows for a conductive physical connection between elements of peripheral port 312 with the case of logic module 310, such as a metallic shield surrounding the signaling pins, power pins, or electrical contacts of peripheral port 312. Logic module 310 also includes conductive bumps 315. Conductive bumps 315 are disposed along a first edge of first mating surface 311. The first edge could be the longest linear edge of first mating surface 311 although other configurations could be employed, such as an edge with the greatest potential or possibility for physical or electrical gapping, as in the longest mating edge, the most curved edge, or the edge with the most complex edge features, among others. Logic module 310 and communication module 320 join together in a stackable configuration, and couple through conductive bumps 315. Conductive bumps 315 allow discrete modules to electrically interface through conductive bumps 315, namely second mating surface 321 of communication module 320 contacts first mating surface 311 of logic module 310 through conductive bumps 315. When first mating surface 311 is in contact with second mating surface 321, electrostatic discharge (ESD) energy received by logic module 310 is directed over at least one of conductive bumps 315 to second mating surface 321. Conductive bumps 315 each comprise halved-ellipsoid raised protrusions which protrude above first mating surface 311. In this example, conductive bumps 315 are each formed from the same material as first mating surface 311, such as being machined from the same piece of material or formed in the same casting. Conductive bumps 315, and likewise first mating surface 311, comprise a conductive material, such as a metal composition. The conductive material could be of the same composition as second mating surface 321, or a different composition. Communication module 320 also encloses electronic circuit portions, which may include similar or different types of electronic circuit portions as logic module 310. Communication module 320 interfaces elements of logic module 310 to further systems and equipment through interface cable 325. Communication module 320 is attached electrically to interface cable 325 in this example. The electrical connection could be achieved through a ground wire, shield, braid, or other conductive coupling to interface cable 325. Interface cable 325 could include further elements, such as signaling wires, optical fiber, communication cables, or other communication, power, or grounding elements. In this example, interface cable 325 is also in electrical connection with a ground potential, not shown for clarity. When ESD energy is received by second mating surface 321, the ESD energy is conducted by communication module 320 to interface cable 325 for discharge to a ground potential. In this example, logic module 310 and communication module 320 are each modular cases, used to enclose electronic circuit portions, among other portions, and each includes a mating surface, namely first mating surface 311 and second mating surface 321. The portions that each of logic module 310 and communication module 320 encase might only be partially encased in some examples. Also in this example, second mating surface 321 is formed from the same piece of material as the case of communication module 320. Likewise, first mating surface 311 and conductive bumps 315 are formed from the same piece of material as the case of logic module 310. The ESD source is shown as peripheral connector 340 in FIG. 3. Other sources of ESD energy could be employed, such as clothing, humans, equipment, or other environmental sources. Peripheral connector 340 discharges electrical energy as an electrostatic discharge 342 into equipment enclosure system 300. The first point where the ESD energy is transferred into equipment enclosure system 300 is at peripheral port 312 of logic module 310. In this example, the ESD energy is discharged through a shield or surround portion of peripheral port 312 or peripheral connector 340 to the outside case surface of logic module 310 and then to first mating surface 311. First mating surface 311 includes conductive bumps 315, which contact second mating surface 321, and the ESD energy is discharged across at least one of conductive bumps 315 to second mating surface 321. The ESD energy is further discharged through communication module 320, such as along the outer case surface of communication module 320 to interface cable 325. It should be understood that other electrostatic discharge paths be taken by electrostatic discharge 342. For example, individual electrical components within logic module 310 or communication module 320 may still receive some exposure to ESD energy, but instead be only exposed to less than the total ESD energy of electrostatic discharge 342 due to multiple discharge paths dispersing the total ESD energy over multiple conductive bumps 315. In this manner, any individual internal electrical component may see only a portion of the total ESD energy, as individual portions of the total ESD energy are directed through different discharge paths by individual ones of conductive bumps 315. FIG. 4 is a view diagram of illustrating examples of raised contact nodes. In FIG. 4, three examples of raised contact nodes are shown, although further configurations could be used. Each of the examples is shown in a side view and an end view to illustrate the shape of the raised contact nodes. Also, each of the examples could be comprised of the various materials described herein. The first example is rounded bump 400, the second example is penetrating protrusion 410, and the third example is tapered bump 420. Rounded bump 400 comprises a smooth, contoured top edge, similar to a halved ellipsoid or ovoid shape. Rounded bump 400 is disposed on a surface by the flat bottom side of rounded bump 400, and configured to contact a mating surface through the contoured top side. Rounded bump 400 could be configured to deform the mating surface when in contact with the mating surface. Penetrating protrusion 410 comprises a sharp, angled top edge, similar to a truncated pyramid or knife shape. Penetrating protrusion 410 is disposed on a surface by the flat bottom side of penetrating protrusion 410, and configured to penetrate a mating surface through the sharp top side. Penetrating protrusion 410 could be configured to penetrate partially into a mating surface, possibly through a non-conductive layer of the mating surface to reach a conductive later of the mating surface. Tapered bump 420 comprises a smooth, tapered top edge, similar to a halved teardrop shape. Tapered bump 420 is disposed on a surface by the flat bottom side of tapered bump 420, and configured to contact a mating surface through the tapered top side. Tapered bump 420 could be configured to deform the mating surface when in contact with the mating surface. FIG. 5 is a flow diagram illustrating a method of manufacturing an equipment enclosure system, such as equipment enclosure system 100, equipment enclosure system 300, or modular visualization display panel 600, although other configurations could be employed. The method of FIG. 5 could be employed in manufacturing a modular equipment enclosure system, such as a modular human-machine interface system, modular visualization display panel system, modular control panel, or other modular electronic enclosure system. In FIG. 5, operation 501 includes forming a first casing from a first metal to enclose electronic circuits, where the first casing comprises a first mating surface and a plurality of raised contact nodes protruding beyond the first mating surface. In some examples, the first casing is machined from a bulk piece of material, such as a metal or metal alloy. In other examples, the first casing is cast in a mold using a metal or metal alloy. The first casing could include a hollow portion to encase or otherwise contain electronic circuitry, mechanical equipment, or other user-interface, processing, or communication equipment. The first mating surface could be any of the surfaces of the first casing, intended for mating or joining with another casing, mounting plate, or module, to form a stacked configuration with the first casing. The plurality of raised contact nodes are disposed over the first mating surface, and configured to protrude above the first mating surface. The raised contact nodes could be raised protrusions, bumps, or other localized individual protrusions above the first mating surface. In typical examples, the raised contact nodes are disposed along a single outer edge of along the perimeter of the first mating surface. In further examples, the raised contact nodes are disposed along multiple edges of the first mating surface, or along the entire perimeter of the first mating surface. Raised contact nodes could also be disposed along internal portions of the first mating surface. The raised contact nodes could be formed from the first mating surface, such as being formed from the same bulk material as the first mating surface or the first casing, and thus could comprise the same metal or metal alloy. In examples of machining, the raised contact nodes would be machined from the same bulk piece of material, such as with a lathe or computer-aided machining equipment. In examples of casting, impressions of the raised contact nodes could be integrated into the mold so as to form from the same material as the first casing when the material is injected into the mold. In yet further examples, the raised contact nodes are formed separately from the first mating surface or the first casing and attached to the first mating surface, such as using fasteners, conductive adhesive, welds, solder, or other electrically conductive attachment techniques. In even further examples, the raised contact nodes could be formed from welds or solder material itself. Operation 502 includes forming a second casing from a second metal, where the second casing comprises a second mating surface. In some examples, the second casing is machined from a bulk piece of material, such as a metal or metal alloy. In other examples, the second casing is cast in a mold using a metal or metal alloy. As with the first casing, the second casing could include a hollow portion to encase or otherwise contain electronic circuitry, mechanical equipment, or other user-interface, processing, or communication equipment. The second mating surface could be any of the surfaces of the second casing, intended for mating or joining with another casing, mounting plate, or module, to form a stacked configuration with the second casing. Operation 503 includes coupling the first mating surface of the first casing to the second mating surface of the second casing through the raised contact nodes, where the raised contact nodes contact the second mating surface to discharge electrostatic discharge energy between the first mating surface and the second mating surface. The first casing is joined to the second casing in a stacked configuration in this example, where the first casing joins to the second casing at the associated mating surfaces. The first casing and the second casing could be joined to each other by fasteners, such as screws, or by an adhesive, weld, or other coupling devices or materials, including combinations thereof. The raised contact nodes of the first mating surface conductively contact the second mating surface, and thus conductively couple the first mating surface to the second mating surface. Other points of conductive contact could exist between the first mating surface and the second mating surface. However, the raised contact nodes typically provide a less-resistive path or a more repeatable conductive path for electrical contact between the two surfaces. In some examples, the raised contact nodes are configured to deform the second mating surface when the first casing is coupled to the second mating surface. In further examples, the raised contact nodes are configured to penetrate the second mating surface when the first casing is coupled to the second mating surface. The penetration depth could be partial or total into the second mating surface. The second mating surface could comprise a non-conductive layer deposited over a conductive layer, such as a coating, paint, anodized layer, or other non-conductive layer over a metal or metal alloy. In examples of a partial penetration depth, the raised contact nodes could be configured to penetrate the non-conductive layer of the second mating surface, such as a coating, paint, anodized layer, or other non-conductive layer, and make electrical contact with another layer of the second mating surface, such as the underlying bulk conductive material of the second casing. The material composition of any of the first casing, first mating surface, second casing, second mating surface, or raised contact nodes could each comprise any conductive material, such as such as a metal, a metal alloy, composite material, laminated material, or could comprise polymers or other non-conductive materials impregnated with conductive particles, fibers, or plates. The metal or metal alloys could include aluminum, magnesium, iron, steel, zinc, beryllium, or any other electrically conductive metal, alloy, or composite material, including combinations thereof. In further examples, the first mating surface and the second mating surface are each comprised of different metal compositions. The different metal compositions could be susceptible to galvanic corrosion, such as when using dissimilar metals. The raised contact nodes could be comprised of an intermediate material composition, and a different composition than both the first mating surface and the second mating surface. The composition of the raised contact nodes could include a metal or metal alloy which is compatible with both the first mating surface and the second mating surface, thus acting as a conductive buffer between the dissimilar metals of the first mating surface and the second mating surface. The raised contact nodes could thus prevent or reduce galvanic corrosion of the first mating surface or second mating surface. Also, redox potentials could be brought closer by the material selection discussed herein to ensure that galvanic corrosion will be minimized. When a different material composition is used for the raised contact nodes, the raised contact nodes could be formed separately from the first mating surface and attached with welds, conductive adhesives, solder, or other attachment techniques. The raised contact nodes are employed to transfer ESD energy from the first mating surface to the second mating surface, and likewise from the first casing to the second casing. Furthermore, the raised contact nodes are employed to disperse the ESD energy over multiple discharge paths. The raised contact nodes can augment other ESD protection schemes, which could include mechanical elements such as conductive gaskets, conductive meshes, conductive fingers, or electrical protection devices such as transient voltage suppression (TVS) diodes, varistors, gas discharge tubes, capacitors, resistors, inductors, or other mechanical or electrical electronic transient protection schemes and elements, including combinations thereof. FIG. 6 is a system diagram illustrating a modular visualization display panel 600. Modular visualization display panel 600 is a modular equipment enclosure system, which includes communication module 610, logic module 620, and display module 630. Communication module 610, logic module 620, and display module 630 join together in a stackable configuration, where each module joins with another along opposing mating surfaces. Although three modules are shown in FIG. 6, modular visualization display panel 600 could include further stacked modules or different modules. Also, FIG. 6 shows modular visualization display panel 600 in an exploded view for clarity, and the individual modules would be joined closely to each other in normal usage. Each module of modular visualization display panel 600 includes a casing which surrounds internal components of each module. The individual casings also include holes for ventilation and inter-module fasteners. It should be understood that the naming of each module is merely for clarity and should not imply a necessary function of the module. In this example, logic module 620 includes electronic logic portions, such as processing system portions or user-interface portions and also includes raised contact nodes 621 and user ports 625. The electronic logic portions of logic module 620 are encased in a casing of logic module 620, which comprises a metallic material, such as aluminum. Serpentine air ventilation channels are also formed from the casing of logic module 621, as shown on the left top side of logic module 620. It should be understood that other examples may lack the ventilation channels. The casing of logic module 620 includes user ports 625. User ports 625 are user-accessible connections for peripheral devices, such as for connecting a keyboard, mouse, storage device, network cable, serial cable, or other peripherals for use with modular visualization display panel 600. Each of user ports 625 includes a conductive surround or shield portion which allows for a conductive physical connection between grounding elements of user ports 625 with the case of logic module 620, such as a metallic shield surrounding the signaling pins, power pins, or electrical contacts of user ports 625. The casing of logic module 620 also includes raised contact nodes 621. Raised contact nodes 621 are disposed at periodic... | 1 | < 0.1% |
| BRIEF DESCRIPTION OF THE DRAWINGS Other characteristics will become apparent on reading the nonlimiting detailed description given by way of example which follows in relation to appended drawings which represent: FIG. 1 , a diagram presenting an exemplary network on which the method according to the invention may be implemented; FIG. 2 , a diagram illustrating an exemplary path taken by data in a network in which the method according to the invention is implemented; FIG. 3 , an example of macro-mobility handled by virtue of the method according to the invention. CROSS-REFERENCE TO RELATED APPLICATION This application claims priority to foreign French patent application No. FR 1102965, filed on Sep. 30, 2011, the disclosure of which is incorporated by reference in its entirety. FIELD OF THE INVENTION The present invention relates to a method for guaranteeing with a high level of reliability the continuity of the communications operated from a fourth-generation (4G) mobile terminal linked to a level-3 interconnection network, in the terminology defined by the OSI (Open Systems Interconnection). The invention applies notably to the mobility of mobile terminals in a context which is highly intolerant to faults, for example for networks used by military forces, public bodies, or civil agents such as the police, fire brigade or civil security. In particular, the invention may be implemented in networks liable to experience breaks in communication links in the interconnection network. BACKGROUND The computerized networks used by fourth-generation (4G) mobile terminals comprise radio sub-networks, sometimes designated by the initials RAN for Radio Access Network, which are hooked up to an interconnection network, also called a CSN (Connectivity Service Network), the CSN being linkable to the Internet. A fourth-generation mobile terminal is identified by an IP (Internet Protocol) address which allows it to receive and to send data across the whole of the computerized network. The mobile terminal is under the coverage of an antennal station, also called a base station. A RAN is formed of a set of base stations whose coverages supplement one another so as to cover a territory. Between the mobile terminal and the base station, the data are transmitted in the form of radioelectric waves and then the base station transmits the data, generally via optical fibers or cables, to a gateway interfacing between a RAN and a CSN. As a general rule, several base stations are controlled by one and the same control station. Such a control station fulfills several roles, notably the filtering of packets, the management of service quality, the authentication of users, the control of the base stations. When the mobile terminal moves and exits the zone covered by a first base station under the coverage of which it was situated, the communications are ensured by a second base station whose coverage is adjacent to the first. If the second base station is connected to the same control station as the first base station, one speaks of micro-mobility. In the case where the mobile terminal moves to a second base station which is connected to a control station different from the first control station, the term macro-mobility is employed. The present invention deals more particularly with problems of continuity of communications within the framework of the macro-mobility of mobile terminals. A protocol, called MIP for Mobile IP, is known for managing the macro-mobility of mobile terminals on WiMax networks. MIP relies on the HA (Home Agent) and FA (Foreign Agent) functions which are software modules executed by routers at the level of the IP network layer (layer 3). The HA function makes it possible to receive and to steer data packets intended for the mobile terminal, including when the latter leaves its initial gateway. The FA function is executed by a router for relaying the data packets up to the mobile terminal. The HA function is an anchoring point for the mobile terminal in the CSN and this anchoring point persists as long as the mobile terminal is under the coverage of a RAN, whatever the base station to which it is connected. The HA function is generally executed by a single router of the CSN and thus constitutes a significant point of weakness. Hence, if a movement of the mobile terminal entails a change of control station, and if the router executing the HA function is not reachable from the new gatewayfor example, if several communication links are cut, the communication may not be maintained, despite the optional duplication mechanisms implemented. Hence, although the MIP protocol can constitute a solution in a centralized environment, it is not suited to networks with strong reliability constraints, such as for example private mobile radio or PMR. A technique described in the French application published under the number FR2953357 has already been proposed for solving the problems of macro-mobility in a context of high reliability. However, this technique is less optimized when the interconnection network operates at the level of the IP layer, that is to say when the network uses IP routers rather than level-2 Ethernet switches. SUMMARY OF THE INVENTION An aim of the invention is to propose a reliable method for ensuring the continuity of communication of a mobile terminal moving around in a network comprising control stations linked by an interconnection network operating at the level of layer 3 of the ISO model. For this purpose, the subject of the invention is a method for guaranteeing the continuity of the communications operated from a fourth-generation mobile terminal connected to a radio network provided with several base stations with which said terminal is able to communicate, a base station being affiliated to a controller from among several controllers linking said radio network to an interconnection network comprising routers operating at the level of the IP layer, at least one controller being connected to at least one gateway configured to encapsulate in IP packets all the IP packets arising from the radio network before broadcasting them over the interconnection network, the method comprising at least the following steps: * when a mobile terminal connects to a base station affiliated to a controller to which the mobile terminal was not affiliated hitherto, said controller transmits to a gateway a level-2 message comprising at least the IP address of the mobile terminal, * said gateway creates, at the level of the IP layer, a message comprising the IP address of said mobile terminal and the IP address of said gateway in the interconnection network, * said IP message is broadcast by said gateway to destination gateways associated with the other controllers, each of said destination gateways storing a correspondence between the IP address of the mobile terminal and the IP address of the sending gateway associated with the controller to which the mobile terminal is affiliated. The method according to the invention makes it possible to permanently update the mobility management function, which is distributed throughout the network. Thus, if a control station becomes defective, only the sub-network of radio stations becomes inoperative, the other sub-networks of radio stations not being affected due to the fact that the mobility management function is ensured by each controller independently of one another. According to one embodiment, the level-2 message sent by the controller comprises a correspondence between the IP address of the mobile terminal and the level-2 address of said controller. According to an implementation of the method according to the invention, the gateways are accessible through at least two different IP addresses, a first IP address being known to the nodes of the radio network, a second IP address being known to the nodes of the interconnection network, in which all the IP packets arising from a controller are systematically transmitted to the gateway with which it is associated, said gateway encapsulating said IP packets in other IP packets whose destination IP address is the second address of a destination gateway. Thus in a communication between two mobile terminals each connected to a different base station, the stations being affiliated to different controllers, all the IP data packets transmitted by the first mobile terminal are encapsulated by IP packets of higher level in the gateway associated with the first controller, these IP packets of higher level being transmitted to the gateway associated with the controller to which the second mobile terminal is affiliated. The IP packets are thereafter de-encapsulated, in such a way that the gateway associated with the second controller transmits the initial IP packets to the second controller, and then to the second mobile terminal. According to an implementation of the method according to the invention, each controller is connected to a gateway specific to this controller. This gateway makes it possible at one and the same time to ensure the function for signaling the mobility of the mobile terminals, and also the function for guiding the IP data traveling through the interconnection network. According to an implementation of the method according to the invention, each gateway is connected to the controller at which it is located by way of at least one IP router included in the interconnection network, said router being configured to systematically guide all the IP packets or level-2 messages to said gateway, prior to their encapsulation and broadcasting in the interconnection network. According to an implementation of the method according to the invention, after the encapsulation step, all the packets arising from a first gateway connected to a first controller travel via the interconnection network and are then transmitted to a second gateway connected to a second controller, this second gateway removing the IP capsule added to the IP packets by the first gateway before transmitting said IP packets to the second controller. According to an implementation of the method according to the invention, the first IP address known to the nodes of the radio network is the same for all the gateways. The presence of these two IP addresses allows the mobile terminal to keep just a single IP address. According to an implementation of the method according to the invention, when a router sends an ARP request to the interconnection network, the first router of the interconnection network receiving said request transmits it to a gateway, said gateway transmitting a response to said router, the response comprising the level-2 address of said gateway. The subject of the invention is also a system for guaranteeing the continuity of the communications operated from a fourth-generation mobile terminal connected to a radio network provided with several base stations with which said terminal is able to communicate, said radio network being linked by controllers to an interconnection network comprising routers operating at the level of the IP layer, wherein each controller is connected to at least one gateway configured to encapsulate in IP packets all the IP packets arising from the radio network before broadcasting them over the interconnection network. According to one embodiment of the system according to the invention, at least one gateway is connected via a data bus to the controller with which it is associated. According to one embodiment of the system according to the invention, at least one gateway is connected by way of at least one router to the controller with which it is associated. DETAILED DESCRIPTION FIG. 1 is a view presenting an exemplary network on which the method according to the invention may be implemented. A 4 G communications network 100 comprises a radio network 110 called a RAN subsequently, and an interconnection network 120 formed, for example, of cabled communications links or RF beam radio links or the like. In the example, the interconnection network 120 is linked to the Internet network 140 by way of a router 121. The RAN 110 comprises several radio base stations 111 spread out to cover a territory. Thus, the 4 G communications network 100 allows mobile terminals 151 present in this territory to communicate with other terminals 152 connected to the 4 G network 100 via other base stations. A mobile terminal 151, 152 is, for example, a telephone, a laptop computer or any other roaming apparatus able to communicate via the 4 G network 100. Several radio base station controllers 113a, 113b, 113c, 113d, also called more simply controllers subsequently, make it possible notably to manage the problems of macro-mobility of the mobile terminals, service quality, and authentication of users. Each of these controllers 113a, 113b, 113c, 113d controls one or more radio base stations 111. The functions traditionally allotted to the Home agent in the case of the use of the MIP (Mobile IP) protocol are, within the framework of the invention, distributed at the level of the base controllers 113a, 113b, 113c, notably so as to avoid the vulnerability of a centralized system. Furthermore, the controllers 113a, 113b, 113c, 113d are linked together by a network of routers 131, 132, 133, 134, 135 operating at the level of the IP layer. Hence, when a new mobile terminal 151 connects to a base station 111 affiliated to a controller 113a to which this terminal 151 was not hitherto affiliatedstated otherwise, the mobile terminal was not connected to a base station affiliated to this controller 113a, the other controllers 113b, 113c, 113d must be advised of the arrival of the new mobile terminal 151. In the example, the controller 113a is designed to be hooked up to an interconnection network comprising switches operating at level 2 of the ISO layer, although in the invention, this controller is hooked up to a network of routers 131, 132, 133, 134, 135 operating at level 3. The base controller 113a to which the new mobile terminal 151 is affiliated is configured to send a message to advise the other controllers 113b, 113c, 113d of the arrival of the mobile terminal 151. According to one mode of implementation of the method according to the invention, the message is of Gratuitous ARP or GARP type. This message comprises the IP address of the mobile terminal and the level-2 address of the controller 113a, which in the case of an Ethernet network is an MAC address. In the implementation of the invention, the interconnection network 120 being level 3, the network cannot propagate the GARP message automatically to the other controllers 113b, 113c, 113d. To allow the propagation of this message, gateways 141, 142, 143, 144 operating at the level of the IP layer are interfaced between each controller 113a, 113b, 113c, 113d and the interconnection network 120. The gateway 141, 142, 143, 144 is accessible to the controller 113a, 113b, 113c, 113d via one or more routers 131, 132, 133, 134 of the interconnection network 120. The GARP message sent by the controller 113a with which the mobile terminal is newly affiliated is redirected to the gateway 141 which is associated with this controller 113a. This level-2 GARP message can thus be processed by the gateway 141 associated with the base controller 113a to which the new mobile terminal 151 is affiliated. The gateway 141 utilizes level-2 message to create an IP message so as to alert the other gateways 142, 143, 144 of the arrival of a new mobile terminal 151 at the controller 113a associated with this gateway 141. The IP message propagates through the interconnection network 120 so as to reach the other gateways 142, 143, 144, which store a correspondence between the IP address of the mobile terminal and the IP address of the gateway 141 with which the controller 113a of the mobile terminal is affiliated. Thus, it is not necessary to directly alert the other controllers 113b, 113c, 113d of the arrival of a new mobile terminal 151 affiliated to the first controller 113a. It is the gateways 141, 142, 143, 144 which maintain this information necessary for proper management of the macro-mobility of the terminals 151. In the case of a movement of a mobile terminal, previously affiliated to a first controller, to a base station affiliated to another controller, the correspondence, maintained by each of the gateways 141, 142, 143, 144, between the IP address of the mobile terminal and the IP address of the gateway associated with the controller to which this mobile terminal is affiliated is modified by each of the gateways 141, 142, 143, 144. Indeed, the IP address of the initial gateway is replaced with the IP address of the new gateway. Within this framework, the gateways play a role in signaling the mobility of the terminals. The mobile terminals 151, 152 connected to the interconnection network 120 via the radio base stations 111 and the controllers 113a, 113b, 113c, 113d belong to the same IP sub-network, so that once a mobile terminal has been declared at the 4 G network 100, and an IP address has been allocated to it, this IP address does not change, even in the case of macro-mobility of this terminal. To allow the mobile terminals to pass from one controller to the other without changing IP address and without disturbing the communications, all the IP data packets transmitted through a controller 113a, 113b, 113c, 113d destined for another controller 113a, 113b, 113c, 113d are systematically encapsulated in other IP packets so as to be able to be propagated by the routers 131, 132, 133, 134, 135 of the interconnection network 120. A known IP address of the interconnection network 120 is allocated to the IP packets encapsulating the IP data packets, so as to correctly route them up to the destination controller, that is to say up to the controller charged with transmitting the packets to the base station to which the destination mobile terminal is connected. The IP capsule which had been added before routing in the interconnection network is thereafter removed at the level of this destination controller, more exactly by the gateway associated with this destination controller. This IP in IP encapsulation mechanism is advantageously implemented by a gateway 141, 142, 143, 144 such as described above, a gateway preferably being put in place for each controller 113a, 113b, 113c, 113d. A gateway may be viewed, for the processing of IP data, as a means for encapsulating IP packets in other IP packets of higher level. Two IP addresses are allocated to each of the gateways 141, 142, 143, 144: a first IP address viewed from the radio network 110, and a second IP address viewed from the interconnection network 120. The first IP address, viewed from the radio network 110, is always the same, whatever the gateway 141, 142, 143, 144; stated otherwise, all the gateways have the same first IP address, which in FIG. 1 is designated by IP0. The second IP address, specific to each gateway, allows the addressing of the data within the interconnection network 120. In the example of FIG. 1, a router 131, 132, 133, 134 is interfaced between each controller 113a, 113b, 113c, 113d and the gateway 141, 142, 143, 144 with which it is associated. This router 131, 132, 133, 134 is configured to systematically transfer all the packets received from the controller to which it is connected to the associated gateway. All the packets entering the interconnection network 120 via a controller 113a, 113b, 113c, 113d are therefore transmitted to the gateway associated with this controller, so as to perform the IP in IP encapsulation described above. Advantageously, a gateway 141 is co-located with the router with which it is associated 131. According to one mode of implementation of the method according to the invention, the controller and the gateway are physically integrated into the same machine, the gateway being for example connected to the controller by a network cable or a data bus. Furthermore, certain gateways 145 of the interconnection network 120 can receive requests of ARP (Address Resolution Protocol) type sent from external routers 121 to this interconnection network 120. These requests originate, for example, from external routers 121 charged with determining which MAC address in the interconnection network 120 is the one which corresponds to a determined IP address. These gateways 145 are configured to respond with their own MAC addresses; stated otherwise, to indicate to the external routers 121 that whatever the specified IP address whose corresponding level-2 party is sought, it is the gateway 145 which must receive all the packets so as to undertake an IP in IP encapsulation such as described above and then steer them to the correct gateways of the network. FIG. 2 illustrates by a diagram an exemplary path taken by data in a network in which the method according to the invention is implemented. The figure illustrates with an arrowed line a path 201 followed by data between a first mobile terminal 151 and a second mobile terminal 152, the mobile terminals 151, 152 having been registered beforehand with the controllers 113a, 113b. The IP data arising from the first mobile terminal 151 are transmitted to a base station 111a, and then to the first controller 113a interfaced with the interconnection network 120. A router 131 of the interconnection network receives the data; it is configured to steer the data packets automatically to the first gateway 141. This gateway 141, which comprises two IP addresses as described above, encapsulates the IP data packets in other IP packets of higher level. The destination IP address in the interconnection network 120 which is allocated to the IP packets of higher level is the IP address of the destination gateway 142 viewed from the interconnection network 120. The IP packets of higher level are thus routed through the interconnection network 120 up to the destination gateway 142, which decodes the previously encapsulated IP data packets, and transmits them to the second controller 113b. The IP data are thereafter transmitted to a base station 111b and then to the second mobile terminal 152. FIG. 3 illustrates an example of macro-mobility handled by virtue of the method according to the invention. The example of FIG. 3 again employs the network of FIG. 2, in which two mobile terminals 151, 152 communicate. The second terminal 152 moves away from the base station 111b with which it was connected, until it connects to a base station 111d affiliated to a third controller 113d different from the previous controller. The second mobile terminal 152 is detected by the third controller 113d. A level-2 message 302 is sent by this third controller 113d to the gateway 144 with which it is associated, which gateway sends an IP message 303 (represented dashed in FIG. 3) destined for the other gateways 141, 142, 143 to advise them of the movement of the mobile terminal 152. The tables of correspondences maintained by the gateways 141, 142, 143 are updated, so that the IP packets intended for the mobile terminal 152 are properly conveyed to the gateway 144 associated with the new controller 113d to which the second mobile terminal 152 is affiliated. The path 301 followed by data between the first mobile terminal 151 and the second mobile terminal 152 after macro-mobility is illustrated by an arrowed solid line. If one or more communication links are cut, then the meshed character of the network and the fact that each gateway has direct access to the correspondences between IP addresses of the mobile terminals and IP addresses of the gateways with which they are affiliated makes it possible to ensure the conveying of the data correctly. The mobility management function is decentralized. An advantage of the method according to the invention is that it makes it possible to reuse controllers initially designed to operate at level 2 of the ISO layer. It is thus possible to realize a reliable 4 G network on the basis of a level-3 interconnection network. The method according to the invention does not require the implementation of particular functionalities on the mobile terminals. Standard mobile terminals can therefore benefit from the invention. Finally, the method according to the invention is compatible with the conventional IP routing solutions and relies only on functions implemented in the controllers between the radio access network and the interconnection network. | 1 | < 0.1% |
| CROSS-REFERENCE TO RELATED APPLICATIONS This application is based on and claims priority under 35 USC 119 from Japanese Patent Application No. 2011-066867 filed Mar. 25, 2011. BACKGROUND (i) Technical Field The present invention relates to a control device, a control method, an image forming apparatus, and a non-transitory computer readable medium storing program. (ii) Related Art In recent years, an image forming apparatus has been proposed in which an operation screen (a menu screen or a function execution screen) that is displayed on a display device of the image forming apparatus and receives an operation for the image forming apparatus from the user may be registered for each user or each group (for example, each department). SUMMARY According to an aspect of the invention, there is provided a control device including: a search request receiving unit that receives a request to search for a first operation screen registered in a second image forming apparatus connected to a first image forming apparatus; a search unit that searches for the first operation screen among operation screens registered in the second image forming apparatus; a display control unit that controls to display the first operation screen on a display device provided in the first image forming apparatus; a receiving unit that receives an instruction for the second image forming apparatus having the first operation screen registered therein from a user through the first operation screen displayed on the display device; and a transmitting unit that transmits the instruction received from the user through the first operation screen to the second image forming apparatus having the first operation screen registered therein. BRIEF DESCRIPTION OF THE DRAWINGS Exemplary embodiments of the present invention will be described in detail based on the following figures, wherein: FIG. 1 is a diagram illustrating an example of the structure of an image forming system including an image forming apparatus according to an exemplary embodiment of the invention; FIG. 2 is a diagram illustrating an example of the structure of the image forming apparatus; FIG. 3 is a diagram illustrating an example of the hardware structure of a control device; FIG. 4 is a functional block diagram illustrating an example of the function of the control device; FIG. 5 is a flowchart illustrating an example of the process of the control device; FIGS. 6A to 6C are diagrams illustrating an example of a screen displayed on a display device; FIGS. 7A and 7B are diagrams illustrating an example of the screen displayed on the display device; FIGS. 8A to 8C are diagrams illustrating an example of the screen displayed on the display device; FIG. 9 is a flowchart illustrating an example of the process of a control device according to a second exemplary embodiment; FIG. 10 is a flowchart illustrating an example of the process of the control device according to the second exemplary embodiment; and FIGS. 11A to 11D are diagrams illustrating an example of a screen displayed on a display device. DETAILED DESCRIPTION Hereinafter, exemplary embodiments of the invention will be described with reference to the accompanying drawings. First Exemplary Embodiment FIG. 1 is a diagram illustrating an example of the structure of an image forming system including an image forming apparatus according to a first exemplary embodiment of the invention. As shown in FIG. 1, an image forming system 300 includes image forming apparatuses 100-1 to 100-n. The image forming apparatuses 100-1 to 100-n are, for example, printers, copiers, or facsimiles. The image forming apparatuses 100-1 to 100-n may be so-called multi-function machines having plural functions, such as a print function, a copy function, and a facsimile function. The image forming apparatuses 100-1 to 100-n are connected to each other through a communication unit 200 so as to communicate with each other. In the following description, when it is not necessary to particularly discriminate the image forming apparatuses 100-1 to 100-n, the image forming apparatuses 100-1 to 100-n are referred to as image forming apparatuses 100. Next, an example of the structure of the image forming apparatus 100 will be described. FIG. 2 is a diagram illustrating an example of the structure of the image forming apparatus 100. The image forming apparatus 100 includes a display device 10, a control device 20, an image reading device 30, an image output device 40, and a communication control device 50. The display device 10 displays an operation screen that receives an operation input to the image forming apparatus 100 by the user under the control of the control device 20. Specifically, the display device 10 displays the functions (also referred to as services) of the image forming apparatus 100 and also displays a menu screen that allows the user to select a function to use. In addition, the display device 10 displays an execution screen that receives an instruction to perform the function of the image forming apparatus 100 from the user. The display device 10 outputs the received instruction to the control device 20. The display device 10 receives a request to search for the operation screen registered in another image forming apparatus from the user. The display device 10 outputs the received search request to the control device 20. In addition, the display device 10 displays the operation screen of another image forming apparatus which is matched with the search conditions included in the received search request. The control device 20 controls the overall operation of the image forming apparatus 100. For example, the control device 20 controls the display device 10 such that the menu screen or the execution screen is displayed on the display device 10. In addition, the control device 20 receives an instruction input to the image forming apparatus 100 from the display device 10. The control device 20 controls the image reading device 30, the image output device 40, and the communication control device 50 of the image forming apparatus 100 on the basis of the received instruction. Specifically, for example, when receiving an instruction to read (scan) an image from the display device 10, the control device 20 controls the image reading device 30 to read a document on a platen and acquires a document image. When receiving a copy instruction from the display device 10, the control device 20 controls the image reading device 30 to read a document on the platen and acquires a document image. Then, the control device 20 controls the image output device 40 to form the acquired document image on a recording medium, such as paper, and output the recording medium. When receiving a FAX instruction from the display device 10, first, the control device 20 controls the image reading device 30 to read a document to be transmitted on the platen and acquires a document image. Then, the control device 20 controls the communication control device 50 to transmit the acquired document image to the destination designated by the display device 10. In addition, when receiving a request to search for the operation screen registered in another image forming apparatus from the display device 10, the control device 20 communicates with another image forming apparatus through the communication control device 50 and searches for the operation screen matched with the search conditions included in the search request. For example, when receiving a request to search for the operation screen registered in another image forming apparatus from the display device 10, the control device 20 of the image forming apparatus 100-1 communicates with the image forming apparatuses 100-2 to 100-n and searches for the operation screen matched with the search conditions. Then, the control device 20 controls to display the operation screen which is registered in another image forming apparatus and is matched with the search conditions on the display device 10. The image reading device 30 is, for example, a scanner. The image reading device 30 reads a document on the platen and outputs the read document image to the control device 20 under the control of the control device 20. The image output device 40 forms the document image read by, for example, the image reading device 30 on a sheet and outputs the sheet under the control of the control device 20. The communication control device 50 transmits, for example, the document image, which is a transmission target, to the destination designated by the display device 10 under the control of the control device 20. When the control device 20 receives a request to search for the operation screen registered in another image forming apparatus, the communication control device 50 communicates with another image forming apparatus connected to the image forming apparatus 100 through the communication unit 200 and searches for the operation screen matched with the search conditions. In addition, the communication control device 50 receives the information of the operation screen matched with the search conditions from another image forming apparatus and outputs the information to the control device 20. The communication control device 50 outputs an instruction for another image forming apparatus which is received from the control device 20 to another image forming apparatus through the communication unit 200. Next, the hardware structure of the control device 20 will be described. FIG. 3 is a diagram illustrating an example of the hardware structure of the control device 20. The control device 20 includes an input/output unit 201, a ROM (Read Only Memory) 202, a CPU 203, and a RAM (Random Access Memory) 204. The input/output unit 201 transmits or receives data to or from the display device 10, the image reading device 30, the image output device 40, and the communication control device 50. The ROM 202 stores, for example, a program for searching for the screen registered in another image forming apparatus. The CPU 203 reads the program stored in the ROM 202 and executes the program. The RAM 204 temporarily stores data used to execute the program. Next, an example of the function of the control device 20 will be described. FIG. 4 is a functional block diagram illustrating the function of the control device 20. The control device 20 includes a search request receiving unit 211, a search unit 212, a display control unit 213, a receiving unit 214, and a transmitting unit 215. In the following description, it is assumed that the user uses the image forming apparatus 100-1. The CPU 203 executes the program stored in the ROM 202 to implement the functions of the search request receiving unit 211, the search unit 212, the display control unit 213, the receiving unit 214, and the transmitting unit 215. The search request receiving unit 211 receives a search request from the user through the operation screen displayed on the display device 10. Specifically, the search request receiving unit 211 receives a search request to search for the operation screens registered in the image forming apparatuses 100-2 to 100-n other than the image forming apparatus 100-1 from the user. The search request includes search conditions. For example, the search request receiving unit 211 receives a search request to search for the same menu screen as that which is registered in the image forming apparatus 100-1 and is being currently displayed on the display device 10 from the other image forming apparatuses 100-2 to 100-n. In this case, the same menu screen as that which is registered in the image forming apparatus 100-1 and is being currently displayed on the display device 10 corresponds to the search condition. Alternatively, the search request receiving unit 211 receives a search request to search for a menu screen including the functions that may be selected from the menu screen of the image forming apparatus 100-1 which is being currently displayed on the display device 10 from the other image forming apparatuses 100-2 to 100-n. Alternatively, the search request receiving unit 211 receives a search request to search for a function execution screen (hereinafter, referred to as an execution screen) for executing the functions designated by the user from the other image forming apparatuses 100-2 to 100-n. The search request receiving unit 211 outputs the received search request to the search unit 212. The search unit 212 receives the search request from the search request receiving unit 211. The search unit 212 searches for the operation screen matched with the search conditions included in the search request among the operation screens registered in the image forming apparatuses 100-2 to 100-n. Specifically, the search unit 212 transmits an instruction to search for the operation screen matched with the search conditions to the image forming apparatuses 100-2 to 100-n through the communication control device 50. The search unit 212 receives the search result of the image forming apparatuses 100-2 to 100-n through the communication control device 50. The search unit 212 outputs the search result to the display control unit 213. The display control unit 213 receives the search result from the search unit 212. When one operation screen is included in the search result, the display control unit 213 controls to display the operation screen on the display device 10. When plural operation screens are included in the search result, the display control unit 213 controls to display the search result on the display device 10 such that the user selects one of the operation screens to be displayed on the display device 10. The display control unit 213 controls to display the operation screen selected by the user from the plural operation screens on the display device 10. The receiving unit 214 receives an instruction for another image forming apparatus from the user through the operation screen that is registered in another image forming apparatus and is displayed on the display device 10. The receiving unit 214 outputs the instruction for another image forming apparatus which is received from the user to the transmitting unit 215. The transmitting unit 215 transmits the instruction received from the user to another image forming apparatus through the communication control device 50. In this way, an instruction for another image forming apparatus (image forming apparatus 100-2) is input to the image forming apparatus 100-1 using the operation screen registered in another image forming apparatus (for example, the image forming apparatus 100-2). Next, an example of the process of the control device 20 will be described using an example of the screen. FIG. 5 is a flowchart illustrating an example of the process of the control device 20. First, when the user logs in through the display device 10, the control device 20 performs user authentication (Step S11). Then, the display control unit 213 determines whether there is a function that is currently unavailable due to, for example, the error of the image forming apparatus 100 on the menu screen displayed on the display device 10 (Step S13). For example, when the menu screen only for the logged-in user is registered, the display control unit 213 determines whether there is a function that is currently unavailable on the menu screen only for the user. When the menu screen only for the logged-in user is not registered, the display control unit 213 determines whether there is a function that is currently unavailable on the initial menu screen. When there is no function that is currently unavailable on the menu screen displayed on the display device 10 (Step S13/NO), the display control unit 213 controls to display the menu screen on the display device 10 as usual (Step S15). Then, the display control unit 213 determines whether the user touches a portion (blank portion) in which an image for selecting the functions is not displayed in the menu screen displayed on the display device 10 (Step S17). When the user does not touch the blank portion of the menu screen (Step S17/NO), the display control unit 213 repeatedly performs the determination process of Step S17. When the user touches the blank portion of the menu screen (Step S 17/YES), as shown in FIG. 6A, the display control unit 213 controls to display a menu A for receiving a search request and the search request receiving unit 211 receives the search request from the user (Step S19). In the example shown in FIG. 6A, a menu search that requests the search of the menu screen and a service search that requests the search of the execution screen for executing a designated function (service) are displayed. When the menu search that searches for the menu screen is selected as the search request (Step S 19/menu screen search), the search request receiving unit 211 receives the function selected by the user (Step S21). For example, it is assumed that the user wants to search for the menu screen capable of selecting a simple copy function of performing a copy process more simply than a general copy function. In this case, the search request receiving unit 211 receives the simple copy function selected by the user. For example, the function selected by the user in Step S21 is not included in the image forming apparatus 100-1, but is included in the image forming apparatuses 100-2 to 100-n. Therefore, the user may use the functions included in the other image forming apparatuses 100-2 to 100-n with the image forming apparatus 100-1, without leaving the image forming apparatus 100-1. Then, the search unit 212 searches for the menu screen on which the function received in Step S21 may be selected among the menu screens registered in the other image forming apparatuses (Step S23). Then, the display control unit 213 controls to display the search result on the display device (Step S25). For example, the display control unit 213 controls to display the search result on the display device 10, as shown in FIG. 6B. For example, when the simple copy function is selected in Step S21 of FIG. 5, a list of the menu screens on which the simple copy function may be selected is displayed on the display device 10. FIG. 6B shows an example of the search result displayed on the display device 10 of the image forming apparatus 100-1. In the example shown in FIG. 6B, the menu name of the menu screens on which the function selected in Step S21 of FIG. 5 may be selected, the name (machine name) of the image forming apparatuses in which the menu screens are registered, the owner of the menu screen, and the update date of the menu screen are displayed. When there are plural search results, the display control unit 213 controls to display the menu screens such that the user selects the menu screen to be displayed on the display device 10 (Step S27). For example, the user selects the menu screen to be displayed on the display device 10 from the menu screens shown in FIG. 6B. Then, the display control unit 213 controls to display the selected menu screen on the display device 10 (Step S29) and ends the process. For example, in FIG. 6B, when a menu screen MyMenu3 registered in a machine 3 (indicating the image forming apparatus 100-3) is selected, the display control unit 213 controls to display the menu screen MyMenu3 registered in the image forming apparatus 100-3 on the display device 10 of the image forming apparatus 100-1, as shown in FIG. 6C. In this case, the display control unit 213 may control to display information indicating that the menu screen MyMenu3 is registered in the image forming apparatus 100-3 (machine 3). In this way, the user recognizes that the menu screen displayed on the display device 10 is for operating the image forming apparatus 100-3. When the owner of the menu screen MyMenu3 is different from the user of the image forming apparatus 100-1, the owner of the menu screen MyMenu3 may be displayed as, for example, a message or an icon on the screen. In the example shown in FIG. 6C, a message B indicating the image forming apparatus having the currently displayed menu screen registered therein and the owner of the menu screen is displayed on the lower right side of the screen. When the service search that requests the search of the execution screen for executing the designated function is selected in Step S 19 (Step S19/execution screen search), the search request receiving unit 211 receives the selected function that the user wants to execute (Step S31). For example, it is assumed that the user wants to execute the simple copy function. In this case, the search request receiving unit 211 receives the simple copy function selected by the user. For example, the function selected by the user in Step S31 is not included in the image forming apparatus 100-1, but is included in the image forming apparatuses 100-2 to 100-n. In this way, the user may execute the function included in the other image forming apparatuses 100-2 to 100-n with the image forming apparatus 100-1, without leaving the image forming apparatus 100-1. Then, the search unit 212 searches for the execution screen for executing the function received in Step S31 among the execution screens registered in other image forming apparatuses (Step S33). Then, the display control unit 213 controls to display the search result on the display device 10 (Step S35). For example, the display control unit 213 controls to display the search result on the display device 10 of the image forming apparatus 100-1, as shown in FIG. 7A. For example, when the simple copy function is selected in Step S31 of FIG. 5, a list of the menu screens that are registered in the image forming apparatuses 100-2 to 100-n and are capable of calling out the execution screen for executing the simple copy function is displayed on the display device 10. FIG. 7A shows an example of the search result displayed on the display device 10 of the image forming apparatus 100-1. In the example shown in FIG. 7A, the following are displayed: the name (service name) of the function selected in Step S31 of FIG. 5, the name (menu name) of the menu screen that is capable of calling out the execution screen for executing the function selected in Step S31 of FIG. 5, the name (machine name) of the image forming apparatus having the menu screen registered therein, the owner of the menu screen, and the update date of the menu screen. When there are plural search results, the display control unit 213 controls to display the search results such that the user selects a desired function from the execution screen registered in any one of the image forming apparatuses (Step S37). Then, the display control unit 213 controls to display the execution screen selected in Step S35 on the display device 10 (Step S39) and ends the process. For example, it is assumed that the user selects a simple copy function that may be called from the menu screen MyMenu3 registered in the machine 3 in Step S35. In this case, the display control unit 213 controls to display the execution screen for executing the simple copy function registered in the image forming apparatus 100-3 (machine 3), which is shown in FIG. 7B, on the display device 10 of the image forming apparatus 100-1. At that time, the display control unit 213 may control to display information indicating that the execution screen displayed on the display device 10 is registered in the image forming apparatus 100-3 (machine 3) and may display the owner of the execution screen. In the example shown in FIG. 7B, information indicating that the currently displayed execution screen is registered in the image forming apparatus 100-3 (machine 3) and the owner of the execution screen is Ishiyama Taro is displayed on the upper right side of the screen. When there is a function that is currently unavailable on the menu screen displayed on the display device 10 (Step S13/YES), the display control unit 213 controls to display the menu screen on the display device 10 such that the unavailable function is discriminated from other functions (Step S41). For example, as shown by the hatched area in FIG. 8A, the display control unit 213 controls to display the unavailable function so as to be discriminated from other functions. In the example of the screen shown in FIG. 8A, since the simple copy function is unavailable, the simple copy function is displayed so as to be discriminated from other functions (for example, the simple copy is dimmer than other functions). Then, the display control unit 213 determines whether an unavailable function is selected by the user on the menu screen (Step S43). In the example shown in FIG. 8A, the display control unit 213 determines whether the simple copy function that is currently unavailable is selected on the menu screen. When the unavailable function is not selected (Step S43/NO), the display control unit 213 repeatedly performs the determination process of Step S43. When the unavailable function is selected on the menu screen (Step S 43/YES), as shown in FIG. 8B, the display control unit 213 controls to display a menu C for receiving instructions from the user on the menu screen and receives instructions from the user (Step S45). In the example shown in FIG. 8B, as the menu that may be selected by the user, the following is displayed: error information display that requests the display of the error information of an unavailable function; a menu search that requests the search of the menu screen; or a service search that requests the search of the execution screen for executing the function. When the error information display is selected on the screen shown in FIG. 8B (Step S45/error information display), the display control unit 213 controls to display error information on the display device 10, as shown in FIG. 8C (Step S47). In this way, the user knows the reason why the selected function is not executable. In the example shown in FIG. 8C, since an error occurs in the image output device 40, the user recognizes that the simple copy function is not executable. When the menu search is selected on the screen shown in FIG. 8B (Step S45/menu screen search), the search unit 212 searches for the menu screen capable of selecting the function that is currently unavailable from the menu screens registered in other image forming apparatuses (Step S23). In the example shown in FIG. 8B, since the simple copy function is unavailable, the search unit 212 searches for the menu screen capable of selecting the simple copy function from the menu screens registered in other image forming apparatuses. The process subsequent to Step S23 is the same as described above and a description thereof will not be repeated. When the service search is selected on the screen shown in FIG. 8B (Step S45/execution screen search), the search unit 212 searches for the execution screen for executing the function that is currently unavailable in the image forming apparatus 100-1 among the execution screens registered in the other image forming apparatuses (Step S33). In the example shown in FIG. 8B, since the simple copy function is unavailable, the search unit 212 searches for the execution screen for executing the simple copy function among the execution screens registered in the other image forming apparatuses. The process subsequent to Step S33 is the same as described above and a description thereof will not be repeated. As can be seen from the above description, according to the first exemplary embodiment, the search request receiving unit 211 receives a request to search for the operation screens registered in the other image forming apparatuses 100-2 to 100-n that are connected to the image forming apparatus 100-1. The search unit 212 searches for the operation screen matched with the search conditions included in the search request among the operation screens registered in the other image forming apparatuses 100-2 to 100-n. The display control unit 213 controls to display the searched operation screens registered in other image forming apparatuses on the display device 10 of the image forming apparatus 100-1. Then, the receiving unit 214 receives from the user an instruction for the operation screens of other image forming apparatuses displayed on the display device 10. The transmitting unit 215 transmits the instruction received from the user through the operation screens to other image forming apparatuses. In this way, the image forming apparatus 100-1 inputs an instruction to other image forming apparatuses using the operation screens registered in other image forming apparatuses. Therefore, the user does not need to move between the image forming apparatuses in order to input instructions to other image forming apparatuses. In addition, when instructions are input to other image forming apparatuses, the operation screens which are matched with the search conditions received from the user and are registered in other image forming apparatuses are used to input the instructions. Therefore, an operation screen with high operability is provided to the user. In particular, when the menu screen or the execution screen customized for each user is registered, the user changes the search conditions to search for the operation screen that the user is accustomed to. Therefore, an operation screen with high operability is provided to the user. The search request receiving unit 211 may receive a request to search for the menu screen capable of selecting any one of the functions of the image forming apparatuses 100-2 to 100-n. In this way, an instruction to execute the functions of the other image forming apparatuses 100-2 to 100-n is input to the image forming apparatus 100-1 using the menu screens registered in the other image forming apparatuses 100-2 to 100-n. Therefore, for example, when the user wants to use the function that is not included in the image forming apparatus 100-1, but is included in other image forming apparatuses, the user does not need to move to other image forming apparatuses in order to use the function. The search request receiving unit 211 may receive a request to search for the execution screen for executing any one of the functions of the other image forming apparatuses 100-2 to 100-n. In this way, the execution screens for executing the functions of the other image forming apparatuses 100-2 to 100-n are displayed on the display device 10 and an instruction to execute the functions of other image forming apparatuses is input to the image forming apparatus 100-1. Therefore, for example, when the user wants to use the functions of other image forming apparatuses, the user does not move to the other image forming apparatus in order to use the functions. The search request receiving unit 211 may receive a request to search for the menu screen capable of selecting the function that is included in the image forming apparatus 100-1, but is unavailable, or an execution screen for executing the function. In this way, it is possible to input an instruction for other image forming apparatuses to the image forming apparatus 100-1. Therefore, the user does not need to move to other image forming apparatuses in order to use the function that is unavailable in the image forming apparatus 100-1. As a result, it is possible to prevent a delay in the work of the user when a specific function is unav... | 1 | < 0.1% |
| Other values (2774) | 2774 |
Length
| Value | Count | Frequency (%) |
| the | 1027887 | 8.5% |
| of | 456241 | 3.8% |
| a | 441814 | 3.6% |
| to | 301503 | 2.5% |
| and | 269904 | 2.2% |
| in | 253192 | 2.1% |
| is | 212455 | 1.8% |
| 124548 | 1.0% | |
| be | 120669 | 1.0% |
| an | 107480 | 0.9% |
| Other values (149648) | 8805825 |
Most occurring characters
| Value | Count | Frequency (%) |
| 12126521 | ||
| e | 7334206 | 9.4% |
| t | 5254871 | 6.8% |
| a | 4507691 | 5.8% |
| i | 4437231 | 5.7% |
| o | 4312710 | 5.5% |
| n | 4245592 | 5.5% |
| r | 3742235 | 4.8% |
| s | 3382701 | 4.4% |
| ? | 3198023 | 4.1% |
| Other values (138) | 25165596 |
Most occurring categories
| Value | Count | Frequency (%) |
| Lowercase Letter | 56579148 | |
| Space Separator | 12130185 | 15.6% |
| Other Punctuation | 4576769 | 5.9% |
| Uppercase Letter | 1848382 | 2.4% |
| Decimal Number | 1653788 | 2.1% |
| Control | 461687 | 0.6% |
| Dash Punctuation | 171368 | 0.2% |
| Close Punctuation | 129319 | 0.2% |
| Open Punctuation | 127216 | 0.2% |
| Math Symbol | 19308 | < 0.1% |
| Other values (7) | 10207 | < 0.1% |
Most frequent character per category
Lowercase Letter
| Value | Count | Frequency (%) |
| e | 7334206 | |
| t | 5254871 | 9.3% |
| a | 4507691 | 8.0% |
| i | 4437231 | 7.8% |
| o | 4312710 | 7.6% |
| n | 4245592 | 7.5% |
| r | 3742235 | 6.6% |
| s | 3382701 | 6.0% |
| c | 2371143 | 4.2% |
| l | 2301973 | 4.1% |
| Other values (33) | 14688795 |
Uppercase Letter
| Value | Count | Frequency (%) |
| I | 230824 | |
| T | 202264 | 10.9% |
| A | 150324 | 8.1% |
| F | 145120 | 7.9% |
| S | 115516 | 6.2% |
| G | 109151 | 5.9% |
| C | 104846 | 5.7% |
| E | 90701 | 4.9% |
| P | 82306 | 4.5% |
| D | 81147 | 4.4% |
| Other values (22) | 536183 |
Other Punctuation
| Value | Count | Frequency (%) |
| ? | 3198023 | |
| , | 656140 | 14.3% |
| . | 602725 | 13.2% |
| / | 40615 | 0.9% |
| ; | 34100 | 0.7% |
| : | 16196 | 0.4% |
| % | 11971 | 0.3% |
| * | 7739 | 0.2% |
| ' | 6325 | 0.1% |
| · | 850 | < 0.1% |
| Other values (8) | 2085 | < 0.1% |
Control
| Value | Count | Frequency (%) |
| 410836 | ||
| | 19785 | 4.3% |
| | 19759 | 4.3% |
| | 6930 | 1.5% |
| | 1462 | 0.3% |
| | 1160 | 0.3% |
| 784 | 0.2% | |
| | 557 | 0.1% |
| | 364 | 0.1% |
| | 24 | < 0.1% |
| Other values (2) | 26 | < 0.1% |
Decimal Number
| Value | Count | Frequency (%) |
| 1 | 383667 | |
| 0 | 317686 | |
| 2 | 281723 | |
| 3 | 151439 | 9.2% |
| 4 | 141062 | 8.5% |
| 5 | 110533 | 6.7% |
| 6 | 97144 | 5.9% |
| 8 | 70109 | 4.2% |
| 7 | 55727 | 3.4% |
| 9 | 44698 | 2.7% |
Math Symbol
| Value | Count | Frequency (%) |
| = | 6032 | |
| + | 5314 | |
| × | 2213 | 11.5% |
| < | 2195 | 11.4% |
| > | 1864 | 9.7% |
| | | 798 | 4.1% |
| ± | 586 | 3.0% |
| ~ | 260 | 1.3% |
| ÷ | 46 | 0.2% |
Close Punctuation
| Value | Count | Frequency (%) |
| ) | 123667 | |
| ] | 4663 | 3.6% |
| } | 989 | 0.8% |
Open Punctuation
| Value | Count | Frequency (%) |
| ( | 121497 | |
| [ | 4662 | 3.7% |
| { | 1057 | 0.8% |
Other Symbol
| Value | Count | Frequency (%) |
| ° | 6009 | |
| ® | 958 | 13.7% |
| © | 2 | < 0.1% |
Other Number
| Value | Count | Frequency (%) |
| ½ | 174 | |
| ¼ | 154 | |
| ¾ | 40 | 10.9% |
Modifier Symbol
| Value | Count | Frequency (%) |
| ^ | 159 | |
| ´ | 20 | 10.9% |
| ¨ | 5 | 2.7% |
Currency Symbol
| Value | Count | Frequency (%) |
| $ | 90 | |
| £ | 4 | 4.2% |
| ¥ | 1 | 1.1% |
Space Separator
| Value | Count | Frequency (%) |
| 12126521 | ||
| 3664 | < 0.1% |
Dash Punctuation
| Value | Count | Frequency (%) |
| - | 171368 |
Connector Punctuation
| Value | Count | Frequency (%) |
| _ | 2580 |
Final Punctuation
| Value | Count | Frequency (%) |
| » | 6 |
Initial Punctuation
| Value | Count | Frequency (%) |
| « | 5 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Latin | 58427530 | |
| Common | 19279847 | 24.8% |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| e | 7334206 | |
| t | 5254871 | 9.0% |
| a | 4507691 | 7.7% |
| i | 4437231 | 7.6% |
| o | 4312710 | 7.4% |
| n | 4245592 | 7.3% |
| r | 3742235 | 6.4% |
| s | 3382701 | 5.8% |
| c | 2371143 | 4.1% |
| l | 2301973 | 3.9% |
| Other values (65) | 16537177 |
Common
| Value | Count | Frequency (%) |
| 12126521 | ||
| ? | 3198023 | 16.6% |
| , | 656140 | 3.4% |
| . | 602725 | 3.1% |
| 410836 | 2.1% | |
| 1 | 383667 | 2.0% |
| 0 | 317686 | 1.6% |
| 2 | 281723 | 1.5% |
| - | 171368 | 0.9% |
| 3 | 151439 | 0.8% |
| Other values (63) | 979719 | 5.1% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 77641218 | |
| None | 66159 | 0.1% |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 12126521 | ||
| e | 7334206 | 9.4% |
| t | 5254871 | 6.8% |
| a | 4507691 | 5.8% |
| i | 4437231 | 5.7% |
| o | 4312710 | 5.6% |
| n | 4245592 | 5.5% |
| r | 3742235 | 4.8% |
| s | 3382701 | 4.4% |
| ? | 3198023 | 4.1% |
| Other values (85) | 25099437 |
None
| Value | Count | Frequency (%) |
| | 19785 | |
| | 19759 | |
| | 6930 | 10.5% |
| ° | 6009 | 9.1% |
| 3664 | 5.5% | |
| × | 2213 | 3.3% |
| | 1462 | 2.2% |
| | 1160 | 1.8% |
| ® | 958 | 1.4% |
| · | 850 | 1.3% |
| Other values (43) | 3369 | 5.1% |
Assignee/Applicant (Original Language)
Categorical
HIGH CARDINALITY  UNIFORM 
| Distinct | 2704 |
|---|---|
| Distinct (%) | 97.1% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 466.2 KiB |
| Canon Kabushiki Kaisha,Tokyo,JP | 8 |
|---|---|
| Sony Corporation,Tokyo,JP | 6 |
| International Business Machines Corporation,Armonk,NY,US | 6 |
| Seagate Technology LLC,Cupertino,CA,US | 5 |
| Samsung Electronics Co. Ltd.,Suwon-si,KR | 4 |
| Other values (2699) |
Length
| Max length | 547 |
|---|---|
| Median length | 264 |
| Mean length | 113.43068 |
| Min length | 19 |
Characters and Unicode
| Total characters | 315791 |
|---|---|
| Distinct characters | 97 |
| Distinct categories | 10 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 2 ? |
Unique
| Unique | 2651 ? |
|---|---|
| Unique (%) | 95.2% |
Sample
| 1st row | Euro-Pro Operating LLC,Newton,MA,US |
|---|---|
| 2nd row | Sikorsky Aircraft Corporation,Stratford,CT,US |
| 3rd row | Vectura Limited,Chippenham, Wiltshire,GB | Staniforth John Nicholas,Bath,GB |
| 4th row | ISIS Innovation Limited,Oxford,GB | Waldmann Herman,Oxford,GB | Fairchild Paul J.,Oxford,GB | Gardner Richard,Oxford,GB | Brook Frances,Oxford,GB |
| 5th row | Sony Corporation,Tokyo,JP |
Common Values
| Value | Count | Frequency (%) |
| Canon Kabushiki Kaisha,Tokyo,JP | 8 | 0.3% |
| Sony Corporation,Tokyo,JP | 6 | 0.2% |
| International Business Machines Corporation,Armonk,NY,US | 6 | 0.2% |
| Seagate Technology LLC,Cupertino,CA,US | 5 | 0.2% |
| Samsung Electronics Co. Ltd.,Suwon-si,KR | 4 | 0.1% |
| Xilinx Inc.,San Jose,CA,US | 3 | 0.1% |
| LG Electronics Inc.,Seoul,KR | 3 | 0.1% |
| QUALCOMM Incorporated,San Diego,CA,US | 3 | 0.1% |
| Seiko Epson Corporation,Tokyo,JP | 3 | 0.1% |
| Fujitsu Limited,Kawasaki,JP | Fujitsu Limited,Kawasaki-shi,JP | 3 | 0.1% |
| Other values (2694) | 2740 |
Length
| Value | Count | Frequency (%) |
| 6566 | 19.5% | |
| co | 356 | 1.1% |
| of | 171 | 0.5% |
| diego,ca,us | 130 | 0.4% |
| the | 129 | 0.4% |
| kabushiki | 122 | 0.4% |
| technology | 118 | 0.4% |
| kim | 111 | 0.3% |
| electronics | 110 | 0.3% |
| jose,ca,us | 107 | 0.3% |
| Other values (14864) | 25779 |
Most occurring characters
| Value | Count | Frequency (%) |
| 30915 | 9.8% | |
| , | 22833 | 7.2% |
| a | 21574 | 6.8% |
| o | 17833 | 5.6% |
| e | 17720 | 5.6% |
| n | 17598 | 5.6% |
| i | 16653 | 5.3% |
| r | 12380 | 3.9% |
| t | 10101 | 3.2% |
| s | 9336 | 3.0% |
| Other values (87) | 138848 |
Most occurring categories
| Value | Count | Frequency (%) |
| Lowercase Letter | 184534 | |
| Uppercase Letter | 66018 | 20.9% |
| Space Separator | 30915 | 9.8% |
| Other Punctuation | 26204 | 8.3% |
| Math Symbol | 6490 | 2.1% |
| Dash Punctuation | 1447 | 0.5% |
| Open Punctuation | 66 | < 0.1% |
| Close Punctuation | 66 | < 0.1% |
| Decimal Number | 38 | < 0.1% |
| Control | 13 | < 0.1% |
Most frequent character per category
Lowercase Letter
| Value | Count | Frequency (%) |
| a | 21574 | |
| o | 17833 | 9.7% |
| e | 17720 | 9.6% |
| n | 17598 | 9.5% |
| i | 16653 | 9.0% |
| r | 12380 | 6.7% |
| t | 10101 | 5.5% |
| s | 9336 | 5.1% |
| l | 8390 | 4.5% |
| h | 7434 | 4.0% |
| Other values (31) | 45515 |
Uppercase Letter
| Value | Count | Frequency (%) |
| S | 8621 | 13.1% |
| C | 5350 | 8.1% |
| U | 4732 | 7.2% |
| A | 4174 | 6.3% |
| P | 3564 | 5.4% |
| J | 3427 | 5.2% |
| M | 3380 | 5.1% |
| T | 3308 | 5.0% |
| L | 2997 | 4.5% |
| K | 2880 | 4.4% |
| Other values (19) | 23585 |
Decimal Number
| Value | Count | Frequency (%) |
| 3 | 13 | |
| 4 | 8 | |
| 5 | 5 | 13.2% |
| 2 | 4 | 10.5% |
| 6 | 2 | 5.3% |
| 0 | 2 | 5.3% |
| 1 | 2 | 5.3% |
| 8 | 1 | 2.6% |
| 9 | 1 | 2.6% |
Other Punctuation
| Value | Count | Frequency (%) |
| , | 22833 | |
| . | 3195 | 12.2% |
| & | 98 | 0.4% |
| ' | 46 | 0.2% |
| / | 23 | 0.1% |
| ? | 6 | < 0.1% |
| ! | 3 | < 0.1% |
Control
| Value | Count | Frequency (%) |
| | 7 | |
| | 3 | |
| | 3 |
Math Symbol
| Value | Count | Frequency (%) |
| | | 6486 | |
| + | 4 | 0.1% |
Open Punctuation
| Value | Count | Frequency (%) |
| ( | 65 | |
| { | 1 | 1.5% |
Close Punctuation
| Value | Count | Frequency (%) |
| ) | 65 | |
| } | 1 | 1.5% |
Space Separator
| Value | Count | Frequency (%) |
| 30915 |
Dash Punctuation
| Value | Count | Frequency (%) |
| - | 1447 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Latin | 250552 | |
| Common | 65239 | 20.7% |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| a | 21574 | 8.6% |
| o | 17833 | 7.1% |
| e | 17720 | 7.1% |
| n | 17598 | 7.0% |
| i | 16653 | 6.6% |
| r | 12380 | 4.9% |
| t | 10101 | 4.0% |
| s | 9336 | 3.7% |
| S | 8621 | 3.4% |
| l | 8390 | 3.3% |
| Other values (60) | 110346 |
Common
| Value | Count | Frequency (%) |
| 30915 | ||
| , | 22833 | |
| | | 6486 | 9.9% |
| . | 3195 | 4.9% |
| - | 1447 | 2.2% |
| & | 98 | 0.2% |
| ( | 65 | 0.1% |
| ) | 65 | 0.1% |
| ' | 46 | 0.1% |
| / | 23 | < 0.1% |
| Other values (17) | 66 | 0.1% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 315580 | |
| None | 211 | 0.1% |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 30915 | 9.8% | |
| , | 22833 | 7.2% |
| a | 21574 | 6.8% |
| o | 17833 | 5.7% |
| e | 17720 | 5.6% |
| n | 17598 | 5.6% |
| i | 16653 | 5.3% |
| r | 12380 | 3.9% |
| t | 10101 | 3.2% |
| s | 9336 | 3.0% |
| Other values (66) | 138637 |
None
| Value | Count | Frequency (%) |
| ü | 64 | |
| é | 32 | |
| ö | 32 | |
| ä | 31 | |
| å | 8 | 3.8% |
| ø | 7 | 3.3% |
| | 7 | 3.3% |
| ç | 7 | 3.3% |
| è | 5 | 2.4% |
| | 3 | 1.4% |
| Other values (11) | 15 | 7.1% |
Assignee - Original
Categorical
HIGH CARDINALITY  UNIFORM 
| Distinct | 2672 |
|---|---|
| Distinct (%) | 96.0% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 337.5 KiB |
| Samsung Electronics Co. Ltd. | 12 |
|---|---|
| Canon Kabushiki Kaisha | 9 |
| Sony Corporation | 7 |
| Semiconductor Energy Laboratory Co. Ltd. | 6 |
| International Business Machines Corporation | 6 |
| Other values (2667) |
Length
| Max length | 287 |
|---|---|
| Median length | 169 |
| Mean length | 66.42421 |
| Min length | 6 |
Characters and Unicode
| Total characters | 184925 |
|---|---|
| Distinct characters | 93 |
| Distinct categories | 10 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 2 ? |
Unique
| Unique | 2609 ? |
|---|---|
| Unique (%) | 93.7% |
Sample
| 1st row | Euro-Pro Operating LLC |
|---|---|
| 2nd row | Sikorsky Aircraft Corporation |
| 3rd row | Vectura Limited | Staniforth John Nicholas |
| 4th row | ISIS Innovation Limited | Waldmann Herman | Fairchild Paul J. | Gardner Richard | Brook Frances |
| 5th row | Sony Corporation |
Common Values
| Value | Count | Frequency (%) |
| Samsung Electronics Co. Ltd. | 12 | 0.4% |
| Canon Kabushiki Kaisha | 9 | 0.3% |
| Sony Corporation | 7 | 0.3% |
| Semiconductor Energy Laboratory Co. Ltd. | 6 | 0.2% |
| International Business Machines Corporation | 6 | 0.2% |
| Seiko Epson Corporation | 5 | 0.2% |
| Fujitsu Limited | 5 | 0.2% |
| Seagate Technology LLC | 5 | 0.2% |
| SK Hynix Inc. | 4 | 0.1% |
| Kawasaki Jukogyo Kabushiki Kaisha | Matsuda Yoshimoto | 3 | 0.1% |
| Other values (2662) | 2722 |
Length
| Value | Count | Frequency (%) |
| 6472 | 20.7% | |
| inc | 588 | 1.9% |
| corporation | 463 | 1.5% |
| ltd | 460 | 1.5% |
| co | 337 | 1.1% |
| llc | 190 | 0.6% |
| of | 167 | 0.5% |
| company | 165 | 0.5% |
| j | 152 | 0.5% |
| a | 150 | 0.5% |
| Other values (9415) | 22114 |
Most occurring characters
| Value | Count | Frequency (%) |
| 28474 | ||
| a | 13486 | 7.3% |
| e | 11459 | 6.2% |
| i | 11309 | 6.1% |
| n | 11132 | 6.0% |
| o | 10904 | 5.9% |
| r | 8737 | 4.7% |
| t | 6775 | 3.7% |
| | | 6392 | 3.5% |
| s | 5951 | 3.2% |
| Other values (83) | 70306 |
Most occurring categories
| Value | Count | Frequency (%) |
| Lowercase Letter | 118830 | |
| Space Separator | 28474 | 15.4% |
| Uppercase Letter | 27202 | 14.7% |
| Math Symbol | 6396 | 3.5% |
| Other Punctuation | 3205 | 1.7% |
| Dash Punctuation | 647 | 0.3% |
| Open Punctuation | 61 | < 0.1% |
| Close Punctuation | 61 | < 0.1% |
| Decimal Number | 36 | < 0.1% |
| Control | 13 | < 0.1% |
Most frequent character per category
Lowercase Letter
| Value | Count | Frequency (%) |
| a | 13486 | |
| e | 11459 | 9.6% |
| i | 11309 | 9.5% |
| n | 11132 | 9.4% |
| o | 10904 | 9.2% |
| r | 8737 | 7.4% |
| t | 6775 | 5.7% |
| s | 5951 | 5.0% |
| h | 5171 | 4.4% |
| l | 4904 | 4.1% |
| Other values (31) | 29002 |
Uppercase Letter
| Value | Count | Frequency (%) |
| C | 2661 | 9.8% |
| S | 2448 | 9.0% |
| M | 2003 | 7.4% |
| L | 1984 | 7.3% |
| K | 1551 | 5.7% |
| T | 1529 | 5.6% |
| A | 1475 | 5.4% |
| I | 1443 | 5.3% |
| H | 1372 | 5.0% |
| J | 1200 | 4.4% |
| Other values (16) | 9536 |
Decimal Number
| Value | Count | Frequency (%) |
| 3 | 11 | |
| 4 | 8 | |
| 5 | 5 | |
| 2 | 4 | 11.1% |
| 1 | 2 | 5.6% |
| 6 | 2 | 5.6% |
| 0 | 2 | 5.6% |
| 8 | 1 | 2.8% |
| 9 | 1 | 2.8% |
Other Punctuation
| Value | Count | Frequency (%) |
| . | 3066 | |
| & | 98 | 3.1% |
| ' | 26 | 0.8% |
| / | 11 | 0.3% |
| ! | 3 | 0.1% |
| ? | 1 | < 0.1% |
Control
| Value | Count | Frequency (%) |
| | 7 | |
| | 3 | |
| | 3 |
Math Symbol
| Value | Count | Frequency (%) |
| | | 6392 | |
| + | 4 | 0.1% |
Open Punctuation
| Value | Count | Frequency (%) |
| ( | 60 | |
| { | 1 | 1.6% |
Close Punctuation
| Value | Count | Frequency (%) |
| ) | 60 | |
| } | 1 | 1.6% |
Space Separator
| Value | Count | Frequency (%) |
| 28474 |
Dash Punctuation
| Value | Count | Frequency (%) |
| - | 647 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Latin | 146032 | |
| Common | 38893 | 21.0% |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| a | 13486 | 9.2% |
| e | 11459 | 7.8% |
| i | 11309 | 7.7% |
| n | 11132 | 7.6% |
| o | 10904 | 7.5% |
| r | 8737 | 6.0% |
| t | 6775 | 4.6% |
| s | 5951 | 4.1% |
| h | 5171 | 3.5% |
| l | 4904 | 3.4% |
| Other values (57) | 56204 |
Common
| Value | Count | Frequency (%) |
| 28474 | ||
| | | 6392 | 16.4% |
| . | 3066 | 7.9% |
| - | 647 | 1.7% |
| & | 98 | 0.3% |
| ( | 60 | 0.2% |
| ) | 60 | 0.2% |
| ' | 26 | 0.1% |
| 3 | 11 | < 0.1% |
| / | 11 | < 0.1% |
| Other values (16) | 48 | 0.1% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 184805 | |
| None | 120 | 0.1% |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 28474 | ||
| a | 13486 | 7.3% |
| e | 11459 | 6.2% |
| i | 11309 | 6.1% |
| n | 11132 | 6.0% |
| o | 10904 | 5.9% |
| r | 8737 | 4.7% |
| t | 6775 | 3.7% |
| | | 6392 | 3.5% |
| s | 5951 | 3.2% |
| Other values (65) | 70186 |
None
| Value | Count | Frequency (%) |
| ü | 27 | |
| é | 25 | |
| ö | 19 | |
| ä | 17 | |
| | 7 | 5.8% |
| ç | 5 | 4.2% |
| | 3 | 2.5% |
| | 3 | 2.5% |
| á | 2 | 1.7% |
| å | 2 | 1.7% |
| Other values (8) | 10 | 8.3% |
Optimized Assignee
Categorical
| Distinct | 1484 |
|---|---|
| Distinct (%) | 53.3% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 224.3 KiB |
| SAMSUNG ELECTRONICS CO LTD | 50 |
|---|---|
| QUALCOMM INC | 36 |
| CANON INC | 29 |
| GENERAL ELECTRIC COMPANY | 24 |
| INTERNATIONAL BUSINESS MACHINES CORP | 23 |
| Other values (1479) |
Length
| Max length | 508 |
|---|---|
| Median length | 118 |
| Mean length | 25.472701 |
| Min length | 4 |
Characters and Unicode
| Total characters | 70916 |
|---|---|
| Distinct characters | 47 |
| Distinct categories | 8 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 1132 ? |
|---|---|
| Unique (%) | 40.7% |
Sample
| 1st row | SHARKNINJA OPERATING LLC (FORMERLY EURO-PRO OPERATING LLC) | COMPASS CAYMAN SPV 2 LIMITED | SHARKNINJA SALES COMPANY | COMPASS CAYMAN SPV LTD. | EP MIDCO LLC | SHARKNINJA MANAGEMENT COMPANY | EURO-PRO HOLDCO LLC | GLOBAL APPLIANCE UK HOLDCO LIMITED | GLOBAL APPLIANCE TECHNOLOGIES INC |
|---|---|
| 2nd row | SIKORSKY AIRCRAFT CORPORATION |
| 3rd row | VECTURA GROUP PLC |
| 4th row | ISIS INNOVATION LTD |
| 5th row | REDWOOD TECHNOLOGIES LLC |
Common Values
| Value | Count | Frequency (%) |
| SAMSUNG ELECTRONICS CO LTD | 50 | 1.8% |
| QUALCOMM INC | 36 | 1.3% |
| CANON INC | 29 | 1.0% |
| GENERAL ELECTRIC COMPANY | 24 | 0.9% |
| INTERNATIONAL BUSINESS MACHINES CORP | 23 | 0.8% |
| LG ELECTRONICS INC. | 23 | 0.8% |
| APPLE INC | 21 | 0.8% |
| NEC CORP | 20 | 0.7% |
| MICROSOFT CORPORATION | 20 | 0.7% |
| GENERAL MOTORS CORP | 20 | 0.7% |
| Other values (1474) | 2518 |
Length
| Value | Count | Frequency (%) |
| inc | 804 | 7.4% |
| ltd | 517 | 4.8% |
| corp | 488 | 4.5% |
| co | 466 | 4.3% |
| 401 | 3.7% | |
| llc | 217 | 2.0% |
| corporation | 173 | 1.6% |
| technology | 127 | 1.2% |
| of | 114 | 1.1% |
| technologies | 109 | 1.0% |
| Other values (2168) | 7411 |
Most occurring characters
| Value | Count | Frequency (%) |
| 8043 | 11.3% | |
| O | 5737 | 8.1% |
| I | 5254 | 7.4% |
| N | 5135 | 7.2% |
| E | 5007 | 7.1% |
| C | 4944 | 7.0% |
| T | 4189 | 5.9% |
| A | 4064 | 5.7% |
| R | 3925 | 5.5% |
| S | 3881 | 5.5% |
| Other values (37) | 20737 |
Most occurring categories
| Value | Count | Frequency (%) |
| Uppercase Letter | 60384 | |
| Space Separator | 8043 | 11.3% |
| Other Punctuation | 1396 | 2.0% |
| Math Symbol | 311 | 0.4% |
| Open Punctuation | 254 | 0.4% |
| Close Punctuation | 244 | 0.3% |
| Dash Punctuation | 216 | 0.3% |
| Decimal Number | 68 | 0.1% |
Most frequent character per category
Uppercase Letter
| Value | Count | Frequency (%) |
| O | 5737 | 9.5% |
| I | 5254 | 8.7% |
| N | 5135 | 8.5% |
| E | 5007 | 8.3% |
| C | 4944 | 8.2% |
| T | 4189 | 6.9% |
| A | 4064 | 6.7% |
| R | 3925 | 6.5% |
| S | 3881 | 6.4% |
| L | 3645 | 6.0% |
| Other values (16) | 14603 |
Other Punctuation
| Value | Count | Frequency (%) |
| . | 1220 | |
| & | 109 | 7.8% |
| / | 50 | 3.6% |
| ' | 7 | 0.5% |
| ; | 5 | 0.4% |
| " | 2 | 0.1% |
| % | 2 | 0.1% |
| ! | 1 | 0.1% |
Decimal Number
| Value | Count | Frequency (%) |
| 1 | 21 | |
| 0 | 16 | |
| 5 | 13 | |
| 3 | 13 | |
| 2 | 3 | 4.4% |
| 6 | 2 | 2.9% |
Math Symbol
| Value | Count | Frequency (%) |
| | | 306 | |
| + | 5 | 1.6% |
Close Punctuation
| Value | Count | Frequency (%) |
| ) | 236 | |
| ] | 8 | 3.3% |
Space Separator
| Value | Count | Frequency (%) |
| 8043 |
Open Punctuation
| Value | Count | Frequency (%) |
| ( | 254 |
Dash Punctuation
| Value | Count | Frequency (%) |
| - | 216 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Latin | 60384 | |
| Common | 10532 | 14.9% |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| O | 5737 | 9.5% |
| I | 5254 | 8.7% |
| N | 5135 | 8.5% |
| E | 5007 | 8.3% |
| C | 4944 | 8.2% |
| T | 4189 | 6.9% |
| A | 4064 | 6.7% |
| R | 3925 | 6.5% |
| S | 3881 | 6.4% |
| L | 3645 | 6.0% |
| Other values (16) | 14603 |
Common
| Value | Count | Frequency (%) |
| 8043 | ||
| . | 1220 | 11.6% |
| | | 306 | 2.9% |
| ( | 254 | 2.4% |
| ) | 236 | 2.2% |
| - | 216 | 2.1% |
| & | 109 | 1.0% |
| / | 50 | 0.5% |
| 1 | 21 | 0.2% |
| 0 | 16 | 0.2% |
| Other values (11) | 61 | 0.6% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 70916 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 8043 | 11.3% | |
| O | 5737 | 8.1% |
| I | 5254 | 7.4% |
| N | 5135 | 7.2% |
| E | 5007 | 7.1% |
| C | 4944 | 7.0% |
| T | 4189 | 5.9% |
| A | 4064 | 5.7% |
| R | 3925 | 5.5% |
| S | 3881 | 5.5% |
| Other values (37) | 20737 |
Ultimate Parent
Categorical
| Distinct | 1317 |
|---|---|
| Distinct (%) | 47.3% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 223.5 KiB |
| SAMSUNG ELECTRONICS CO LTD | 67 |
|---|---|
| QUALCOMM INC | 38 |
| CANON INC | 33 |
| INTERNATIONAL BUSINESS MACHINES CORP | 26 |
| MICROSOFT CORPORATION | 26 |
| Other values (1312) |
Length
| Max length | 491 |
|---|---|
| Median length | 113 |
| Mean length | 25.179239 |
| Min length | 4 |
Characters and Unicode
| Total characters | 70099 |
|---|---|
| Distinct characters | 47 |
| Distinct categories | 8 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 988 ? |
|---|---|
| Unique (%) | 35.5% |
Sample
| 1st row | SHARKNINJA OPERATING LLC (FORMERLY EURO-PRO OPERATING LLC) | COMPASS CAYMAN SPV 2 LIMITED | SHARKNINJA SALES COMPANY | COMPASS CAYMAN SPV LTD. | EP MIDCO LLC | SHARKNINJA MANAGEMENT COMPANY | EURO-PRO HOLDCO LLC | GLOBAL APPLIANCE UK HOLDCO LIMITED | GLOBAL APPLIANCE TECHNOLOGIES INC |
|---|---|
| 2nd row | LOCKHEED MARTIN CORP. |
| 3rd row | VECTURA GROUP PLC |
| 4th row | UNIVERSITY OF OXFORD |
| 5th row | REDWOOD TECHNOLOGIES LLC |
Common Values
| Value | Count | Frequency (%) |
| SAMSUNG ELECTRONICS CO LTD | 67 | 2.4% |
| QUALCOMM INC | 38 | 1.4% |
| CANON INC | 33 | 1.2% |
| INTERNATIONAL BUSINESS MACHINES CORP | 26 | 0.9% |
| MICROSOFT CORPORATION | 26 | 0.9% |
| PANASONIC HOLDING CORPORATION | 26 | 0.9% |
| HON HAI PRECISION INDUSTRY CO. LTD.(ALSO KNOWN AS FOXCONN] | 25 | 0.9% |
| GENERAL ELECTRIC COMPANY | 25 | 0.9% |
| GENERAL MOTORS CORP | 23 | 0.8% |
| LG ELECTRONICS INC. | 23 | 0.8% |
| Other values (1307) | 2472 |
Length
| Value | Count | Frequency (%) |
| inc | 792 | 7.4% |
| ltd | 496 | 4.6% |
| co | 473 | 4.4% |
| corp | 440 | 4.1% |
| 359 | 3.4% | |
| corporation | 192 | 1.8% |
| llc | 185 | 1.7% |
| of | 131 | 1.2% |
| electronics | 110 | 1.0% |
| technology | 104 | 1.0% |
| Other values (1980) | 7398 |
Most occurring characters
| Value | Count | Frequency (%) |
| 7896 | 11.3% | |
| O | 5757 | 8.2% |
| N | 5217 | 7.4% |
| I | 5205 | 7.4% |
| E | 4877 | 7.0% |
| C | 4761 | 6.8% |
| T | 4114 | 5.9% |
| A | 4036 | 5.8% |
| R | 3937 | 5.6% |
| S | 3814 | 5.4% |
| Other values (37) | 20485 |
Most occurring categories
| Value | Count | Frequency (%) |
| Uppercase Letter | 59695 | |
| Space Separator | 7896 | 11.3% |
| Other Punctuation | 1387 | 2.0% |
| Open Punctuation | 303 | 0.4% |
| Close Punctuation | 288 | 0.4% |
| Math Symbol | 247 | 0.4% |
| Dash Punctuation | 207 | 0.3% |
| Decimal Number | 76 | 0.1% |
Most frequent character per category
Uppercase Letter
| Value | Count | Frequency (%) |
| O | 5757 | 9.6% |
| N | 5217 | 8.7% |
| I | 5205 | 8.7% |
| E | 4877 | 8.2% |
| C | 4761 | 8.0% |
| T | 4114 | 6.9% |
| A | 4036 | 6.8% |
| R | 3937 | 6.6% |
| S | 3814 | 6.4% |
| L | 3464 | 5.8% |
| Other values (16) | 14513 |
Other Punctuation
| Value | Count | Frequency (%) |
| . | 1188 | |
| & | 125 | 9.0% |
| / | 58 | 4.2% |
| ' | 6 | 0.4% |
| ; | 5 | 0.4% |
| " | 2 | 0.1% |
| % | 2 | 0.1% |
| ! | 1 | 0.1% |
Decimal Number
| Value | Count | Frequency (%) |
| 1 | 21 | |
| 0 | 20 | |
| 5 | 17 | |
| 3 | 14 | |
| 2 | 2 | 2.6% |
| 6 | 2 | 2.6% |
Close Punctuation
| Value | Count | Frequency (%) |
| ) | 260 | |
| ] | 28 | 9.7% |
Math Symbol
| Value | Count | Frequency (%) |
| | | 243 | |
| + | 4 | 1.6% |
Space Separator
| Value | Count | Frequency (%) |
| 7896 |
Open Punctuation
| Value | Count | Frequency (%) |
| ( | 303 |
Dash Punctuation
| Value | Count | Frequency (%) |
| - | 207 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Latin | 59695 | |
| Common | 10404 | 14.8% |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| O | 5757 | 9.6% |
| N | 5217 | 8.7% |
| I | 5205 | 8.7% |
| E | 4877 | 8.2% |
| C | 4761 | 8.0% |
| T | 4114 | 6.9% |
| A | 4036 | 6.8% |
| R | 3937 | 6.6% |
| S | 3814 | 6.4% |
| L | 3464 | 5.8% |
| Other values (16) | 14513 |
Common
| Value | Count | Frequency (%) |
| 7896 | ||
| . | 1188 | 11.4% |
| ( | 303 | 2.9% |
| ) | 260 | 2.5% |
| | | 243 | 2.3% |
| - | 207 | 2.0% |
| & | 125 | 1.2% |
| / | 58 | 0.6% |
| ] | 28 | 0.3% |
| 1 | 21 | 0.2% |
| Other values (11) | 75 | 0.7% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 70099 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 7896 | 11.3% | |
| O | 5757 | 8.2% |
| N | 5217 | 7.4% |
| I | 5205 | 7.4% |
| E | 4877 | 7.0% |
| C | 4761 | 6.8% |
| T | 4114 | 5.9% |
| A | 4036 | 5.8% |
| R | 3937 | 5.6% |
| S | 3814 | 5.4% |
| Other values (37) | 20485 |
Inventor
Categorical
HIGH CARDINALITY  UNIFORM 
| Distinct | 2766 |
|---|---|
| Distinct (%) | 99.4% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 291.2 KiB |
| Matsuda, Yoshimoto | 3 |
|---|---|
| Collard, Joseph | Khorkova Sherman, Olga | 2 |
| Horstman, John Bernard | Swier, Steven | 2 |
| Visenzi, Giuseppe | 2 |
| Sasaki, Yasushi | Murakami, Yuhichiroh | Yamamoto, Etsuo | 2 |
| Other values (2761) |
Length
| Max length | 279 |
|---|---|
| Median length | 165 |
| Mean length | 49.434267 |
| Min length | 6 |
Characters and Unicode
| Total characters | 137625 |
|---|---|
| Distinct characters | 80 |
| Distinct categories | 9 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 2 ? |
Unique
| Unique | 2749 ? |
|---|---|
| Unique (%) | 98.7% |
Sample
| 1st row | Breit, Oliver Rudolph |
|---|---|
| 2nd row | Welsh, William A. |
| 3rd row | Staniforth, John Nicholas |
| 4th row | Waldmann, Herman | Fairchild, Paul J. | Gardner, Richard | Brook, Frances |
| 5th row | Ishiguro, Ryuji | Osawa, Yoshitomo | Osakabe, Yoshio | Sato, Makoto | Shima, Hisato | Asano, Tomoyuki |
Common Values
| Value | Count | Frequency (%) |
| Matsuda, Yoshimoto | 3 | 0.1% |
| Collard, Joseph | Khorkova Sherman, Olga | 2 | 0.1% |
| Horstman, John Bernard | Swier, Steven | 2 | 0.1% |
| Visenzi, Giuseppe | 2 | 0.1% |
| Sasaki, Yasushi | Murakami, Yuhichiroh | Yamamoto, Etsuo | 2 | 0.1% |
| Vauchel, Guy Bernard | 2 | 0.1% |
| Cleverdon, Robert Fletcher | Phillips, Christine Marie | Timken, Hye Kyung Cho | 2 | 0.1% |
| Tovey, Cameron John | 2 | 0.1% |
| Ciesla, Craig Michael | Yairi, Micah B. | Saal, Nathaniel Mark | 2 | 0.1% |
| Tsuchi, Hiroshi | 2 | 0.1% |
| Other values (2756) | 2763 |
Length
| Value | Count | Frequency (%) |
| 4913 | 21.1% | |
| j | 183 | 0.8% |
| a | 177 | 0.8% |
| michael | 165 | 0.7% |
| kim | 137 | 0.6% |
| david | 130 | 0.6% |
| john | 126 | 0.5% |
| m | 125 | 0.5% |
| lee | 116 | 0.5% |
| s | 110 | 0.5% |
| Other values (8592) | 17119 |
Most occurring characters
| Value | Count | Frequency (%) |
| 20517 | 14.9% | |
| a | 11218 | 8.2% |
| i | 8211 | 6.0% |
| e | 8198 | 6.0% |
| , | 7770 | 5.6% |
| n | 7545 | 5.5% |
| o | 6440 | 4.7% |
| r | 6142 | 4.5% |
| | | 4912 | 3.6% |
| h | 4510 | 3.3% |
| Other values (70) | 52162 |
Most occurring categories
| Value | Count | Frequency (%) |
| Lowercase Letter | 83064 | |
| Space Separator | 20517 | 14.9% |
| Uppercase Letter | 19083 | 13.9% |
| Other Punctuation | 9388 | 6.8% |
| Math Symbol | 4912 | 3.6% |
| Dash Punctuation | 645 | 0.5% |
| Open Punctuation | 7 | < 0.1% |
| Close Punctuation | 7 | < 0.1% |
| Control | 2 | < 0.1% |
Most frequent character per category
Lowercase Letter
| Value | Count | Frequency (%) |
| a | 11218 | |
| i | 8211 | |
| e | 8198 | |
| n | 7545 | 9.1% |
| o | 6440 | 7.8% |
| r | 6142 | 7.4% |
| h | 4510 | 5.4% |
| s | 3863 | 4.7% |
| u | 3837 | 4.6% |
| l | 3399 | 4.1% |
| Other values (32) | 19701 |
Uppercase Letter
| Value | Count | Frequency (%) |
| S | 1784 | 9.3% |
| M | 1595 | 8.4% |
| K | 1368 | 7.2% |
| J | 1344 | 7.0% |
| H | 1212 | 6.4% |
| C | 1114 | 5.8% |
| A | 1030 | 5.4% |
| T | 1026 | 5.4% |
| R | 869 | 4.6% |
| L | 855 | 4.5% |
| Other values (16) | 6886 |
Other Punctuation
| Value | Count | Frequency (%) |
| , | 7770 | |
| . | 1598 | 17.0% |
| ' | 20 | 0.2% |
Open Punctuation
| Value | Count | Frequency (%) |
| ( | 6 | |
| { | 1 | 14.3% |
Close Punctuation
| Value | Count | Frequency (%) |
| ) | 6 | |
| } | 1 | 14.3% |
Control
| Value | Count | Frequency (%) |
| | 1 | |
| | 1 |
Space Separator
| Value | Count | Frequency (%) |
| 20517 |
Math Symbol
| Value | Count | Frequency (%) |
| | | 4912 |
Dash Punctuation
| Value | Count | Frequency (%) |
| - | 645 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Latin | 102147 | |
| Common | 35478 | 25.8% |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| a | 11218 | 11.0% |
| i | 8211 | 8.0% |
| e | 8198 | 8.0% |
| n | 7545 | 7.4% |
| o | 6440 | 6.3% |
| r | 6142 | 6.0% |
| h | 4510 | 4.4% |
| s | 3863 | 3.8% |
| u | 3837 | 3.8% |
| l | 3399 | 3.3% |
| Other values (58) | 38784 |
Common
| Value | Count | Frequency (%) |
| 20517 | ||
| , | 7770 | 21.9% |
| | | 4912 | 13.8% |
| . | 1598 | 4.5% |
| - | 645 | 1.8% |
| ' | 20 | 0.1% |
| ( | 6 | < 0.1% |
| ) | 6 | < 0.1% |
| } | 1 | < 0.1% |
| { | 1 | < 0.1% |
| Other values (2) | 2 | < 0.1% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 137522 | |
| None | 103 | 0.1% |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 20517 | 14.9% | |
| a | 11218 | 8.2% |
| i | 8211 | 6.0% |
| e | 8198 | 6.0% |
| , | 7770 | 5.7% |
| n | 7545 | 5.5% |
| o | 6440 | 4.7% |
| r | 6142 | 4.5% |
| | | 4912 | 3.6% |
| h | 4510 | 3.3% |
| Other values (52) | 52059 |
None
| Value | Count | Frequency (%) |
| é | 27 | |
| ü | 25 | |
| ö | 18 | |
| ä | 10 | 9.7% |
| ç | 5 | 4.9% |
| ø | 2 | 1.9% |
| æ | 2 | 1.9% |
| á | 2 | 1.9% |
| å | 2 | 1.9% |
| è | 2 | 1.9% |
| Other values (8) | 8 | 7.8% |
Inventor Count
Real number (ℝ)
| Distinct | 13 |
|---|---|
| Distinct (%) | 0.5% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Infinite | 0 |
| Infinite (%) | 0.0% |
| Mean | 2.7643678 |
| Minimum | 1 |
|---|---|
| Maximum | 15 |
| Zeros | 0 |
| Zeros (%) | 0.0% |
| Negative | 0 |
| Negative (%) | 0.0% |
| Memory size | 21.9 KiB |
Quantile statistics
| Minimum | 1 |
|---|---|
| 5-th percentile | 1 |
| Q1 | 1 |
| median | 2 |
| Q3 | 4 |
| 95-th percentile | 6 |
| Maximum | 15 |
| Range | 14 |
| Interquartile range (IQR) | 3 |
Descriptive statistics
| Standard deviation | 1.8266035 |
|---|---|
| Coefficient of variation (CV) | 0.66076719 |
| Kurtosis | 3.1839747 |
| Mean | 2.7643678 |
| Median Absolute Deviation (MAD) | 1 |
| Skewness | 1.4941794 |
| Sum | 7696 |
| Variance | 3.3364805 |
| Monotonicity | Not monotonic |
| Value | Count | Frequency (%) |
| 1 | 807 | |
| 2 | 704 | |
| 3 | 517 | |
| 4 | 333 | |
| 5 | 194 | 7.0% |
| 6 | 107 | 3.8% |
| 7 | 61 | 2.2% |
| 8 | 33 | 1.2% |
| 10 | 11 | 0.4% |
| 11 | 7 | 0.3% |
| Other values (3) | 10 | 0.4% |
| Value | Count | Frequency (%) |
| 1 | 807 | |
| 2 | 704 | |
| 3 | 517 | |
| 4 | 333 | |
| 5 | 194 | 7.0% |
| 6 | 107 | 3.8% |
| 7 | 61 | 2.2% |
| 8 | 33 | 1.2% |
| 9 | 5 | 0.2% |
| 10 | 11 | 0.4% |
| Value | Count | Frequency (%) |
| 15 | 1 | < 0.1% |
| 12 | 4 | 0.1% |
| 11 | 7 | 0.3% |
| 10 | 11 | 0.4% |
| 9 | 5 | 0.2% |
| 8 | 33 | 1.2% |
| 7 | 61 | 2.2% |
| 6 | 107 | 3.8% |
| 5 | 194 | |
| 4 | 333 |
Attorney/Agent
Categorical
HIGH CARDINALITY  MISSING 
| Distinct | 1146 |
|---|---|
| Distinct (%) | 44.8% |
| Missing | 226 |
| Missing (%) | 8.1% |
| Memory size | 223.1 KiB |
| Oblon, Spivak, McClelland, Maier & Neustadt, L.L.P. | 63 |
|---|---|
| Sughrue Mion, PLLC | 55 |
| Fish & Richardson P.C. | 36 |
| Birch, Stewart, Kolasch & Birch, LLP | 35 |
| Cantor Colburn LLP | 29 |
| Other values (1141) |
Length
| Max length | 88 |
|---|---|
| Median length | 74 |
| Mean length | 29.422596 |
| Min length | 8 |
Characters and Unicode
| Total characters | 75263 |
|---|---|
| Distinct characters | 69 |
| Distinct categories | 10 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 2 ? |
Unique
| Unique | 787 ? |
|---|---|
| Unique (%) | 30.8% |
Sample
| 1st row | Wolf, Greenfield & Sacks, P.C. |
|---|---|
| 2nd row | Carlson, Gaskey & Olds P.C. |
| 3rd row | Merchant & Gould P.C. |
| 4th row | Chandra, Shweta | Bozicevic, Field & Francis LLP |
| 5th row | Frommer Lawrence & Haug LLP | Frommer, William S. |
Common Values
| Value | Count | Frequency (%) |
| Oblon, Spivak, McClelland, Maier & Neustadt, L.L.P. | 63 | 2.3% |
| Sughrue Mion, PLLC | 55 | 2.0% |
| Fish & Richardson P.C. | 36 | 1.3% |
| Birch, Stewart, Kolasch & Birch, LLP | 35 | 1.3% |
| Cantor Colburn LLP | 29 | 1.0% |
| Brinks Gilson & Lione | 22 | 0.8% |
| Novak Druce Connolly Bove + Quigg LLP | 21 | 0.8% |
| Foley & Lardner LLP | 20 | 0.7% |
| Kenyon & Kenyon LLP | 19 | 0.7% |
| Oliff PLC | 19 | 0.7% |
| Other values (1136) | 2239 | |
| (Missing) | 226 | 8.1% |
Length
| Value | Count | Frequency (%) |
| 1965 | 15.1% | |
| llp | 898 | 6.9% |
| p.c | 275 | 2.1% |
| pllc | 209 | 1.6% |
| law | 186 | 1.4% |
| llc | 154 | 1.2% |
| group | 115 | 0.9% |
| l.l.p | 112 | 0.9% |
| ip | 95 | 0.7% |
| j | 87 | 0.7% |
| Other values (2084) | 8948 |
Most occurring characters
| Value | Count | Frequency (%) |
| 10486 | 13.9% | |
| e | 5066 | 6.7% |
| a | 4191 | 5.6% |
| n | 4070 | 5.4% |
| r | 3835 | 5.1% |
| L | 3494 | 4.6% |
| o | 3365 | 4.5% |
| i | 3087 | 4.1% |
| , | 2968 | 3.9% |
| l | 2695 | 3.6% |
| Other values (59) | 32006 |
Most occurring categories
| Value | Count | Frequency (%) |
| Lowercase Letter | 42570 | |
| Uppercase Letter | 15157 | 20.1% |
| Space Separator | 10486 | 13.9% |
| Other Punctuation | 6384 | 8.5% |
| Math Symbol | 623 | 0.8% |
| Dash Punctuation | 23 | < 0.1% |
| Open Punctuation | 7 | < 0.1% |
| Close Punctuation | 7 | < 0.1% |
| Decimal Number | 5 | < 0.1% |
| Control | 1 | < 0.1% |
Most frequent character per category
Lowercase Letter
| Value | Count | Frequency (%) |
| e | 5066 | |
| a | 4191 | |
| n | 4070 | |
| r | 3835 | 9.0% |
| o | 3365 | 7.9% |
| i | 3087 | 7.3% |
| l | 2695 | 6.3% |
| t | 2437 | 5.7% |
| s | 2392 | 5.6% |
| h | 1385 | 3.3% |
| Other values (17) | 10047 |
Uppercase Letter
| Value | Count | Frequency (%) |
| L | 3494 | |
| P | 2283 | |
| C | 1450 | |
| M | 915 | 6.0% |
| S | 895 | 5.9% |
| B | 683 | 4.5% |
| H | 495 | 3.3% |
| D | 482 | 3.2% |
| K | 468 | 3.1% |
| G | 462 | 3.0% |
| Other values (16) | 3530 |
Other Punctuation
| Value | Count | Frequency (%) |
| , | 2968 | |
| . | 2035 | |
| & | 1359 | |
| ' | 15 | 0.2% |
| : | 5 | 0.1% |
| / | 2 | < 0.1% |
Decimal Number
| Value | Count | Frequency (%) |
| 2 | 2 | |
| 6 | 2 | |
| 3 | 1 |
Math Symbol
| Value | Count | Frequency (%) |
| | | 593 | |
| + | 30 | 4.8% |
Space Separator
| Value | Count | Frequency (%) |
| 10486 |
Dash Punctuation
| Value | Count | Frequency (%) |
| - | 23 |
Open Punctuation
| Value | Count | Frequency (%) |
| ( | 7 |
Close Punctuation
| Value | Count | Frequency (%) |
| ) | 7 |
Control
| Value | Count | Frequency (%) |
| | 1 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Latin | 57727 | |
| Common | 17536 | 23.3% |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| e | 5066 | 8.8% |
| a | 4191 | 7.3% |
| n | 4070 | 7.1% |
| r | 3835 | 6.6% |
| L | 3494 | 6.1% |
| o | 3365 | 5.8% |
| i | 3087 | 5.3% |
| l | 2695 | 4.7% |
| t | 2437 | 4.2% |
| s | 2392 | 4.1% |
| Other values (43) | 23095 |
Common
| Value | Count | Frequency (%) |
| 10486 | ||
| , | 2968 | 16.9% |
| . | 2035 | 11.6% |
| & | 1359 | 7.7% |
| | | 593 | 3.4% |
| + | 30 | 0.2% |
| - | 23 | 0.1% |
| ' | 15 | 0.1% |
| ( | 7 | < 0.1% |
| ) | 7 | < 0.1% |
| Other values (6) | 13 | 0.1% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 75260 | |
| None | 3 | < 0.1% |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 10486 | 13.9% | |
| e | 5066 | 6.7% |
| a | 4191 | 5.6% |
| n | 4070 | 5.4% |
| r | 3835 | 5.1% |
| L | 3494 | 4.6% |
| o | 3365 | 4.5% |
| i | 3087 | 4.1% |
| , | 2968 | 3.9% |
| l | 2695 | 3.6% |
| Other values (57) | 32003 |
None
| Value | Count | Frequency (%) |
| ç | 2 | |
| | 1 |
Correspondent
Unsupported
MISSING  REJECTED  UNSUPPORTED 
| Missing | 2784 |
|---|---|
| Missing (%) | 100.0% |
| Memory size | 21.9 KiB |
Examiner
Categorical
HIGH CARDINALITY  UNIFORM 
| Distinct | 2150 |
|---|---|
| Distinct (%) | 77.2% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 212.0 KiB |
| Marinelli, Patrick F | 7 |
|---|---|
| Lian, Mangtin | 6 |
| Gerrity, Stephen F | 5 |
| Mullins, Burton | 5 |
| Lee, John J | 5 |
| Other values (2145) |
Length
| Max length | 47 |
|---|---|
| Median length | 39 |
| Mean length | 20.912356 |
| Min length | 7 |
Characters and Unicode
| Total characters | 58220 |
|---|---|
| Distinct characters | 64 |
| Distinct categories | 7 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 2 ? |
Unique
| Unique | 1652 ? |
|---|---|
| Unique (%) | 59.3% |
Sample
| 1st row | Ko, Jason |
|---|---|
| 2nd row | Dinh, Tien / Kreiner, Michael |
| 3rd row | Haghighatian, Mina |
| 4th row | Wilson, Michael C. |
| 5th row | Song, Hosuk |
Common Values
| Value | Count | Frequency (%) |
| Marinelli, Patrick F | 7 | 0.3% |
| Lian, Mangtin | 6 | 0.2% |
| Gerrity, Stephen F | 5 | 0.2% |
| Mullins, Burton | 5 | 0.2% |
| Lee, John J | 5 | 0.2% |
| Huynh, Hai | 4 | 0.1% |
| Barnie, Rexford / Dhillon, Jagdeep | 4 | 0.1% |
| Mok, Alex W | 4 | 0.1% |
| Mandala, Michelle | 4 | 0.1% |
| Peace, Rhonda | 4 | 0.1% |
| Other values (2140) | 2736 |
Length
| Value | Count | Frequency (%) |
| 1028 | 10.2% | |
| nguyen | 133 | 1.3% |
| a | 127 | 1.3% |
| j | 126 | 1.3% |
| m | 108 | 1.1% |
| c | 98 | 1.0% |
| d | 89 | 0.9% |
| michael | 80 | 0.8% |
| david | 76 | 0.8% |
| l | 73 | 0.7% |
| Other values (3068) | 8119 |
Most occurring characters
| Value | Count | Frequency (%) |
| 7273 | 12.5% | |
| a | 4722 | 8.1% |
| e | 4211 | 7.2% |
| , | 3870 | 6.6% |
| n | 3627 | 6.2% |
| i | 3022 | 5.2% |
| r | 2706 | 4.6% |
| o | 2473 | 4.2% |
| h | 2052 | 3.5% |
| l | 2030 | 3.5% |
| Other values (54) | 22234 |
Most occurring categories
| Value | Count | Frequency (%) |
| Lowercase Letter | 36640 | |
| Uppercase Letter | 9197 | 15.8% |
| Space Separator | 7273 | 12.5% |
| Other Punctuation | 5042 | 8.7% |
| Dash Punctuation | 66 | 0.1% |
| Open Punctuation | 1 | < 0.1% |
| Close Punctuation | 1 | < 0.1% |
Most frequent character per category
Lowercase Letter
| Value | Count | Frequency (%) |
| a | 4722 | |
| e | 4211 | |
| n | 3627 | |
| i | 3022 | 8.2% |
| r | 2706 | 7.4% |
| o | 2473 | 6.7% |
| h | 2052 | 5.6% |
| l | 2030 | 5.5% |
| s | 1603 | 4.4% |
| t | 1447 | 3.9% |
| Other values (18) | 8747 |
Uppercase Letter
| Value | Count | Frequency (%) |
| M | 766 | 8.3% |
| S | 698 | 7.6% |
| J | 687 | 7.5% |
| C | 641 | 7.0% |
| A | 622 | 6.8% |
| D | 543 | 5.9% |
| L | 483 | 5.3% |
| B | 479 | 5.2% |
| T | 466 | 5.1% |
| R | 450 | 4.9% |
| Other values (17) | 3362 |
Other Punctuation
| Value | Count | Frequency (%) |
| , | 3870 | |
| / | 1028 | 20.4% |
| . | 136 | 2.7% |
| ' | 7 | 0.1% |
| ? | 1 | < 0.1% |
Space Separator
| Value | Count | Frequency (%) |
| 7273 |
Dash Punctuation
| Value | Count | Frequency (%) |
| - | 66 |
Open Punctuation
| Value | Count | Frequency (%) |
| ( | 1 |
Close Punctuation
| Value | Count | Frequency (%) |
| ) | 1 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Latin | 45837 | |
| Common | 12383 | 21.3% |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| a | 4722 | 10.3% |
| e | 4211 | 9.2% |
| n | 3627 | 7.9% |
| i | 3022 | 6.6% |
| r | 2706 | 5.9% |
| o | 2473 | 5.4% |
| h | 2052 | 4.5% |
| l | 2030 | 4.4% |
| s | 1603 | 3.5% |
| t | 1447 | 3.2% |
| Other values (45) | 17944 |
Common
| Value | Count | Frequency (%) |
| 7273 | ||
| , | 3870 | |
| / | 1028 | 8.3% |
| . | 136 | 1.1% |
| - | 66 | 0.5% |
| ' | 7 | 0.1% |
| ( | 1 | < 0.1% |
| ) | 1 | < 0.1% |
| ? | 1 | < 0.1% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 58213 | |
| None | 7 | < 0.1% |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 7273 | 12.5% | |
| a | 4722 | 8.1% |
| e | 4211 | 7.2% |
| , | 3870 | 6.6% |
| n | 3627 | 6.2% |
| i | 3022 | 5.2% |
| r | 2706 | 4.6% |
| o | 2473 | 4.2% |
| h | 2052 | 3.5% |
| l | 2030 | 3.5% |
| Other values (51) | 22227 |
None
| Value | Count | Frequency (%) |
| á | 4 | |
| í | 2 | |
| Á | 1 | 14.3% |
Publication Country Code
Categorical
| Distinct | 1 |
|---|---|
| Distinct (%) | < 0.1% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 160.5 KiB |
| US |
|---|
Length
| Max length | 2 |
|---|---|
| Median length | 2 |
| Mean length | 2 |
| Min length | 2 |
Characters and Unicode
| Total characters | 5568 |
|---|---|
| Distinct characters | 2 |
| Distinct categories | 1 ? |
| Distinct scripts | 1 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 0 ? |
|---|---|
| Unique (%) | 0.0% |
Sample
| 1st row | US |
|---|---|
| 2nd row | US |
| 3rd row | US |
| 4th row | US |
| 5th row | US |
Common Values
| Value | Count | Frequency (%) |
| US | 2784 |
Length
Common Values (Plot)
| Value | Count | Frequency (%) |
| us | 2784 |
Most occurring characters
| Value | Count | Frequency (%) |
| U | 2784 | |
| S | 2784 |
Most occurring categories
| Value | Count | Frequency (%) |
| Uppercase Letter | 5568 |
Most frequent character per category
Uppercase Letter
| Value | Count | Frequency (%) |
| U | 2784 | |
| S | 2784 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Latin | 5568 |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| U | 2784 | |
| S | 2784 |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 5568 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| U | 2784 | |
| S | 2784 |
Dead/Alive
Categorical
| Distinct | 2 |
|---|---|
| Distinct (%) | 0.1% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 167.7 KiB |
| Alive | |
|---|---|
| Dead |
Length
| Max length | 5 |
|---|---|
| Median length | 5 |
| Mean length | 4.6454741 |
| Min length | 4 |
Characters and Unicode
| Total characters | 12933 |
|---|---|
| Distinct characters | 8 |
| Distinct categories | 2 ? |
| Distinct scripts | 1 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 0 ? |
|---|---|
| Unique (%) | 0.0% |
Sample
| 1st row | Alive |
|---|---|
| 2nd row | Alive |
| 3rd row | Dead |
| 4th row | Dead |
| 5th row | Dead |
Common Values
| Value | Count | Frequency (%) |
| Alive | 1797 | |
| Dead | 987 |
Length
Common Values (Plot)
| Value | Count | Frequency (%) |
| alive | 1797 | |
| dead | 987 |
Most occurring characters
| Value | Count | Frequency (%) |
| e | 2784 | |
| A | 1797 | |
| l | 1797 | |
| i | 1797 | |
| v | 1797 | |
| D | 987 | 7.6% |
| a | 987 | 7.6% |
| d | 987 | 7.6% |
Most occurring categories
| Value | Count | Frequency (%) |
| Lowercase Letter | 10149 | |
| Uppercase Letter | 2784 | 21.5% |
Most frequent character per category
Lowercase Letter
| Value | Count | Frequency (%) |
| e | 2784 | |
| l | 1797 | |
| i | 1797 | |
| v | 1797 | |
| a | 987 | 9.7% |
| d | 987 | 9.7% |
Uppercase Letter
| Value | Count | Frequency (%) |
| A | 1797 | |
| D | 987 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Latin | 12933 |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| e | 2784 | |
| A | 1797 | |
| l | 1797 | |
| i | 1797 | |
| v | 1797 | |
| D | 987 | 7.6% |
| a | 987 | 7.6% |
| d | 987 | 7.6% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 12933 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| e | 2784 | |
| A | 1797 | |
| l | 1797 | |
| i | 1797 | |
| v | 1797 | |
| D | 987 | 7.6% |
| a | 987 | 7.6% |
| d | 987 | 7.6% |
Publication Month
Categorical
| Distinct | 1 |
|---|---|
| Distinct (%) | < 0.1% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 160.5 KiB |
| 12 |
|---|
Length
| Max length | 2 |
|---|---|
| Median length | 2 |
| Mean length | 2 |
| Min length | 2 |
Characters and Unicode
| Total characters | 5568 |
|---|---|
| Distinct characters | 2 |
| Distinct categories | 1 ? |
| Distinct scripts | 1 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 0 ? |
|---|---|
| Unique (%) | 0.0% |
Sample
| 1st row | 12 |
|---|---|
| 2nd row | 12 |
| 3rd row | 12 |
| 4th row | 12 |
| 5th row | 12 |
Common Values
| Value | Count | Frequency (%) |
| 12 | 2784 |
Length
Common Values (Plot)
| Value | Count | Frequency (%) |
| 12 | 2784 |
Most occurring characters
| Value | Count | Frequency (%) |
| 1 | 2784 | |
| 2 | 2784 |
Most occurring categories
| Value | Count | Frequency (%) |
| Decimal Number | 5568 |
Most frequent character per category
Decimal Number
| Value | Count | Frequency (%) |
| 1 | 2784 | |
| 2 | 2784 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Common | 5568 |
Most frequent character per script
Common
| Value | Count | Frequency (%) |
| 1 | 2784 | |
| 2 | 2784 |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 5568 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 1 | 2784 | |
| 2 | 2784 |
Publication Year
Categorical
| Distinct | 1 |
|---|---|
| Distinct (%) | < 0.1% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 166.0 KiB |
| 2014 |
|---|
Length
| Max length | 4 |
|---|---|
| Median length | 4 |
| Mean length | 4 |
| Min length | 4 |
Characters and Unicode
| Total characters | 11136 |
|---|---|
| Distinct characters | 4 |
| Distinct categories | 1 ? |
| Distinct scripts | 1 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 0 ? |
|---|---|
| Unique (%) | 0.0% |
Sample
| 1st row | 2014 |
|---|---|
| 2nd row | 2014 |
| 3rd row | 2014 |
| 4th row | 2014 |
| 5th row | 2014 |
Common Values
| Value | Count | Frequency (%) |
| 2014 | 2784 |
Length
Common Values (Plot)
| Value | Count | Frequency (%) |
| 2014 | 2784 |
Most occurring characters
| Value | Count | Frequency (%) |
| 2 | 2784 | |
| 0 | 2784 | |
| 1 | 2784 | |
| 4 | 2784 |
Most occurring categories
| Value | Count | Frequency (%) |
| Decimal Number | 11136 |
Most frequent character per category
Decimal Number
| Value | Count | Frequency (%) |
| 2 | 2784 | |
| 0 | 2784 | |
| 1 | 2784 | |
| 4 | 2784 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Common | 11136 |
Most frequent character per script
Common
| Value | Count | Frequency (%) |
| 2 | 2784 | |
| 0 | 2784 | |
| 1 | 2784 | |
| 4 | 2784 |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 11136 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 2 | 2784 | |
| 0 | 2784 | |
| 1 | 2784 | |
| 4 | 2784 |
Application Country/Region
Categorical
| Distinct | 1 |
|---|---|
| Distinct (%) | < 0.1% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 160.5 KiB |
| US |
|---|
Length
| Max length | 2 |
|---|---|
| Median length | 2 |
| Mean length | 2 |
| Min length | 2 |
Characters and Unicode
| Total characters | 5568 |
|---|---|
| Distinct characters | 2 |
| Distinct categories | 1 ? |
| Distinct scripts | 1 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 0 ? |
|---|---|
| Unique (%) | 0.0% |
Sample
| 1st row | US |
|---|---|
| 2nd row | US |
| 3rd row | US |
| 4th row | US |
| 5th row | US |
Common Values
| Value | Count | Frequency (%) |
| US | 2784 |
Length
Common Values (Plot)
| Value | Count | Frequency (%) |
| us | 2784 |
Most occurring characters
| Value | Count | Frequency (%) |
| U | 2784 | |
| S | 2784 |
Most occurring categories
| Value | Count | Frequency (%) |
| Uppercase Letter | 5568 |
Most frequent character per category
Uppercase Letter
| Value | Count | Frequency (%) |
| U | 2784 | |
| S | 2784 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Latin | 5568 |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| U | 2784 | |
| S | 2784 |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 5568 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| U | 2784 | |
| S | 2784 |
Application Month
Real number (ℝ)
| Distinct | 12 |
|---|---|
| Distinct (%) | 0.4% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Infinite | 0 |
| Infinite (%) | 0.0% |
| Mean | 6.5520833 |
| Minimum | 1 |
|---|---|
| Maximum | 12 |
| Zeros | 0 |
| Zeros (%) | 0.0% |
| Negative | 0 |
| Negative (%) | 0.0% |
| Memory size | 21.9 KiB |
Quantile statistics
| Minimum | 1 |
|---|---|
| 5-th percentile | 1 |
| Q1 | 3 |
| median | 6 |
| Q3 | 10 |
| 95-th percentile | 12 |
| Maximum | 12 |
| Range | 11 |
| Interquartile range (IQR) | 7 |
Descriptive statistics
| Standard deviation | 3.47055 |
|---|---|
| Coefficient of variation (CV) | 0.52968648 |
| Kurtosis | -1.2292411 |
| Mean | 6.5520833 |
| Median Absolute Deviation (MAD) | 3 |
| Skewness | 0.029163552 |
| Sum | 18241 |
| Variance | 12.044717 |
| Monotonicity | Not monotonic |
| Value | Count | Frequency (%) |
| 3 | 280 | |
| 12 | 275 | |
| 8 | 239 | |
| 5 | 237 | |
| 6 | 234 | |
| 4 | 230 | |
| 9 | 224 | |
| 11 | 219 | |
| 10 | 218 | |
| 2 | 211 | |
| Other values (2) | 417 |
| Value | Count | Frequency (%) |
| 1 | 211 | |
| 2 | 211 | |
| 3 | 280 | |
| 4 | 230 | |
| 5 | 237 | |
| 6 | 234 | |
| 7 | 206 | |
| 8 | 239 | |
| 9 | 224 | |
| 10 | 218 |
| Value | Count | Frequency (%) |
| 12 | 275 | |
| 11 | 219 | |
| 10 | 218 | |
| 9 | 224 | |
| 8 | 239 | |
| 7 | 206 | |
| 6 | 234 | |
| 5 | 237 | |
| 4 | 230 | |
| 3 | 280 |
Application Year
Real number (ℝ)
| Distinct | 14 |
|---|---|
| Distinct (%) | 0.5% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Infinite | 0 |
| Infinite (%) | 0.0% |
| Mean | 2011.1171 |
| Minimum | 2000 |
|---|---|
| Maximum | 2014 |
| Zeros | 0 |
| Zeros (%) | 0.0% |
| Negative | 0 |
| Negative (%) | 0.0% |
| Memory size | 21.9 KiB |
Quantile statistics
| Minimum | 2000 |
|---|---|
| 5-th percentile | 2007 |
| Q1 | 2010 |
| median | 2012 |
| Q3 | 2012 |
| 95-th percentile | 2013 |
| Maximum | 2014 |
| Range | 14 |
| Interquartile range (IQR) | 2 |
Descriptive statistics
| Standard deviation | 1.7234018 |
|---|---|
| Coefficient of variation (CV) | 0.00085693755 |
| Kurtosis | 3.4607655 |
| Mean | 2011.1171 |
| Median Absolute Deviation (MAD) | 1 |
| Skewness | -1.5761174 |
| Sum | 5598950 |
| Variance | 2.9701136 |
| Monotonicity | Not monotonic |
| Value | Count | Frequency (%) |
| 2012 | 941 | |
| 2011 | 673 | |
| 2013 | 449 | |
| 2010 | 320 | 11.5% |
| 2009 | 155 | 5.6% |
| 2008 | 81 | 2.9% |
| 2007 | 65 | 2.3% |
| 2006 | 47 | 1.7% |
| 2014 | 22 | 0.8% |
| 2005 | 19 | 0.7% |
| Other values (4) | 12 | 0.4% |
| Value | Count | Frequency (%) |
| 2000 | 1 | < 0.1% |
| 2002 | 3 | 0.1% |
| 2003 | 3 | 0.1% |
| 2004 | 5 | 0.2% |
| 2005 | 19 | 0.7% |
| 2006 | 47 | 1.7% |
| 2007 | 65 | 2.3% |
| 2008 | 81 | 2.9% |
| 2009 | 155 | |
| 2010 | 320 |
| Value | Count | Frequency (%) |
| 2014 | 22 | 0.8% |
| 2013 | 449 | |
| 2012 | 941 | |
| 2011 | 673 | |
| 2010 | 320 | 11.5% |
| 2009 | 155 | 5.6% |
| 2008 | 81 | 2.9% |
| 2007 | 65 | 2.3% |
| 2006 | 47 | 1.7% |
| 2005 | 19 | 0.7% |
Priority Date - Earliest
Categorical
HIGH CARDINALITY  UNIFORM 
| Distinct | 1467 |
|---|---|
| Distinct (%) | 52.7% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 182.3 KiB |
| 2011-06-29 | 8 |
|---|---|
| 2012-04-27 | 8 |
| 2011-12-22 | 8 |
| 2010-02-12 | 8 |
| 2010-10-19 | 8 |
| Other values (1462) |
Length
| Max length | 10 |
|---|---|
| Median length | 10 |
| Mean length | 10 |
| Min length | 10 |
Characters and Unicode
| Total characters | 27840 |
|---|---|
| Distinct characters | 11 |
| Distinct categories | 2 ? |
| Distinct scripts | 1 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 787 ? |
|---|---|
| Unique (%) | 28.3% |
Sample
| 1st row | 2009-09-25 |
|---|---|
| 2nd row | 2008-03-20 |
| 3rd row | 1995-01-31 |
| 4th row | 1998-11-05 |
| 5th row | 1997-04-23 |
Common Values
| Value | Count | Frequency (%) |
| 2011-06-29 | 8 | 0.3% |
| 2012-04-27 | 8 | 0.3% |
| 2011-12-22 | 8 | 0.3% |
| 2010-02-12 | 8 | 0.3% |
| 2010-10-19 | 8 | 0.3% |
| 2011-03-08 | 8 | 0.3% |
| 2010-06-04 | 8 | 0.3% |
| 2011-09-16 | 8 | 0.3% |
| 2010-09-22 | 7 | 0.3% |
| 2010-09-30 | 7 | 0.3% |
| Other values (1457) | 2706 |
Length
| Value | Count | Frequency (%) |
| 2011-06-29 | 8 | 0.3% |
| 2011-12-22 | 8 | 0.3% |
| 2010-02-12 | 8 | 0.3% |
| 2010-10-19 | 8 | 0.3% |
| 2011-03-08 | 8 | 0.3% |
| 2010-06-04 | 8 | 0.3% |
| 2011-09-16 | 8 | 0.3% |
| 2012-04-27 | 8 | 0.3% |
| 2010-09-29 | 7 | 0.3% |
| 2012-01-31 | 7 | 0.3% |
| Other values (1457) | 2706 |
Most occurring characters
| Value | Count | Frequency (%) |
| 0 | 7827 | |
| - | 5568 | |
| 2 | 4816 | |
| 1 | 4657 | |
| 9 | 940 | 3.4% |
| 3 | 837 | 3.0% |
| 8 | 753 | 2.7% |
| 6 | 672 | 2.4% |
| 7 | 639 | 2.3% |
| 4 | 573 | 2.1% |
Most occurring categories
| Value | Count | Frequency (%) |
| Decimal Number | 22272 | |
| Dash Punctuation | 5568 | 20.0% |
Most frequent character per category
Decimal Number
| Value | Count | Frequency (%) |
| 0 | 7827 | |
| 2 | 4816 | |
| 1 | 4657 | |
| 9 | 940 | 4.2% |
| 3 | 837 | 3.8% |
| 8 | 753 | 3.4% |
| 6 | 672 | 3.0% |
| 7 | 639 | 2.9% |
| 4 | 573 | 2.6% |
| 5 | 558 | 2.5% |
Dash Punctuation
| Value | Count | Frequency (%) |
| - | 5568 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Common | 27840 |
Most frequent character per script
Common
| Value | Count | Frequency (%) |
| 0 | 7827 | |
| - | 5568 | |
| 2 | 4816 | |
| 1 | 4657 | |
| 9 | 940 | 3.4% |
| 3 | 837 | 3.0% |
| 8 | 753 | 2.7% |
| 6 | 672 | 2.4% |
| 7 | 639 | 2.3% |
| 4 | 573 | 2.1% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 27840 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 0 | 7827 | |
| - | 5568 | |
| 2 | 4816 | |
| 1 | 4657 | |
| 9 | 940 | 3.4% |
| 3 | 837 | 3.0% |
| 8 | 753 | 2.7% |
| 6 | 672 | 2.4% |
| 7 | 639 | 2.3% |
| 4 | 573 | 2.1% |
Earliest Priority Year
Real number (ℝ)
| Distinct | 20 |
|---|---|
| Distinct (%) | 0.7% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Infinite | 0 |
| Infinite (%) | 0.0% |
| Mean | 2009.2557 |
| Minimum | 1995 |
|---|---|
| Maximum | 2014 |
| Zeros | 0 |
| Zeros (%) | 0.0% |
| Negative | 0 |
| Negative (%) | 0.0% |
| Memory size | 21.9 KiB |
Quantile statistics
| Minimum | 1995 |
|---|---|
| 5-th percentile | 2004 |
| Q1 | 2008 |
| median | 2010 |
| Q3 | 2011 |
| 95-th percentile | 2012 |
| Maximum | 2014 |
| Range | 19 |
| Interquartile range (IQR) | 3 |
Descriptive statistics
| Standard deviation | 2.5754799 |
|---|---|
| Coefficient of variation (CV) | 0.0012818079 |
| Kurtosis | 3.0492099 |
| Mean | 2009.2557 |
| Median Absolute Deviation (MAD) | 1 |
| Skewness | -1.4800948 |
| Sum | 5593768 |
| Variance | 6.6330967 |
| Monotonicity | Not monotonic |
| Value | Count | Frequency (%) |
| 2011 | 645 | |
| 2010 | 594 | |
| 2009 | 381 | |
| 2012 | 301 | |
| 2008 | 243 | 8.7% |
| 2007 | 174 | 6.2% |
| 2006 | 128 | 4.6% |
| 2005 | 88 | 3.2% |
| 2013 | 61 | 2.2% |
| 2004 | 53 | 1.9% |
| Other values (10) | 116 | 4.2% |
| Value | Count | Frequency (%) |
| 1995 | 1 | < 0.1% |
| 1996 | 1 | < 0.1% |
| 1997 | 4 | 0.1% |
| 1998 | 4 | 0.1% |
| 1999 | 10 | 0.4% |
| 2000 | 15 | 0.5% |
| 2001 | 12 | 0.4% |
| 2002 | 17 | 0.6% |
| 2003 | 38 | |
| 2004 | 53 |
| Value | Count | Frequency (%) |
| 2014 | 14 | 0.5% |
| 2013 | 61 | 2.2% |
| 2012 | 301 | |
| 2011 | 645 | |
| 2010 | 594 | |
| 2009 | 381 | |
| 2008 | 243 | 8.7% |
| 2007 | 174 | 6.2% |
| 2006 | 128 | 4.6% |
| 2005 | 88 | 3.2% |
IPC Class
Categorical
| Distinct | 940 |
|---|---|
| Distinct (%) | 33.8% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 173.6 KiB |
| H04 | |
|---|---|
| A61 | 187 |
| H01 | 187 |
| G06 | 166 |
| G06, H04 | 92 |
| Other values (935) |
Length
| Max length | 38 |
|---|---|
| Median length | 33 |
| Mean length | 6.8128592 |
| Min length | 3 |
Characters and Unicode
| Total characters | 18967 |
|---|---|
| Distinct characters | 20 |
| Distinct categories | 4 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 704 ? |
|---|---|
| Unique (%) | 25.3% |
Sample
| 1st row | B08, A47 |
|---|---|
| 2nd row | B64, F01, F16, G01, H02 |
| 3rd row | A61 |
| 4th row | C12 |
| 5th row | H04, G06, G09, G11 |
Common Values
| Value | Count | Frequency (%) |
| H04 | 257 | 9.2% |
| A61 | 187 | 6.7% |
| H01 | 187 | 6.7% |
| G06 | 166 | 6.0% |
| G06, H04 | 92 | 3.3% |
| G01 | 41 | 1.5% |
| H04, G06 | 40 | 1.4% |
| F16 | 33 | 1.2% |
| H02 | 31 | 1.1% |
| B65 | 29 | 1.0% |
| Other values (930) | 1721 |
Length
| Value | Count | Frequency (%) |
| h04 | 541 | 11.0% |
| g06 | 490 | 10.0% |
| h01 | 430 | 8.8% |
| a61 | 381 | 7.8% |
| g01 | 243 | 5.0% |
| f16 | 125 | 2.5% |
| b60 | 121 | 2.5% |
| b01 | 115 | 2.3% |
| h02 | 114 | 2.3% |
| c07 | 111 | 2.3% |
| Other values (106) | 2236 |
Most occurring characters
| Value | Count | Frequency (%) |
| 0 | 3404 | |
| , | 2123 | |
| 2123 | ||
| 1 | 1908 | |
| 6 | 1376 | |
| H | 1258 | 6.6% |
| G | 1212 | 6.4% |
| 2 | 948 | 5.0% |
| 4 | 821 | 4.3% |
| B | 772 | 4.1% |
| Other values (10) | 3022 |
Most occurring categories
| Value | Count | Frequency (%) |
| Decimal Number | 9814 | |
| Uppercase Letter | 4907 | |
| Other Punctuation | 2123 | 11.2% |
| Space Separator | 2123 | 11.2% |
Most frequent character per category
Decimal Number
| Value | Count | Frequency (%) |
| 0 | 3404 | |
| 1 | 1908 | |
| 6 | 1376 | |
| 2 | 948 | 9.7% |
| 4 | 821 | 8.4% |
| 3 | 391 | 4.0% |
| 5 | 386 | 3.9% |
| 9 | 208 | 2.1% |
| 8 | 187 | 1.9% |
| 7 | 185 | 1.9% |
Uppercase Letter
| Value | Count | Frequency (%) |
| H | 1258 | |
| G | 1212 | |
| B | 772 | |
| A | 567 | |
| C | 528 | |
| F | 445 | 9.1% |
| E | 89 | 1.8% |
| D | 36 | 0.7% |
Other Punctuation
| Value | Count | Frequency (%) |
| , | 2123 |
Space Separator
| Value | Count | Frequency (%) |
| 2123 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Common | 14060 | |
| Latin | 4907 | 25.9% |
Most frequent character per script
Common
| Value | Count | Frequency (%) |
| 0 | 3404 | |
| , | 2123 | |
| 2123 | ||
| 1 | 1908 | |
| 6 | 1376 | |
| 2 | 948 | 6.7% |
| 4 | 821 | 5.8% |
| 3 | 391 | 2.8% |
| 5 | 386 | 2.7% |
| 9 | 208 | 1.5% |
| Other values (2) | 372 | 2.6% |
Latin
| Value | Count | Frequency (%) |
| H | 1258 | |
| G | 1212 | |
| B | 772 | |
| A | 567 | |
| C | 528 | |
| F | 445 | 9.1% |
| E | 89 | 1.8% |
| D | 36 | 0.7% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 18967 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 0 | 3404 | |
| , | 2123 | |
| 2123 | ||
| 1 | 1908 | |
| 6 | 1376 | |
| H | 1258 | 6.6% |
| G | 1212 | 6.4% |
| 2 | 948 | 5.0% |
| 4 | 821 | 4.3% |
| B | 772 | 4.1% |
| Other values (10) | 3022 |
CPC Class
Categorical
| Distinct | 1115 |
|---|---|
| Distinct (%) | 40.1% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 177.8 KiB |
| H04 | |
|---|---|
| A61 | 174 |
| G06 | 120 |
| H01 | 107 |
| G06, H04 | 49 |
| Other values (1110) |
Length
| Max length | 48 |
|---|---|
| Median length | 33 |
| Mean length | 8.3573994 |
| Min length | 3 |
Characters and Unicode
| Total characters | 23267 |
|---|---|
| Distinct characters | 21 |
| Distinct categories | 4 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 855 ? |
|---|---|
| Unique (%) | 30.7% |
Sample
| 1st row | B08, A47 |
|---|---|
| 2nd row | B64, F01, F16, G01, H02, Y10 |
| 3rd row | A61 |
| 4th row | C12, A61 |
| 5th row | H04, G06, G11 |
Common Values
| Value | Count | Frequency (%) |
| H04 | 269 | 9.7% |
| A61 | 174 | 6.2% |
| G06 | 120 | 4.3% |
| H01 | 107 | 3.8% |
| G06, H04 | 49 | 1.8% |
| H04, G06 | 48 | 1.7% |
| H01, Y02 | 45 | 1.6% |
| G01 | 35 | 1.3% |
| H04, Y02 | 24 | 0.9% |
| G02 | 23 | 0.8% |
| Other values (1105) | 1890 |
Length
| Value | Count | Frequency (%) |
| h04 | 536 | 9.3% |
| y10 | 533 | 9.2% |
| y02 | 423 | 7.3% |
| h01 | 400 | 6.9% |
| a61 | 400 | 6.9% |
| g06 | 393 | 6.8% |
| g01 | 216 | 3.7% |
| g02 | 127 | 2.2% |
| b60 | 121 | 2.1% |
| h02 | 114 | 2.0% |
| Other values (111) | 2504 |
Most occurring characters
| Value | Count | Frequency (%) |
| 0 | 4285 | |
| , | 2983 | |
| 2983 | ||
| 1 | 2461 | |
| 2 | 1375 | 5.9% |
| 6 | 1284 | 5.5% |
| H | 1272 | 5.5% |
| G | 1107 | 4.8% |
| Y | 970 | 4.2% |
| 4 | 813 | 3.5% |
| Other values (11) | 3734 |
Most occurring categories
| Value | Count | Frequency (%) |
| Decimal Number | 11534 | |
| Uppercase Letter | 5767 | |
| Other Punctuation | 2983 | 12.8% |
| Space Separator | 2983 | 12.8% |
Most frequent character per category
Decimal Number
| Value | Count | Frequency (%) |
| 0 | 4285 | |
| 1 | 2461 | |
| 2 | 1375 | 11.9% |
| 6 | 1284 | 11.1% |
| 4 | 813 | 7.0% |
| 5 | 374 | 3.2% |
| 3 | 359 | 3.1% |
| 9 | 205 | 1.8% |
| 8 | 194 | 1.7% |
| 7 | 184 | 1.6% |
Uppercase Letter
| Value | Count | Frequency (%) |
| H | 1272 | |
| G | 1107 | |
| Y | 970 | |
| B | 719 | |
| A | 560 | |
| C | 557 | |
| F | 455 | 7.9% |
| E | 94 | 1.6% |
| D | 33 | 0.6% |
Other Punctuation
| Value | Count | Frequency (%) |
| , | 2983 |
Space Separator
| Value | Count | Frequency (%) |
| 2983 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Common | 17500 | |
| Latin | 5767 | 24.8% |
Most frequent character per script
Common
| Value | Count | Frequency (%) |
| 0 | 4285 | |
| , | 2983 | |
| 2983 | ||
| 1 | 2461 | |
| 2 | 1375 | 7.9% |
| 6 | 1284 | 7.3% |
| 4 | 813 | 4.6% |
| 5 | 374 | 2.1% |
| 3 | 359 | 2.1% |
| 9 | 205 | 1.2% |
| Other values (2) | 378 | 2.2% |
Latin
| Value | Count | Frequency (%) |
| H | 1272 | |
| G | 1107 | |
| Y | 970 | |
| B | 719 | |
| A | 560 | |
| C | 557 | |
| F | 455 | 7.9% |
| E | 94 | 1.6% |
| D | 33 | 0.6% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 23267 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 0 | 4285 | |
| , | 2983 | |
| 2983 | ||
| 1 | 2461 | |
| 2 | 1375 | 5.9% |
| 6 | 1284 | 5.5% |
| H | 1272 | 5.5% |
| G | 1107 | 4.8% |
| Y | 970 | 4.2% |
| 4 | 813 | 3.5% |
| Other values (11) | 3734 |
US Class - Original
Categorical
HIGH CARDINALITY  UNIFORM 
| Distinct | 2698 |
|---|---|
| Distinct (%) | 96.9% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 242.0 KiB |
| 370329 | 7 |
|---|---|
| 382128 | 7 |
| 370328 | 5 |
| 370392 | 3 |
| 377064 | 377068 | 377079 | 3 |
| Other values (2693) |
Length
| Max length | 573 |
|---|---|
| Median length | 265 |
| Mean length | 31.976652 |
| Min length | 6 |
Characters and Unicode
| Total characters | 89023 |
|---|---|
| Distinct characters | 32 |
| Distinct categories | 4 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 2636 ? |
|---|---|
| Unique (%) | 94.7% |
Sample
| 1st row | 134105 |
|---|---|
| 2nd row | 416145 | 0745741 | 310081 |
| 3rd row | 424046 | 424489 | 424490 | 424493 | 424499 | 514951 |
| 4th row | 435325 | 435375 |
| 5th row | 380044 | 713189 |
Common Values
| Value | Count | Frequency (%) |
| 370329 | 7 | 0.3% |
| 382128 | 7 | 0.3% |
| 370328 | 5 | 0.2% |
| 370392 | 3 | 0.1% |
| 377064 | 377068 | 377079 | 3 | 0.1% |
| 345173 | 3 | 0.1% |
| 290044 | 290055 | 3 | 0.1% |
| 382103 | 3 | 0.1% |
| 310071 | 3 | 0.1% |
| 525477 | 3 | 0.1% |
| Other values (2688) | 2744 |
Length
| Value | Count | Frequency (%) |
| 7647 | ||
| 370329 | 36 | 0.2% |
| 370328 | 31 | 0.2% |
| 370338 | 23 | 0.1% |
| 709224 | 20 | 0.1% |
| 370252 | 20 | 0.1% |
| 709203 | 19 | 0.1% |
| 370331 | 16 | 0.1% |
| 370401 | 15 | 0.1% |
| 345173 | 15 | 0.1% |
| Other values (7434) | 10236 |
Most occurring characters
| Value | Count | Frequency (%) |
| 15294 | ||
| 0 | 9720 | |
| 2 | 8996 | |
| 1 | 8208 | |
| 3 | 7822 | |
| | | 7647 | |
| 4 | 7182 | |
| 5 | 6773 | |
| 7 | 5594 | 6.3% |
| 6 | 4510 | 5.1% |
| Other values (22) | 7277 |
Most occurring categories
| Value | Count | Frequency (%) |
| Decimal Number | 65778 | |
| Space Separator | 15294 | 17.2% |
| Math Symbol | 7647 | 8.6% |
| Uppercase Letter | 304 | 0.3% |
Most frequent character per category
Uppercase Letter
| Value | Count | Frequency (%) |
| E | 129 | |
| R | 64 | |
| A | 23 | 7.6% |
| B | 14 | 4.6% |
| D | 12 | 3.9% |
| G | 11 | 3.6% |
| I | 9 | 3.0% |
| C | 9 | 3.0% |
| S | 6 | 2.0% |
| P | 5 | 1.6% |
| Other values (10) | 22 | 7.2% |
Decimal Number
| Value | Count | Frequency (%) |
| 0 | 9720 | |
| 2 | 8996 | |
| 1 | 8208 | |
| 3 | 7822 | |
| 4 | 7182 | |
| 5 | 6773 | |
| 7 | 5594 | |
| 6 | 4510 | |
| 8 | 3705 | 5.6% |
| 9 | 3268 | 5.0% |
Space Separator
| Value | Count | Frequency (%) |
| 15294 |
Math Symbol
| Value | Count | Frequency (%) |
| | | 7647 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Common | 88719 | |
| Latin | 304 | 0.3% |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| E | 129 | |
| R | 64 | |
| A | 23 | 7.6% |
| B | 14 | 4.6% |
| D | 12 | 3.9% |
| G | 11 | 3.6% |
| I | 9 | 3.0% |
| C | 9 | 3.0% |
| S | 6 | 2.0% |
| P | 5 | 1.6% |
| Other values (10) | 22 | 7.2% |
Common
| Value | Count | Frequency (%) |
| 15294 | ||
| 0 | 9720 | |
| 2 | 8996 | |
| 1 | 8208 | |
| 3 | 7822 | |
| | | 7647 | |
| 4 | 7182 | |
| 5 | 6773 | |
| 7 | 5594 | 6.3% |
| 6 | 4510 | 5.1% |
| Other values (2) | 6973 |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 89023 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 15294 | ||
| 0 | 9720 | |
| 2 | 8996 | |
| 1 | 8208 | |
| 3 | 7822 | |
| | | 7647 | |
| 4 | 7182 | |
| 5 | 6773 | |
| 7 | 5594 | 6.3% |
| 6 | 4510 | 5.1% |
| Other values (22) | 7277 |
Cited Refs - Patent
Categorical
HIGH CARDINALITY  UNIFORM 
| Distinct | 2778 |
|---|---|
| Distinct (%) | 100.0% |
| Missing | 6 |
| Missing (%) | 0.2% |
| Memory size | 1.7 MiB |
| CN2544162Y | US7516565B1 | CN2741495Y | US5609047A | US6295691B1 | US20050274403A1 | CN101022898A | JP2001327449A | WO2008012661A2 | WO2001021054A1 | WO2006014311A1 | CN2639658Y | CN2644027Y | EP1223844A1 | JP9154569A | KR2007119256A | CN2577987Y | DE202004014412U1 | US20060000049A1 | CN2389017Y | CN1500565A | JP2003526489A | US7237409B2 | EP719516A2 | JP58156587U | KR2007016449A | US7475448B2 | US20050125934A1 | CN1439836A | DE2004014412U1 | US3000036A | US20030145880A1 | US20050161538A1 | US20110073135A1 | CN2568904Y | CN2689033Y | 1 |
|---|---|
| US6498348B2 | US7078713B2 | US20100327181A1 | US20100116983A1 | US7635850B2 | 1 |
| US20100207953A1 | KR2010094222A | JP2010002668A | JP2010066384A | 1 |
| US6407854B1 | JP8204267A | JP2003051632A | JP2005192256A | US5986799A | US6476961B1 | US20060215716A1 | US6661570B2 | US6166850A | US5633750A | US6342959B1 | US7038769B2 | JP11026848A | US5267071A | US8339698B2 | JP2000151515A | US5701195A | US20100157415A1 | US8094369B2 | US6396625B1 | JP8032162A | US20120050845A1 | US5680246A | US6433925B1 | US5572356A | US6356386B1 | US5268786A | 1 |
| US20090084426A1 | US20100154864A1 | US6750391B2 | US20110048507A1 | US20080283118A1 | US20090165838A1 | WO2010144637A1 | US20050217716A1 | US20060118163A1 | WO2007136318A1 | US20090078299A1 | 1 |
| Other values (2773) |
Length
| Max length | 31743 |
|---|---|
| Median length | 1495 |
| Mean length | 595.32217 |
| Min length | 10 |
Characters and Unicode
| Total characters | 1653805 |
|---|---|
| Distinct characters | 36 |
| Distinct categories | 4 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 2778 ? |
|---|---|
| Unique (%) | 100.0% |
Sample
| 1st row | CN2544162Y | US7516565B1 | CN2741495Y | US5609047A | US6295691B1 | US20050274403A1 | CN101022898A | JP2001327449A | WO2008012661A2 | WO2001021054A1 | WO2006014311A1 | CN2639658Y | CN2644027Y | EP1223844A1 | JP9154569A | KR2007119256A | CN2577987Y | DE202004014412U1 | US20060000049A1 | CN2389017Y | CN1500565A | JP2003526489A | US7237409B2 | EP719516A2 | JP58156587U | KR2007016449A | US7475448B2 | US20050125934A1 | CN1439836A | DE2004014412U1 | US3000036A | US20030145880A1 | US20050161538A1 | US20110073135A1 | CN2568904Y | CN2689033Y |
|---|---|
| 2nd row | US4326158A | US5310137A | US5757662A | US6907800B1 | US7958801B2 | US4953098A | US5676025A | US7350749B2 | US4728837A | US2664763A | US4901573A | US5586505A | US6568291B1 | US7047109B2 | US20090180882A1 | US7492074B1 | US4218187A | US5497861A | US7942633B2 | US20050079056A1 | US3219120A | US5553514A | US6236934B1 | US4951514A | US5831354A | US6210099B1 | US7267029B2 | US7722322B2 | US20010035068A1 | US20090116963A1 | JP61164109A | US20060083617A1 | US3538469A | US5372478A |
| 3rd row | US6521260B1 | US7744855B2 | WO1995000127A1 | ZA199400155A | EP239798A1 | WO1995011666A1 | GB1242211A | US7718163B2 | US20030185764A1 | US2533065A | US5478578A | WO1994013271A1 | WO1987005213A1 | EP20072979A1 | EP124493A2 | US6153224A | GB2269992A | WO1991014422A1 | GB905723A | GB1310527A | GB786499A | US6884794B2 | US5376386A | WO1994004133A1 | GB1230087A | GB2240337A | GB95219374X | WO1993011746A1 | WO1991011173A1 | EP2213279A2 | US7223748B2 | US7541022B2 | US5642728A | WO1995000128A1 | WO1996023485A1 | SE9203743A | GB1242212A | US3957965A | GB1381872A | EP187433A1 | GB1132583A | EP1283160A1 | US7011818B2 | US5506203A | US20030133880A1 | US5972388A | ZA199400155B | WO1992008447A1 | EP606486A1 | EP100751197A1 | US20030175214A1 | GB95219374A | ZA94155B | SE92037431B |
| 4th row | WO1997021802A1 | US7781213B2 | US7473556B2 | US7247480B2 | US20020131962A1 | US8232100B2 |
| 5th row | US4972475A | US4203166A | US5148485A | US6105012A | EP32107B1 | JP63070634A | JP7175411A | JP8195735A | JP2006340407A | WO1986007221A1 | US5278905A | US4956863A | US5060266A | US7860248B2 | CH648167A5 | DE19705350C2 | JP1279650A | JP7193566A | JP10301492A | US4850017A | US5425103A | JP3080646A | JP4117826A | JP7162692A | JP8335040A | JP2013017225A | WO1997012461A1 | JP8046948A | US5253294A | US5912973A | US7298842B2 | DE19524021C2 | EP93525B1 | EP756276A1 | JP8503569A | JP8204702A | JP8234658A | JP8331076A | JP2010246158A | JP2012070430A | US4531021A | US4791669A | US5870477A | US8170206B2 | JP4117411A | JP4189045A | JP5075598A | JP7107082A | JP2007043738A | JP2007306581A | JP2014078589A | US4689606A | US5029207A | US5838797A | US6539094B1 | US6973189B1 | EP12974B1 | JP4211543A | JP5336136A | JP8279281A | US6868404B1 | US6256391B1 | US8594325B2 | US4887296A | US5341425A | US7242769B2 | EP94423B1 | EP765061A2 | FR2732531A1 | JP59006948A | WO1996033564A1 | AU712649B2 | US4823388A | AU7126491B | DE3432651B3 | EP720326A2 | JP62503066A | JP5175411A | JP8008913A | WO1997047111A1 |
Common Values
| Value | Count | Frequency (%) |
| CN2544162Y | US7516565B1 | CN2741495Y | US5609047A | US6295691B1 | US20050274403A1 | CN101022898A | JP2001327449A | WO2008012661A2 | WO2001021054A1 | WO2006014311A1 | CN2639658Y | CN2644027Y | EP1223844A1 | JP9154569A | KR2007119256A | CN2577987Y | DE202004014412U1 | US20060000049A1 | CN2389017Y | CN1500565A | JP2003526489A | US7237409B2 | EP719516A2 | JP58156587U | KR2007016449A | US7475448B2 | US20050125934A1 | CN1439836A | DE2004014412U1 | US3000036A | US20030145880A1 | US20050161538A1 | US20110073135A1 | CN2568904Y | CN2689033Y | 1 | < 0.1% |
| US6498348B2 | US7078713B2 | US20100327181A1 | US20100116983A1 | US7635850B2 | 1 | < 0.1% |
| US20100207953A1 | KR2010094222A | JP2010002668A | JP2010066384A | 1 | < 0.1% |
| US6407854B1 | JP8204267A | JP2003051632A | JP2005192256A | US5986799A | US6476961B1 | US20060215716A1 | US6661570B2 | US6166850A | US5633750A | US6342959B1 | US7038769B2 | JP11026848A | US5267071A | US8339698B2 | JP2000151515A | US5701195A | US20100157415A1 | US8094369B2 | US6396625B1 | JP8032162A | US20120050845A1 | US5680246A | US6433925B1 | US5572356A | US6356386B1 | US5268786A | 1 | < 0.1% |
| US20090084426A1 | US20100154864A1 | US6750391B2 | US20110048507A1 | US20080283118A1 | US20090165838A1 | WO2010144637A1 | US20050217716A1 | US20060118163A1 | WO2007136318A1 | US20090078299A1 | 1 | < 0.1% |
| US7722829B2 | US20070104623A1 | US7062904B1 | US8093173B2 | US8512657B2 | US20080045405A1 | US20080148700A1 | EP1657410A2 | WO2009079590A1 | US20050207946A1 | US5198007A | US7179430B1 | WO2008132452A2 | US20100092358A1 | US8318286B2 | US20030101718A1 | DE102005005663A1 | EP2105200A1 | WO2008022967A1 | US7972400B2 | US8012439B2 | US20060193757A1 | US4689150A | US6264045B1 | US20050074374A1 | 1 | < 0.1% |
| US6311349B1 | JP2010188171A | US20030130696A1 | US7060085B2 | US5626616A | US2818854A | US6125851A | JP8126718A | 1 | < 0.1% |
| US7243625B2 | US8607954B2 | US20110297504A1 | JP2005265768A | US20080103663A1 | 1 | < 0.1% |
| US7551556B2 | US8363550B1 | US20030198183A1 | US7158479B1 | US5448561A | US7072973B1 | US8274996B1 | US8320252B2 | 1 | < 0.1% |
| US20110052977A1 | JP2009087693A | JP2009087727A | US20090087737A1 | JP2004111300A | JP2008066254A | JP2003173767A | US20090136841A1 | US6579640B1 | US20030104276A1 | JP2009087728A | US20120148908A1 | US20050095502A1 | US20100143786A1 | US20100216008A1 | US20030143460A1 | US20080038627A1 | JP2001093486A | 1 | < 0.1% |
| Other values (2768) | 2768 | |
| (Missing) | 6 | 0.2% |
Length
| Value | Count | Frequency (%) |
| 106451 | ||
| us6323846b1 | 8 | < 0.1% |
| us20060026521a1 | 7 | < 0.1% |
| us4683202a | 7 | < 0.1% |
| us5488204a | 5 | < 0.1% |
| us20080174570a1 | 5 | < 0.1% |
| us20090085878a1 | 5 | < 0.1% |
| us20060165060a1 | 5 | < 0.1% |
| us6188391b1 | 5 | < 0.1% |
| us4733665a | 5 | < 0.1% |
| Other values (101848) | 109176 |
Most occurring characters
| Value | Count | Frequency (%) |
| 212901 | ||
| 0 | 198563 | |
| 1 | 146875 | 8.9% |
| 2 | 143983 | 8.7% |
| | | 106451 | 6.4% |
| S | 90788 | 5.5% |
| U | 90405 | 5.5% |
| 6 | 82081 | 5.0% |
| 5 | 80494 | 4.9% |
| A | 78308 | 4.7% |
| Other values (26) | 422956 |
Most occurring categories
| Value | Count | Frequency (%) |
| Decimal Number | 1005711 | |
| Uppercase Letter | 328742 | 19.9% |
| Space Separator | 212901 | 12.9% |
| Math Symbol | 106451 | 6.4% |
Most frequent character per category
Uppercase Letter
| Value | Count | Frequency (%) |
| S | 90788 | |
| U | 90405 | |
| A | 78308 | |
| B | 30429 | 9.3% |
| P | 9006 | 2.7% |
| W | 6587 | 2.0% |
| O | 6396 | 1.9% |
| J | 6272 | 1.9% |
| E | 4004 | 1.2% |
| D | 1770 | 0.5% |
| Other values (14) | 4777 | 1.5% |
Decimal Number
| Value | Count | Frequency (%) |
| 0 | 198563 | |
| 1 | 146875 | |
| 2 | 143983 | |
| 6 | 82081 | |
| 5 | 80494 | |
| 7 | 76128 | 7.6% |
| 4 | 71898 | 7.1% |
| 3 | 70568 | 7.0% |
| 8 | 67843 | 6.7% |
| 9 | 67278 | 6.7% |
Space Separator
| Value | Count | Frequency (%) |
| 212901 |
Math Symbol
| Value | Count | Frequency (%) |
| | | 106451 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Common | 1325063 | |
| Latin | 328742 | 19.9% |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| S | 90788 | |
| U | 90405 | |
| A | 78308 | |
| B | 30429 | 9.3% |
| P | 9006 | 2.7% |
| W | 6587 | 2.0% |
| O | 6396 | 1.9% |
| J | 6272 | 1.9% |
| E | 4004 | 1.2% |
| D | 1770 | 0.5% |
| Other values (14) | 4777 | 1.5% |
Common
| Value | Count | Frequency (%) |
| 212901 | ||
| 0 | 198563 | |
| 1 | 146875 | |
| 2 | 143983 | |
| | | 106451 | |
| 6 | 82081 | 6.2% |
| 5 | 80494 | 6.1% |
| 7 | 76128 | 5.7% |
| 4 | 71898 | 5.4% |
| 3 | 70568 | 5.3% |
| Other values (2) | 135121 |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 1653805 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 212901 | ||
| 0 | 198563 | |
| 1 | 146875 | 8.9% |
| 2 | 143983 | 8.7% |
| | | 106451 | 6.4% |
| S | 90788 | 5.5% |
| U | 90405 | 5.5% |
| 6 | 82081 | 5.0% |
| 5 | 80494 | 4.9% |
| A | 78308 | 4.7% |
| Other values (26) | 422956 |
Count of Cited Refs - Patent
Real number (ℝ)
| Distinct | 242 |
|---|---|
| Distinct (%) | 8.7% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Infinite | 0 |
| Infinite (%) | 0.0% |
| Mean | 39.255388 |
| Minimum | 0 |
|---|---|
| Maximum | 2197 |
| Zeros | 6 |
| Zeros (%) | 0.2% |
| Negative | 0 |
| Negative (%) | 0.0% |
| Memory size | 21.9 KiB |
Quantile statistics
| Minimum | 0 |
|---|---|
| 5-th percentile | 3 |
| Q1 | 9 |
| median | 16 |
| Q3 | 30 |
| 95-th percentile | 133 |
| Maximum | 2197 |
| Range | 2197 |
| Interquartile range (IQR) | 21 |
Descriptive statistics
| Standard deviation | 100.86609 |
|---|---|
| Coefficient of variation (CV) | 2.569484 |
| Kurtosis | 126.67664 |
| Mean | 39.255388 |
| Median Absolute Deviation (MAD) | 8 |
| Skewness | 9.1522161 |
| Sum | 109287 |
| Variance | 10173.968 |
| Monotonicity | Not monotonic |
| Value | Count | Frequency (%) |
| 11 | 128 | 4.6% |
| 9 | 115 | 4.1% |
| 8 | 114 | 4.1% |
| 10 | 109 | 3.9% |
| 15 | 107 | 3.8% |
| 14 | 106 | 3.8% |
| 12 | 101 | 3.6% |
| 13 | 95 | 3.4% |
| 6 | 94 | 3.4% |
| 5 | 93 | 3.3% |
| Other values (232) | 1722 |
| Value | Count | Frequency (%) |
| 0 | 6 | 0.2% |
| 1 | 24 | 0.9% |
| 2 | 55 | |
| 3 | 61 | |
| 4 | 67 | |
| 5 | 93 | |
| 6 | 94 | |
| 7 | 89 | |
| 8 | 114 | |
| 9 | 115 |
| Value | Count | Frequency (%) |
| 2197 | 1 | |
| 1589 | 1 | |
| 1346 | 1 | |
| 1058 | 1 | |
| 902 | 1 | |
| 891 | 1 | |
| 887 | 1 | |
| 878 | 1 | |
| 844 | 1 | |
| 828 | 1 |
Cited Refs - Non-patent
Categorical
HIGH CARDINALITY  MISSING  UNIFORM 
| Distinct | 1869 |
|---|---|
| Distinct (%) | 99.8% |
| Missing | 911 |
| Missing (%) | 32.7% |
| Memory size | 3.5 MiB |
| Etienne et al., 2006, Polyelectrolyte Multilayer Film Coating and Stability at the Surfaces of Oral Prosthesis Base Polymers: An in vitro and in vivo Study, J. Dental Research 85(1):44-48. 3 | Green et al., 1999, Protective Groups in Organic Synthesis, New York, NY pp. 67-74 and 708-711. | International Search Report and Written Opinion in International Application No. PCT/US10/061704, mailed Apr. 19, 2011. | International Search Report and Written Opinion in International Application No. PCT/US10/061708, mailed Jul. 5, 2011. | International Search Report in International Application No. PCT/US09/054582, mailed Aug. 21, 2009. | Tangerman, 2002, Halitosis in Medicine: A Review, International Dental J. 52(Supp. 3):201-206. | Written Opinion in International Application No. PCT/US10/061704, mailed Jan. 27, 2012. | 2 |
|---|---|
| Simoudis, E. (2000). If it's not one channel, then it's another. Bank Marketing, 32(1), 48-50+. | 2 |
| Patent Cooperation Treaty, International Search Report & Written Opinion of the International Search Authority, PCT/US2009/055758, Oct. 29, 2010, 16 pages. | 2 |
| Optical Society of America, Optics Express; vol. 12, No. 11. May 31, 2004, 7 Pages, Jeong, Ki-Hun , et al. Tunable Microdoublet Lens Array. DOI:10.1364/OPEX.12.002494 52 | http://sharp-world.com/corporate/news/070831.html, Sharp Press Release, Aug. 31, 2007, 3 pages Sharp Develops and Will Mass Produce New System LCD with Embedded Optical Sensors to Provide Input Capabilities Including Touch Screen and Scanner Functions. | Preumont, A. Vibration Control of Active Structures: An Introduction, Jul. 2011. | 2 |
| Zou, et al., AI Planning and Combinatorial Optimization for Web Service Composition in Cloud Computing, May 17, 2010, Proceedings from Cloud Computing & Virtualization Conference, Singapore, 8 pp. | Morgan, Systems and Methods for Detecting Resource Consumption Events Over Sliding Intervals in Cloud-Based Network, U.S. Appl. No. 13/149, 235, filed May 31, 2011. | Morgan, Systems and Methods for Triggering Workload Movement Based on Policy Stack Having Multipie Selectable Inputs, U.S. Appl. No. 13/149, 418, filed May 31, 2011. | Morgan, Systems and Methods for Cloud Deployment Engine for Selective Workload Migration or Federation Based on Workload Conditions, U.S. Appl. No. 13/117, 937, filed May 27, 2011. | Morgan, Systems and Methods for Tracking Cloud Installation Information Using Cloud-Aware Kernel of Operating System, U.S. Appl. No. 13/149, 750, filed May 31, 2011. | Morgan, Systems and Methods for Introspective Application Reporting to Facilitate Virtual Machine Movement Between Cloud Hosts, U.S. Appl. No. 13/118, 009, filed May 27, 2011. | Morgan, Systems and Methods for Self-Moving Operating System Installation in Cloud-Based Network, U.S. Appl. No. 13/149, 877, filed May 31, 2011. | rBuilder and the rPath Appliance Platform, 2007 rPath, Inc., www.rpath.com, 3 pgs. | White PaperrPath Versus Other Software Appliance Approaches, Mar. 2008, rPath, Inc., www.rpath.com, 9 pgs. | White PaperBest Practices for Building Virtual Appliances, 2008 rPath, Inc., www.rpath.com, 6 pgs. | DeHaan et al., Systems and Methods for Secure Distributed Storage, U.S. Appl. No. 12/610, 081, filed Oct. 30, 2009. | Ferris et al., Methods and Systems for Monitoring Cloud Computing Environments U.S. Appl. No. 12/627, 764, filed Nov. 30, 2009. | Ferris et al., Methods and Systems for Detecting Events in Cloud Computing Environments and Performing Actions Upon Occurrence of the Events, U.S. Appl. No. 12/627, 646, filed Nov. 30, 2009. | Ferris et al, Methods and Systems for Verifying Software License Compliance in Cloud Computing Environments, U.S. Appl. No. 12/627, 643, filed Nov. 30, 2009. | Ferris et al, Systems and Methods for Service Aggregation Using Graduated Service Levels in a Cloud Network, U.S. Appl. No. 12/628, 112, filed Nov. 30, 2009. | Ferris et al, Methods and Systems for Generating a Software License Knowledge Base for Verifying Software License Compliance in Cloud Computing Environments, U.S. Appl. No. 12/628, 156, filed Nov. 30, 2009. | Ferris et al, Methods and Systems for Converting Standard Software Licenses for Use in Cloud Computing Environments, U.S. Appl. No. 12/714, 099, filed Feb. 26, 2010. | Ferris et al, Systems and Methods for Managing a Software Subscription in a Cloud Network, U.S. Appl. No. 12/714, 096, filed Feb. 26, 2010. | Ferris et al., Methods and Systems for Providing Deployment Architectures in Cloud Computing Environments, U.S. Appl. No. 12/714, 427, filed Feb. 26, 2010. | Ferris et al., Methods and Systems for Matching Resource Requests with Cloud Computing Environments, U.S. Appl. No. 12/714, 113, filed Feb. 26, 2010. | Ferris et al., Systems and Methods for Generating Cross-Cloud Computing Appliances, U.S. Appl. No. 12/714, 315, filed Feb. 26, 2010. | Ferris et al., Systems and Methods for Cloud-Based Brokerage Exchange of Software Entitlements, U.S. Appl. No. 12/714, 302, filed Feb. 26, 2010. | Ferris et al., Methods and Systems for Offering Additional License Terms During Conversion of Standard Software Licenses for Use in Cloud Computing Environments, U.S. Appl. No. 12/714, 065, filed Feb. 26, 2010. | Ferris et al., Systems and Methods for or a Usage Manager for Cross-Cloud Appliances, U.S. Appl. No. 12/714, 334, filed Feb. 26, 2010. | Ferris et al., Systems and Methods for Delivery of User-Controlled Resources in Cloud Environments Via a Resource Specification Language Wrapper, U.S. Appl. No. 12/790, 294, filed May 28, 2010. | Ferris et al., Systems and Methods for Managing Multi-Level Service Level Agreements in Cloud-Based Networks, U.S. Appl. No. 12/789, 660, filed May 28, 2010. | Ferris et al., Methods and Systems for Generating Cross-Mapping of Vendor Software in a Cloud Computing Environment, U.S. Appl. No. 12/790, 527, filed May 28, 2010. | Ferris et al., Methods and Systems for Cloud Deployment Analysis Featuring Relative Cloud Resource Importance, U.S. Appl. No. 12/790, 366, filed May 28, 2010. | Ferris et al., Systems and Methods for Generating Customized Build Options for Cloud Deployment Matching Usage Profile Against Cloud Infrastructure Options, U.S. Appl. No. 12/789, 701, filed May 28, 2010. | Ferris et al., Systems and Methods for Exporting Usage History Data as Input to a Managment Platform of a Target Cloud-Based Network, U.S. Appl. No. 12/790, 415, filed May 28, 2010. | Ferris et al., Systems and Methods for Cross-Vendor Mapping Service in Cloud Networks, U.S. Appl. No. 12/790, 162, filed May 28, 2010. | Ferris et al., Systems and Methods for Cross-Cloud Vendor Mapping Service in a Dynamic Cloud Marketplace, U.S. Appl. No. 12/790, 229, filed May 28, 2010. | Ferris et al., Systems and Methods for Aggregate Monitoring of Utilization Data for Vendor Products in Cloud Networks, U.S. Appl. No. 12/790, 039, filed May 28, 2010. | Ferris et al., Systems and Methods for Matching a Usage History to a New Cloud, U.S. Appl. No. 12/953, 757, filed Nov. 24, 2010. | Ferris et al., Systems and Methods for Identifying Usage Histories for Producing Optimized Cloud Utilization, U.S. Appl. No. 12/952, 930, filed Nov. 23, 2010. | Ferris et al., Systems and Methods for Identifying Service Dependencies in a Cloud Deployment, U.S. Appl. No. 12/952, 857, filed Nov. 23, 2010. | Ferris et al., Systems and Methods for Migrating Subscribed Services in a Cloud Deployment, U.S. Appl. No. 12/955, 277, filed Nov. 29, 2010. | Ferris et al., System and Methods for Migrating Subscribed Services from a Set of Clouds to a Second Set of Clouds, U.S. Appl. No. 12/957, 281, filed Nov. 30, 2001. | Morgan, Systems and Methods for Generating Multi-Cloud Incremental Billing Capture and Administration, U.S. Appl. No. 12/954, 323, filed Nov. 24, 2010. | Morgan, Systems and Methods for Aggregating Marginal Subscription Offsets in Set of Multiple Host Clouds, U.S. Appl. No. 12/954, 400, filed Nov. 24, 2010. | Morgan, Systems and Methods for Generating Dynamically Configurable Subscription Parameters for Temporary Migration of Predictive User Workloads in Cloud Network, U.S. Appl. No. 12/954, 378, filed Nov. 24, 2010. | Morgan, Systems and Methods for Managing Subscribed Resource Limits in Cloud Network Using Variable or Instantaneous Consumption Tracking Periods, U.S. Appl. No. 12/954, 352, filed Nov. 24, 2010. | Ferris et al., Systems and Methods for Migrating Software Modules into One or More Clouds, U.S. Appl. No. 12/952, 701, filed Nov. 23, 2010. | Ferris et al. Systems and Methods for Brokering Optimized Resource Supply Costs in Host Cloud-Based Network Using Predictive Workloads, U.S. Appl. No. 12/957, 274, filed Nov. 30, 2010. | Ferris et al., Systems and Methods for Reclassifying Virtual Machines to Target Virtual Machines or Appliances Based on Code Analysis in a Cloud Environment, U.S. Appl. No. 12/957, 267, filed Nov. 30, 2010. | Morgan, Systems and Methods for Generating Optimized Resource Consumption Periods for Multiple Users on Combined Basis, U.S. Appl. No. 13/037, 359, filed Mar. 1, 2011. | Morgan, Systems and Methods for Metering Cloud Resource Consumption Using Multiple Hierarchical Subscription Periods, U.S. Appl. No. 13/037, 360, filed Mar. 1, 2011. | Morgan, Systems and Methods for Generating Marketplace Brokerage Exchange of Excess Subscribed Resources Using Dynamic Subscription Periods, U.S. Appl. No. 13/037, 351, filed Feb. 28, 2011. | 1 |
| Other values (1864) |
Length
| Max length | 31746 |
|---|---|
| Median length | 2261 |
| Mean length | 1846.0662 |
| Min length | 17 |
Characters and Unicode
| Total characters | 3457682 |
|---|---|
| Distinct characters | 126 |
| Distinct categories | 14 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 2 ? |
Unique
| Unique | 1865 ? |
|---|---|
| Unique (%) | 99.6% |
Sample
| 1st row | Evaluation Report for Chinese Application No. 201020138464.6. | Novelty Evaluation Report for Chinese Application No. 201020138464.6. | Chinese Office Action for CN 201010127191.0 mailed Aug. 2, 2012. | Report of Utility Model Technical Opinion for JP 2010-001169 mailed Jun. 15, 2011. | International Search Report and Written Opinion for PCT/US2010/048043 mailed May 26, 2011. | International Preliminary Report on Patentability for PCT/US2010/048043 mailed Apr. 5, 2012. |
|---|---|
| 2nd row | Kayler, Kimberly. LORD Corporation's Technology to be Presented at American Helicopter Society's Annual Forum 67. Apr. 28, 2011. Retrieved from <http://www.lord.com/News-Center/News-Stories/LORD-Technology-Presented-at-American-Helicopter-Societys-Annual-Forum-67.xml>. | Anonymous. Carolina Transparency: Dual Frequency Hub-Mounted Vibration Suppressor. Date unknown. Retrieved from <http://www.carolinatransparency.com/earmarks/popup.php?id=62098>. Retrieved Sep. 21, 2011. | Kayler, Kimberly. LORD Selected to Team with Sikorsky for Hub-Mounted Vibration. Jan. 29, 2009. Retrieved from <http://www.lord.com/News-Center/Press-Releases/LORD-Selected-to-Team-with-Sikorsky-for-Hub-Mounted-Vibration-Suppression-(HMVS).xml>. |
| 3rd row | Ahmed Particle Interactions in Multicomponent Systems. (Ph.D. Thesis, University of bath, 1989), pp. 1-376. | Ganderton. The Generation of Respirable clouds form coarse powder aggregates. Journal of Biopharmaceutical Sciences. vol. 3 (1/2), 1992, pp. 101-105. | Kassem. Generation of Deeply Inspirable clouds from dry powder mixtures. Ph. D. Thesis. Department of Pharmacy. Kings College, University of London, 1990. pp. 1-275. | Glaxo Opposition Against European Patent 1232745 in the Name of Vectura Limited, Aug. 24, 2009. | Norton Opposition Against European Patent No. 1 232 745, Norton Healthcare Ltd. Aug. 2009. | European Search ReportCorresponding application No. EP 06 08 4066. Mailed Mar. 26, 2009. | AstraZeneca AB Notice of Opposition against European Patent No. 1 666 023 in the name of Vectura Limited, filed Jul. 4, 2012. | Staniforth, J. et al. Interparticle forces in binary and ternary ordered powder mixes, J. Pharm. Pharmacol., vol. 34, 1982, pp. 141-145. 15 | Brindley et al., Design, Manufacture and Dose Consistenty of the Serevent Diskus Inhaler, Pharmaceutical Technology Europe, Jan. 1995, seven pages. | Rowe et al., Handbook of Pharmaceutical Excipients, Royal Pharmaceutical Society of Great Britain, Fifth Edition, Pharmaceutical Press, 2007 pp. 389-395. | Extended European Search Report for corresponding European Patent Application No. 10075119.7 mailed Aug. 25, 2010. | Reply to Grounds of Appeal for corresponding European Patent No. 1232745, Oct. 8, 2010. | Zeng, X. et al. Particulate Interactions in Dry Powder Formulations for Inhalation, Taylor & Francis, London & New York, 2001, pp. 220-224. |
| 4th row | Brossart et al. Virus-mediated delivery of antigenic epitopes into dendritic cells as a means to induce CTL. The Journal of Immunology 158: 3270-3276. | Abbas & Lichtman. Cellular and Molecular Immunology, Philadelphia, P.A., Elsevier Saunders, 1991, p. 249. | Brocker, et al., Targeted Expression of Major Histocompatibility Complex (MHC) Class II Molecules Demonstrates that Dendritic CellsCan Induce Negative but Not Positive Selection of Thymocytes In Vivo, J. of Exp. Med. 185 (33): 541-550, Feb. 3, 1997. DOI:10.1084/jem.185.3.541 7 | Clontech Catalog information for vector pEGFP-N1, Protocol # PT3027-5, Version # PR29972, pp. 1-3, 2002. | Ellis et al. (1991) Antigen presentation by dendritic cells provides optimal stimulation for the production of interleukin (IL) 2, IL 4 and interferon-gamma by allogeneic T cells. European Journal of Immunology 21(11): 2803-2809. DOI:10.1002/eji.1830211123 3 | Genbank Accession No. U55762, submitted Apr. 17, 1996, accessed online, Feb. 15, 2008. | Keller et al., Hematopoietic commitment during embryonic stem cell differentiation in cultureMol. Cell Bio., 13(10): 473-486 (Jan. 1993). 38 | Klug et al., Genetically Selected Cardiomyocytes from Differentiating Embryonic Stem Cells Form Stable Intracardiac Grafts, J. Clin. Invest., 98:216-224 (1996). DOI:10.1172/JCI118769 80 | Reeves, M. E., et al. Retroviral transduction of human dendritic cells with a tumor-associated antigen gene. Cancer Research. 1996, vol. 56, pp. 5672-5677. 29 | Senju et al. Generation and genetic modification of dendritic cells derived from mouse embryonic stem cells. Immunogiology, Blood, 2003, vol. 101, No. 9, pp. 3501-3508. DOI:10.1182/blood-2002-07-2254 17 | Slukvin, et al. Directed differentiation of human embryonic stem cells into functional dendritic cells through the myeloid pathway. The Journal of Immunology, 2006, 176: 2924-2932. 15 | Steinman, R. M., et al. Identification of a novel cell type in peripheral lymphoid organs of mice. I. Morphology quantitation, tissue distribution. Journal of Experimental Medicine. 1973, vol. 137, pp. 1142-1162. DOI:10.1084/jem.137.5.1142 21 | Brook & Gardner, The origin and efficient derivation of embryonic stem cells in the mouse, Proc. Natl. Acad. Sci. USA, 97: 5709-5712 (1997). DOI:10.1073/pnas.94.11.5709 24 | Brustle et al., In vitro-generated neural precursors participate in mammalian brain development, Proc. Natl. Acad. Sci. USA, 94:14809-14814 (1997). DOI:10.1073/pnas.94.26.14809 | Inaba et al. (1993) Granulocytes, macrophages, and dendritic cells arise from a common major histocompatibility complex class II-negative progenitor in mouse bone marrow Proc Natl Acad Soc. USA 90:3038-3042. DOI:10.1073/pnas.90.7.3038 16 | Melcher et al. (1999) Adoptive transfer of immature dendritic cells with autologous or allogeneic tumor cells generates systemic antitumor immunity Cancer Res 59:2802-2805. 4 | Ridgway (2003) The first 1000 dendritic cell vaccinees Cancer Invest 21(6):873-886. DOI:10.1081/CNV-120025091 27 | Sallusto & Lanzavecchia Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha (1994) J Exp Med 179:1109-1118. DOI:10.1084/jem.179.4.1109 177 | Saudrais et al. (1998) Intracellular pathway for the generation of functional MHC class II peptide complexes in immature human dendritic cells J Immunol 160(6):2597-2607. 1 | Smith, Culture and differentiation of embryonic stem cells, J. of Tiss. Cult. Method, 13:89-94, 1991. | Talmor et al. (1998) Generation or large numbers of immature and mature dendritic cells from rat bone marrow cultures Eur J Immunol 28:811-817. DOI:10.1002/(SICI)1521-4141(199803)28:03<811::AID-IMMU811>3.0.CO;2-S 2 | Whiteside & Odoux (2004) Dendritic cell biology and cancer therapy Cancer Immunol Immunother 53:240-248. DOI:10.1007/s00262-003-0468-6 |
| 5th row | Schneier Bruce: Applied Cryptography Second Edition: Protocols, algoriths, and source code in C, 1996, John Wiley & Sons, USA XP002104180, pp. 180-181; 265-301; 30-31; 429-459 and 351-354. | Encryption for Open VMS, Version 1.3 Digital Software Product Descriptions, Updated: Apr. 30, 1996, Retreived From Internet: May 27, 1999 Via http:/www.digital.com/inro/sp2674, XP002104179, The whole document. | Bloks R.H.J., The IEEE1394 High Speed Serial Bus, Philips Journal of Research, vol. 50, No. 1, Jan. 1, 1996; pp. 209-216. DOI:10.1016/0165-5817(96)81310-6 210 | Kunzman A.J. et al., 1394 High Performance Serial Bus: The Digital Interface for ATV, IEEE Transactions on Consumer Electronics, vol. 41, No. 3, Aug. 1, 1995; pp. 893-900. DOI:10.1109/30.468067 145 | Stream Ciphers, Jul. 26, 2006, pp. 1-6. | Schneier Bruce: Applied Cryptography Second Edition: Protocol, algoriths, and source code in C 1996, John Wiley & Sons, USA, XP002104588. | Tasuaki Okamoto, Hiroshi Yamamoto, Series / Mathematics of information science Modern encryption, Industrial book Co., Ltd., Jun. 30, 2997, pp. 50-52. | Alfred J. Menezes et al., Handbook of Applied Cryptography, 1996 pp. 489-499. | Bruce Schneier, Applied Cryptography: Protocols, Algorithms, and Source Code in C, John Wiley & Sons, Inc. 1996 Second Edition, pp. 205-206. | Whitfield Diffie and Martin E. Hellman, Privacy and Authentication: An Introduction to Cryptography, pp. 397-428, Proceedings of the IEEE, vol. 67, No. 3, Mar. 1979. DOI:10.1109/PROC.1979.11256 161 | Eiji Okamoto, Encoding Technique for Aiming at Attainment of Bright Information Society, ?5 ? Decoding Key Delivery Technique, bit, Japan, Kyoritsu Shuppan Co., Ltd, Nov. 1, 1991, vol. 23, No. 12, pp. 51-59. | Masanori Suzuki et al., Real Time Transfer Mode of IEEE13941995 (Fire Wire) and Multimedia Correspondence Protocol, Interface, Japan, CQ Publishing Co., Ltd., Jan. 1, 1997, vol. 23, No. 1, p. 136-146. | Haruo Ushio et al., Special Edition of DVD Part 1, Try to Find out Function and Ability of New Model DVd, April issue of Video Salon, Japan, Genkosha Co., Apr. 1, 1997, vol. 33, No. 4 (201st Volume of the Set), p. 48-61. | Akira Komura, Special Edition/News Flash of DV from Europe (Second Step), Japanese Edition DV Deck will Develop in this Way, June issue of Video Salon, Japan, Genkosha Co., Jun. 1, 1996, vol. 31, No. 6(194st Volume of the Set), p. 26-35. | Office Action issued in corresponding Japanese application No. 2013-241600 dated Feb. 13, 2014 with the English translation. | Office Action issued in corresponding Japanese application No. 2013-123625 dated Mar. 11, 2014. | Office Action issued in corresponding Japanese application No. 2013-123625 dated Mar. 18, 2014. | Office Action issued in corresponding Japanese application No. 2013-251917 dated Apr. 24, 2014 and the English translation. |
Common Values
| Value | Count | Frequency (%) |
| Etienne et al., 2006, Polyelectrolyte Multilayer Film Coating and Stability at the Surfaces of Oral Prosthesis Base Polymers: An in vitro and in vivo Study, J. Dental Research 85(1):44-48. 3 | Green et al., 1999, Protective Groups in Organic Synthesis, New York, NY pp. 67-74 and 708-711. | International Search Report and Written Opinion in International Application No. PCT/US10/061704, mailed Apr. 19, 2011. | International Search Report and Written Opinion in International Application No. PCT/US10/061708, mailed Jul. 5, 2011. | International Search Report in International Application No. PCT/US09/054582, mailed Aug. 21, 2009. | Tangerman, 2002, Halitosis in Medicine: A Review, International Dental J. 52(Supp. 3):201-206. | Written Opinion in International Application No. PCT/US10/061704, mailed Jan. 27, 2012. | 2 | 0.1% |
| Simoudis, E. (2000). If it's not one channel, then it's another. Bank Marketing, 32(1), 48-50+. | 2 | 0.1% |
| Patent Cooperation Treaty, International Search Report & Written Opinion of the International Search Authority, PCT/US2009/055758, Oct. 29, 2010, 16 pages. | 2 | 0.1% |
| Optical Society of America, Optics Express; vol. 12, No. 11. May 31, 2004, 7 Pages, Jeong, Ki-Hun , et al. Tunable Microdoublet Lens Array. DOI:10.1364/OPEX.12.002494 52 | http://sharp-world.com/corporate/news/070831.html, Sharp Press Release, Aug. 31, 2007, 3 pages Sharp Develops and Will Mass Produce New System LCD with Embedded Optical Sensors to Provide Input Capabilities Including Touch Screen and Scanner Functions. | Preumont, A. Vibration Control of Active Structures: An Introduction, Jul. 2011. | 2 | 0.1% |
| Zou, et al., AI Planning and Combinatorial Optimization for Web Service Composition in Cloud Computing, May 17, 2010, Proceedings from Cloud Computing & Virtualization Conference, Singapore, 8 pp. | Morgan, Systems and Methods for Detecting Resource Consumption Events Over Sliding Intervals in Cloud-Based Network, U.S. Appl. No. 13/149, 235, filed May 31, 2011. | Morgan, Systems and Methods for Triggering Workload Movement Based on Policy Stack Having Multipie Selectable Inputs, U.S. Appl. No. 13/149, 418, filed May 31, 2011. | Morgan, Systems and Methods for Cloud Deployment Engine for Selective Workload Migration or Federation Based on Workload Conditions, U.S. Appl. No. 13/117, 937, filed May 27, 2011. | Morgan, Systems and Methods for Tracking Cloud Installation Information Using Cloud-Aware Kernel of Operating System, U.S. Appl. No. 13/149, 750, filed May 31, 2011. | Morgan, Systems and Methods for Introspective Application Reporting to Facilitate Virtual Machine Movement Between Cloud Hosts, U.S. Appl. No. 13/118, 009, filed May 27, 2011. | Morgan, Systems and Methods for Self-Moving Operating System Installation in Cloud-Based Network, U.S. Appl. No. 13/149, 877, filed May 31, 2011. | rBuilder and the rPath Appliance Platform, 2007 rPath, Inc., www.rpath.com, 3 pgs. | White PaperrPath Versus Other Software Appliance Approaches, Mar. 2008, rPath, Inc., www.rpath.com, 9 pgs. | White PaperBest Practices for Building Virtual Appliances, 2008 rPath, Inc., www.rpath.com, 6 pgs. | DeHaan et al., Systems and Methods for Secure Distributed Storage, U.S. Appl. No. 12/610, 081, filed Oct. 30, 2009. | Ferris et al., Methods and Systems for Monitoring Cloud Computing Environments U.S. Appl. No. 12/627, 764, filed Nov. 30, 2009. | Ferris et al., Methods and Systems for Detecting Events in Cloud Computing Environments and Performing Actions Upon Occurrence of the Events, U.S. Appl. No. 12/627, 646, filed Nov. 30, 2009. | Ferris et al, Methods and Systems for Verifying Software License Compliance in Cloud Computing Environments, U.S. Appl. No. 12/627, 643, filed Nov. 30, 2009. | Ferris et al, Systems and Methods for Service Aggregation Using Graduated Service Levels in a Cloud Network, U.S. Appl. No. 12/628, 112, filed Nov. 30, 2009. | Ferris et al, Methods and Systems for Generating a Software License Knowledge Base for Verifying Software License Compliance in Cloud Computing Environments, U.S. Appl. No. 12/628, 156, filed Nov. 30, 2009. | Ferris et al, Methods and Systems for Converting Standard Software Licenses for Use in Cloud Computing Environments, U.S. Appl. No. 12/714, 099, filed Feb. 26, 2010. | Ferris et al, Systems and Methods for Managing a Software Subscription in a Cloud Network, U.S. Appl. No. 12/714, 096, filed Feb. 26, 2010. | Ferris et al., Methods and Systems for Providing Deployment Architectures in Cloud Computing Environments, U.S. Appl. No. 12/714, 427, filed Feb. 26, 2010. | Ferris et al., Methods and Systems for Matching Resource Requests with Cloud Computing Environments, U.S. Appl. No. 12/714, 113, filed Feb. 26, 2010. | Ferris et al., Systems and Methods for Generating Cross-Cloud Computing Appliances, U.S. Appl. No. 12/714, 315, filed Feb. 26, 2010. | Ferris et al., Systems and Methods for Cloud-Based Brokerage Exchange of Software Entitlements, U.S. Appl. No. 12/714, 302, filed Feb. 26, 2010. | Ferris et al., Methods and Systems for Offering Additional License Terms During Conversion of Standard Software Licenses for Use in Cloud Computing Environments, U.S. Appl. No. 12/714, 065, filed Feb. 26, 2010. | Ferris et al., Systems and Methods for or a Usage Manager for Cross-Cloud Appliances, U.S. Appl. No. 12/714, 334, filed Feb. 26, 2010. | Ferris et al., Systems and Methods for Delivery of User-Controlled Resources in Cloud Environments Via a Resource Specification Language Wrapper, U.S. Appl. No. 12/790, 294, filed May 28, 2010. | Ferris et al., Systems and Methods for Managing Multi-Level Service Level Agreements in Cloud-Based Networks, U.S. Appl. No. 12/789, 660, filed May 28, 2010. | Ferris et al., Methods and Systems for Generating Cross-Mapping of Vendor Software in a Cloud Computing Environment, U.S. Appl. No. 12/790, 527, filed May 28, 2010. | Ferris et al., Methods and Systems for Cloud Deployment Analysis Featuring Relative Cloud Resource Importance, U.S. Appl. No. 12/790, 366, filed May 28, 2010. | Ferris et al., Systems and Methods for Generating Customized Build Options for Cloud Deployment Matching Usage Profile Against Cloud Infrastructure Options, U.S. Appl. No. 12/789, 701, filed May 28, 2010. | Ferris et al., Systems and Methods for Exporting Usage History Data as Input to a Managment Platform of a Target Cloud-Based Network, U.S. Appl. No. 12/790, 415, filed May 28, 2010. | Ferris et al., Systems and Methods for Cross-Vendor Mapping Service in Cloud Networks, U.S. Appl. No. 12/790, 162, filed May 28, 2010. | Ferris et al., Systems and Methods for Cross-Cloud Vendor Mapping Service in a Dynamic Cloud Marketplace, U.S. Appl. No. 12/790, 229, filed May 28, 2010. | Ferris et al., Systems and Methods for Aggregate Monitoring of Utilization Data for Vendor Products in Cloud Networks, U.S. Appl. No. 12/790, 039, filed May 28, 2010. | Ferris et al., Systems and Methods for Matching a Usage History to a New Cloud, U.S. Appl. No. 12/953, 757, filed Nov. 24, 2010. | Ferris et al., Systems and Methods for Identifying Usage Histories for Producing Optimized Cloud Utilization, U.S. Appl. No. 12/952, 930, filed Nov. 23, 2010. | Ferris et al., Systems and Methods for Identifying Service Dependencies in a Cloud Deployment, U.S. Appl. No. 12/952, 857, filed Nov. 23, 2010. | Ferris et al., Systems and Methods for Migrating Subscribed Services in a Cloud Deployment, U.S. Appl. No. 12/955, 277, filed Nov. 29, 2010. | Ferris et al., System and Methods for Migrating Subscribed Services from a Set of Clouds to a Second Set of Clouds, U.S. Appl. No. 12/957, 281, filed Nov. 30, 2001. | Morgan, Systems and Methods for Generating Multi-Cloud Incremental Billing Capture and Administration, U.S. Appl. No. 12/954, 323, filed Nov. 24, 2010. | Morgan, Systems and Methods for Aggregating Marginal Subscription Offsets in Set of Multiple Host Clouds, U.S. Appl. No. 12/954, 400, filed Nov. 24, 2010. | Morgan, Systems and Methods for Generating Dynamically Configurable Subscription Parameters for Temporary Migration of Predictive User Workloads in Cloud Network, U.S. Appl. No. 12/954, 378, filed Nov. 24, 2010. | Morgan, Systems and Methods for Managing Subscribed Resource Limits in Cloud Network Using Variable or Instantaneous Consumption Tracking Periods, U.S. Appl. No. 12/954, 352, filed Nov. 24, 2010. | Ferris et al., Systems and Methods for Migrating Software Modules into One or More Clouds, U.S. Appl. No. 12/952, 701, filed Nov. 23, 2010. | Ferris et al. Systems and Methods for Brokering Optimized Resource Supply Costs in Host Cloud-Based Network Using Predictive Workloads, U.S. Appl. No. 12/957, 274, filed Nov. 30, 2010. | Ferris et al., Systems and Methods for Reclassifying Virtual Machines to Target Virtual Machines or Appliances Based on Code Analysis in a Cloud Environment, U.S. Appl. No. 12/957, 267, filed Nov. 30, 2010. | Morgan, Systems and Methods for Generating Optimized Resource Consumption Periods for Multiple Users on Combined Basis, U.S. Appl. No. 13/037, 359, filed Mar. 1, 2011. | Morgan, Systems and Methods for Metering Cloud Resource Consumption Using Multiple Hierarchical Subscription Periods, U.S. Appl. No. 13/037, 360, filed Mar. 1, 2011. | Morgan, Systems and Methods for Generating Marketplace Brokerage Exchange of Excess Subscribed Resources Using Dynamic Subscription Periods, U.S. Appl. No. 13/037, 351, filed Feb. 28, 2011. | 1 | < 0.1% |
| Extended European Search Report dated Mar. 27, 2014, issued in corresponding EP Application No. 12166381.9, 9 pages. | QUALCOMM Incorporated, CQI reporting for MIMO UE's when the P-CPICH and S-CPICH have unequal power settings, 3GPP TSG RAN WG1 Meeting #61bis, R1-103847, Dresden, Germany, Jun. 28-Jul. 2, 2010, Agenda item: 5.1.1, 10 pages. | Lenardi, Massimiliano et al., A RAKE Structured SINR Maximizing Mobile Receiver for the WCDMA Downlink, XP032139740, vol. 1, Nov. 4, 2001, DOI: 10.1109/ACSSC.2001.98690, ISBN: 978-0/7803-7147-7, pp. 410-414. DOI:10.1109/ACSSC.2001.986960 2 | Buchacher, Clemens et al., A Semi-Blind Base Station Power Estimation Algorithm for Interference Aware HSDPA Receivers, 18th European Signal Processing Conference (EUSIPCO-2010), Aalborg, Denmark, Aug. 23-27, 2010, EURASIP, 2010, XP55106956, pp. 1592-1596. 1 | 1 | < 0.1% |
| U.S. Appl. No. 13/282, 228: Non-final office action, mailed Jun. 19, 2014, 10 pages. | 1 | < 0.1% |
| Pan et al. Journal of Biomedical Materials Research Part A, Apr. 2008, 89(1); 160-7. | Danhier et al. Journal of Controlled Release 133 (2009) 11-17, published 2008. DOI:10.1016/j.jconrel.2008.09.086 2 | McGee J. Paul, Stanley S. Davis, Derek T. O'Hagan, Zero order release of protein from poly (D, L-lactide-co-glycolide) microparticles prepared using a modified phase separation technique, Journal of Controlled Release, 34, 77-86 (1995). 9 | Nair S. Lakshmi and Cato T. Laurencin, Biodegradable polymers as biomaterials, Progress in Polymer Science, 32, 762-98 (2007). DOI:10.1016/j.progpolymsci.2007.05.017 54 | Merkli A., C. Tabatabay, R. Gurny, J. Heller, Biodegradable polymers for the controlled release of ocular drugs, Progress in Polymer Science, 23, 563-80 (1998). DOI:10.1016/S0079-6700(97)00048-8 | Ray Biswajit and Broja M. Mandal, Dispersion polymerization of Acrylamide: Part II. 2, 2?-Azobisisobutyronitrile initiator, Journal of Polymer Science: Part A: Polymer Chemistry, 37, 493-499 (1999). 3 | Horak Daniel, Effect of reaction parameters on the particle size in the dispersion polymerization of 2-Hydroxyethyl Methacrylate, Journal of Polymer Science Part A: Polymer Chemistry, 37, 3785-92 (1999). DOI:10.1002/(SICI)1099-0518(19991015)37:20<3785::AID-POLA7>3.0.CO;2-U | Horak Daniel and Ostap Chaykivskyy, Poly (2-Hydroxyethyl Methacrylate-co-N, O-Dimethacryloylhydroxylamine) particles by dispersion polymerization, Journal of Polymer Science: Part A: Polymer Chemistry, 40, 1625-1632 (2002). DOI:10.1002/pola.10238 | Gref. R., A. Domb, P. Quellec, T. Blunk, R. H. Muller, J. M. Verbavatz, R. Langer, The controlled intravenous delivery of drugs using PEG-coated sterically stabilized nanospheres, Advanced Drug Delivery Reviews, 16, 215-33 (1995). DOI:10.1016/0169-409X(95)00026-4 21 | Errico Cesare, Bartoli Cristina, Chiellini Federica and Chiellini Emo, Poly(hydroxyalkanoates)-based Polymeric Nanoparticles for Drug Delivery, Journal of Biomedicine and Biotechnology, 2009, Article ID 571702, 1-10 pages (2009). | Herault Damien, Christine Saluzzo, Marc Lemaire, Preparation of monodisperse enantiomerically pure glycidyl methacrylate-ethylene glycol dimethacrylate copolymers in dispersion copolymerization: Functionalization, Reactive and Functional Polymers, 66, 567-77 (2006). DOI:10.1016/j.reactfunctpolym.2005.10.010 | Song, Jing-She, Frederic Tronc, Mitchell A. Winnik, Monodisperse, controlled micron-size dye-labeled polystyrene particles by two stage dispersion polymerization, Polymer, 47, 817-825 (2005). | Kricheldorf Hans R., Kreiser-Saunders and Caroline Boettcher, Polylactones: 31. Sn(II)octoate-initiated polymerization of L-lactide: a mechanistic study, Polymer, 36(6), 1253-59 (1995). DOI:10.1016/0032-3861(95)93928-F 8 | Akala Emmanuel O., Pavla Kopeckova, Jindrich Kopecek, Novel pH-sensitive hydrogels with adjustable swelling kinetics; Biomaterials, 19, 1037-47 (1998). DOI:10.1016/S0142-9612(98)00023-4 14 | Al-Ghananeem Abeer M., Malkawi Ahmad H., Muammer Yahya, Balko Justin M., Black Esther P., Mourad Walid and Romond Edward, Intratumoral Delivery of Paclitaxel in Solid Tumor from Biodegradable Hyaluronan Nanoparticle Formulations, AAPS Pharm. Sci. Tech., 10(2), 410-417 (2009). DOI:10.1208/s12249-009-9222-5 | Athanasiou Kyriacos A., C. Mauli Agrawal, F. Alan Barber and Stephen S. Burkhart, Orthopaedic applications for PLA-PGA biodegradable polymers, The Journal of Arthroscopy and Related Surgery, 14(7), 726-737 (1998). DOI:10.1016/S0749-8063(98)70099-4 6 | Cadee J. A, M. De Kerf, C. J. De Groot, W. Den Otter, W. E. Hennink, Synthesis, characterization of 2-(mathacryloyloxy)-(di-) L-lactate and their application in dextran-based hydrogels, Polymer, 40, 6877-81 (1999). DOI:10.1016/S0032-3861(99)00354-7 7 | Capek Ignac, Surface active properties of polyoxyethylene macromonomers and their role in radical polymerization in disperse systems, Advances in Colloid and Interface Science, 88(3), 295-357 (2000). DOI:10.1016/S0001-8686(99)00025-1 | Eguiburu Jose Luis, Maria Fernandez Berridi and Julio San Roman, Functionalization of poly(L-lactide) macromonomers by ring-opening polymerization of L-lactide initiated with hydroxyethyl methacrylate-aluminium alkoxides, Polymer, 36(1), 173-179 (1995). DOI:10.1016/0032-3861(95)90689-Y | Chavanpatil Mahesh D., Patil Yogesh and Panyam Jayanth, Susceptibility of nanoparticle-encapsulated paclitaxel to P-glycoprotein-mediated drug efflux, International Journal of Pharmaceutics, 320, 150-156 (2006). DOI:10.1016/j.ijpharm.2006.03.045 | Czelusniak Izabela, Ezat Khosravi, Alan M. Kenwright, Christopher W. G. Ansell, Synthesis, Characterization, and Hydrolytic Degradation of Polylactide-Functionalized Polyoxanorbornenes, Macromolecules, 40, 1444-52 (2007). DOI:10.1021/ma061900o | Couvreur Patrick and Christine Vauthier, Nanotechnology: Intelligent design to treat complex disease, Pharmaceutical Research, 23(7), 1417-50 (2006). DOI:10.1007/s11095-006-0284-8 | Allemann Eric, Eric Doelker and Robert Gurny, Drug loaded Poly(lactic acid) nanoparticles produced by a reversible salting out process: Purification of an injectable dosage form, European Journal of Pharmaceutics and Biopharmaceutics, 39(1), 13-18 (1993). 27 | Layre A., P. Couvreur, H. Chacun, J. Richard, C. Passirani, D. Requier, J. P. Benoit, R. Gref, Novel composite core-shell nanoparticles as busulfan carriers, Journal of Controlled Release, 111, 271-80 (2006). DOI:10.1016/j.jconrel.2006.01.002 | Metters A. T., K. S. Anseth, C. N. Bowman, Fundamental studies of a novel, biodegradable PEG-b-PLA hydrogel, Polymer, 41, 3993-4004 (2000). DOI:10.1016/S0032-3861(99)00629-1 4 | Iojoiu Christina, David Cade, Hatem Fessi and Thierry Hamaide, Synthesis of oligocaprolactone vinyl ether macromonomers and their use for indomethacin encapsulation in polymer nanoparticles based on polycaprolactone macromonomer-maleic anhydride-N-vinyl pyrrolidone terpolymers, Polymer International, 55, 222-28 (2006). DOI:10.1002/pi.1964 | Jin Cheng, Bai Ling, Wu Hong, Song Wenjie, Guo Guohen and Dou Kefeng, Cytotoxicity of Paclitaxel Incorporated in PLGA Nanoparticles on Hypoxic Human Tumor Cells, Pharmaceutical Research, 26(7), 1776-1784 (2009). DOI:10.1007/s11095-009-9889-z | Kawaguchi Seigou and Koichi Ito, Dispersion Polymerization, Advances in Polymer Science, 175, 299-328 (2005). DOI:10.1007/b100118 11 | Kim Jin-Woong, Chung-Hyuk Lee, Jung Bae Jun, Kyung-Do Suh, Monodisperse micron-sized crosslinked polystyrene particles: VII. Importance of monomer-diffusible surface characteristics of growing particles, Colloids and Surfaces A: Physicochemical and Engineering Aspects, 194, 57-64 (2001). DOI:10.1016/S0927-7757(01)00805-6 | Kim, Mi Sun, Gyu Ho Lee, Jae-Min Hong, Hyunjung Lee, Synthesis of Monodisperse PS-co-PDMS Microspheres by Dispersion Polymerization, Materials Science and Engineering C, 27, 1247-51 (2007). DOI:10.1016/j.msec.2006.06.034 | Kunzmann Andrea, Andersson Britta, Thurnherr Tina, Krug Harald, Scheynius Annika, Fadeel Bengt, Toxicology of engineered nanomaterials: Focus on biocompatibility, biodistribution and biodegradation, Biochimica et Biophysica Acta, 1810:361-373, (2011). (e-published ahead of printing: (May 8, 2010). DOI:10.1016/j.bbagen.2010.04.007 | Ulbrich K., V. Subr, L. W. Seymour, R. Duncan, Novel biodegradable hydrogels prepared using the divinylic crosslinking agent N, O-dimethacryloylhydroxylamine: 1. Synthesis and characterization of rates of gel degradation and rate of release of model drugs, in vitro and in vivo, Journal of Controlled Release, 24, 181-90 (1993). DOI:10.1016/0168-3659(93)90177-7 26 | Kim So Yeon, I L Gyun Shin, Young Moo Lee, Chong Su Cho, Yong Kiel Sung, Methoxy poly(ethylene glycol) and . epsilon.-caprolactone amphiphilic block copolymeric micelle containing indomethacin. II. Micelle formation and drug release behaviours, Journal of Controlled Release, 51, 13-22 (1998). DOI:10.1016/S0168-3659(97)00124-7 16 | Langer Robert, Polymer-Controlled Drug Delivery Systems, Accounts of Chemical Research, 26(10), 537-42 (1993). DOI:10.1021/ar00034a004 24 | Soppimath Kumaresh S., Tejraj M. Aminabhavi, Anandrao R. Kulkarni, Walter E. Rudzinski, Biodegradable polymeric nanoparticles as drug delivery devices, Journal of Controlled Release, 70, 1-20 (2001). DOI:10.1016/S0168-3659(00)00339-4 42 | Leobandung William, Hideki Ichikawa, Yoshinobu Fukumori, Nicholas A. Peppas, Monodisperse Nanoparticles of Poly (ethylene glycol) Macromers and N-Isopropyl Acrylamide for Biomedical Applications. Journal of Applied Polymer Science, 87, 1678-84 (2003). DOI:10.1002/app.11612 | Ulbrich K., V. Subr, P. Podperova, M. Buresova, Synthesis of novel hydrolytically degradable hydrogels for controlled drug release, Journal of Controlled Release, 34, 155-65 (1995). DOI:10.1016/0168-3659(95)00004-R | Luo Weijun, Suming Li, Jianzhong Bei, Shenguo Wang, Synthesis and Characterization of Poly(L-lactide)-Poly (ethylene glycol) Multiblock Copolymers, Journal of Applied Polymer Science, 84, 1729-36 (2002). DOI:10.1002/app.10580 | Ranade Vasant V., Drug delivery systems: 3B. Role of Polymers in Drug Delivery, The Journal of Clinical Pharmacology, 30, 107-120 (1990). | Sahoo Sanjeeb K. and Labhasetwar Vinod, Enhanced Antiproliferative Activity of Transferrin-Conjugated Paclitaxel-Loaded Nanoparticles is Mediated via Sustained Intracellular Drug Retention, Molecular Pharmaceutics, 2(5), 373-383 (2005). DOI:10.1021/mp050032z | Sairam Malladi, V. Ramesh Babu, Boya Vijaya Kumar Naidu, Tejraj M. Aminabhavi, Encapsulation efficiency and controlled release characteristics of crosslinked polyacrylamide particles, International Journal of Pharmaceutics, 320, 131-136 (2006). DOI:10.1016/j.ijpharm.2006.05.001 | Sarac A. S., Redox Polymerization, Progress in Polymer Science, 24, 1149-1204 (1999). DOI:10.1016/S0079-6700(99)00026-X 19 | Vazquez Blanca, Belen Levenfeld, Julio San Roman, Role of amine activators on the curing parameters, properties and tocixity of acrylic bone cements, Polymer International, 46, 241-50 (1998). DOI:10.1002/(SICI)1097-0126(199807)46:3<241::AID-PI49>3.0.CO;2-G | Wood David A., Biodegradable drug delivery systems, International Journal of Pharmaceutics, 7, 1-18 (1980). DOI:10.1016/0378-5173(80)90094-0 | Yang Tao, Fu-De Cui, Min-Koo Choi, Hongxia Lin, Suk-Jae Chung, Chang-Koo Shim, Dae-Duk Kim, Liposome Formulation of Paclitaxel with Enhanced Solubility and Stability, Drug Delivery, 14(5), 301-08 (2007). DOI:10.1080/10717540601098799 | Torchilin Vladimir, Multifunctional Nanocarriers, Advanced Drug Delivery Reviews, 58, 1532-1555 (2006). DOI:10.1016/j.addr.2006.09.009 | Xu Peisheng, Edward A. Van Kirk, Shiyan Li, William J. Murdoch, Jun Ren, Muhammad Delwar Hussain, Maciej Radosz, Youquing Shen, Highly stable core-surface-crosslinked nanoparticles as cisplatin carriers for cancer chemotherapy, Colloids and Surfaces B: Biointerfaces, 48, 50-57 (2006). DOI:10.1016/j.colsurfb.2006.01.004 | Yin Wusheng, Emmanuel O. Akala, Robert E. Taylor, Design of naltrexone-loaded hydrolyzable crosslinked nanoparticles, International Journal of Pharmaceutics, 244, 9-19 (2002). DOI:10.1016/S0378-5173(02)00297-1 | Ofir R, Seidman R, Rabinski T, Krup M, Yavelsky V, Weinstein Y and Wolfson M, Taxol-induced apoptosis un human SKOV3 ovarian and MCF7 breast carcinoma cells is caspase-3 and caspase-9 independent, Cell Death and Differentiation, 9, 636-642 (2002). DOI:10.1038/sj.cdd.4401012 | Zhao Yue, Jie Fu, Dennis K. P. Ng, Chi Wu, Formation and Degradation of Poly (D, L-lactide) Nanoparticles and Their Potential Application as Controllable Releasing Devices, Macromolecular Bioscience, 4, 901-06 (2004). DOI:10.1002/mabi.200400072 | Odian George, Principles of Polymerization Second ed.; Wiley-Interscience: New York, U.S.A., pp. 194-204; 216-219; 271-275 (1981). | Huang Samuel J. and John M. Onyari, Multicomponent polymers of poly(lactic acid) macromonomers with methacrylate terminal and copolymers of poly(2-hydroxyethyl methacrylate), Journal of Macromolecular SciencePure and Applied Chemistry A, 33(5), 571-84 (1996). | Akala Emmanuel O, Oluchi Elekwachi, Vantoria Chase, Hausalynn Johnson, Marjorie Lazarre, Kenneth Scott, Organic redox-initiated polymerization process for the fabrication of hydrogels for colon-specific drug delivery, Drug Development and Industrial Pharmacy, 29(4), 375-386 (2003). DOI:10.1081/DDC-120018373 | Gerhardt Warren W., David E. Noga, Kenneth I. Hardcastle, Andres J. Garcia, David M. Collard, Marcus Weck, Functional Lactide Monomers: Methodology and Polymerization, Biomacromolecules, 7, 17-1742 (2006). | Achilias Dimitris S, and Irini D. Sideridou, Kinetics of the benzoyl peroxide/amine initiated free-radical polymerization of dental dimethacrylate monomers: Experimental studies and mathematical modeling for TEGDMA and bis-EMA, Macromolecules, 37, 4254-65 (2004). DOI:10.1021/ma049803n 5 | Ober Christopher K. and Kar P. Lok, Formation of large monodisperse copolymer particles by dispersion polymerization, Macromolecules, 20, 268-273 (1987). DOI:10.1021/ma00168a007 | Ryner Maria, Anna Finne, Ann-Christine Albertsson, Hans R. Kricheldorf, L-lactide Macromonomer Synthesis Initiated by New Cyclic Tin Alkoxides Functionalized for Brushlike Structures, Macromolecules, 34, 7281-7287 (2001). DOI:10.1021/ma0106898 | Boffa Lisa S, and Bruce M. Novak, Link-Functionalized Polymers: An unusual macromolecular architecture through bifunctional initiation, Macromolecules, 30, 3494-3506 (1997). DOI:10.1021/ma961805n | Sawhney Amarpreet S., Chandrashekhar P. Pathak and Jeffrey A. Hubbell, Bioerodible hydrogels based on photopolymerized poly(ethyleneglycol)-co-poly(.alpha.-hydroxy acid) diacrylate macromers, Macromolecules, 26:581-587 (1993). DOI:10.1021/ma00056a005 424 | CellTiter.RTM.-Glo Luminescent Cell Viability Assay Technical Bulletin, TB 288, Jun. 2009, Promega Corporation, WI, USA. | PCT Search Report and Written Opinion: PCT/US2011/061902, mailed Jul. 30, 2012, which corresponds to U.S. Appl. No. 12/952, 843 (9 pages). | PCT Search Report and Written Opinion: PCT/US2011/061917, mailed Jul. 20, 2012, which corresponds to U.S. Appl. No. 12/952, 856 (10 pages). | Shenoy, D. B., Amiji, M. M., Poly(ethylene oxide)-modified poly(-caprolactone) Nanoparticles for Targeted Delivery of Tamoxifen in Breast Cancer, Int. J. Pharm., 293, 261-70 (2005). DOI:10.1016/j.ijpharm.2004.12.010 | Cammas, S., Suzuki, K.; Sone, C.; Sakurai, Y., Kataoka, K., Okano, T, Thermo-Responsive polymer nanoparticles with a Core-Shell Micelle Structure as Site-Specific Drug Carriers, Journal of Controlled Release 48, 157-64 (1997). DOI:10.1016/S0168-3659(97)00040-0 | Yokoyama, M., Okano, T., Targetable Drug Carriers: Present Status and a Future Perspective, Advanced Drug Delivery Reviews 21, 77-80 (1996). DOI:10.1016/S0169-409X(96)00439-5 | Kawaguchi, S., Winnik, M. A., Ito, K., Dispersion Copolymerization of n-Butyl Methacrylate with Poly(ethylene oxide) Macromonomers in Methanol-Water: Comparison of Experiment with Theory, Macromolecules 28, 1159-66 (1995). DOI:10.1021/ma00108a051 | Robinson, D. N., Peppas, N. A., Preparation and Characterization of pH-Responsive Poly(methacrylic acid-g-ethylene glycol) nanospheres, Macromolecules 35, 3668-74 (2002). DOI:10.1021/ma011525u | Huang, S. K., Stauffer, P. R., Hong, K., Uuo, J. W. H., Philips, T. L., Huang, A., Papahadjopoulos, D., Liposomes and Hyperthermia in Mice: Increased Tumor Uptake and Therapeutic Efficacy of Doxorubicin in Sterically Stabilized Liposomes, Cancer Research 54, 2186-91 (1994). | Bakare, O., Ashendel, C. L., Peng, H., Zalkow, L. H., Burgess, E. M., Synthesis of MEK1 Inhibitory Activities of Imido-Substituted 2-Chloro-1, 4-naphthoquinones, Bioorganic & Medicinal Chemistry 11, 3165-70 (2003). DOI:10.1016/S0968-0896(03)00267-0 | Yin, W., Akala, E. O., Taylor, R. E., Design of Naltrexone-Loaded Crosslinked Nanoparticles, International Journal of Pharmaceutics 244, 9-19 (2002). DOI:10.1016/S0378-5173(02)00297-1 | Bamnolker, H., Margel, S., Dispersion Polymerization of Styrene in Polar Solvent: Effect of Reaction parameters on Microsphere Surface Composition and Surface Properties, Size and Size Distribution, and Molecular Weight, Journal of Polymer Science: Part A: Polymer Chemistry 34, 1857-71 (1996). | Rosier, A., Vandermeulen, W. M., Klok, H.-A., Advanced Drug Delivery Devices via Self-Assembly of Amphiphilic Block Copolymers, Advanced Drug Delivery Reviews 53, 95-108 (2001). DOI:10.1016/S0169-409X(01)00222-8 18 | Feng, S.-S., Chien, S., Chemotherapeutic Engineering: Application and Further Development of Chemical Engineering Principles for Chemotherapy of Cancer and Other Diseases, Chemical Engineering Science 58, 4087-4114 (2003). DOI:10.1016/S0009-2509(03)00234-3 | Ramtoola, Z., Corrigan, O. I, Barrett, C. J., Release Kinetics of Fluphenazine from Biodegradable Microspheres, Journal of Microencapsulation, 9, 415-23 (1992). DOI:10.3109/02652049209040480 | Pakunlu, R. I., Wang, Y., Tsao, William, Pozharov, V., Cook, T. J., Minko, T., Enhancement of the Efficay of Chemotherapy for Lung Cancer by Simultaneous Suppression of Multidrug Resistance and Antiapoptotic Cellular Defense: Novel Multicomponent Delivery System, Cancer Research, 64, 6214-6224 (2004). DOI:10.1158/0008-5472.CAN-04-0001 | Nasongkla, Norased, Bey, Erik, Ren, Jimin, Ai, Hua, Khemtong, Chalermchai, Guthi, Jagadeesh Setti, Chin, Shook-Fong, Sheery, A. Dean, Boothman, David A. and Gao, Jinming, Multifunctional Polymeric Micelles as Cancer-Targeted, MRI-Ultasenstive Drug Delivery Systems, Nano Letters, 6(11), 2427-2430 (2006). DOI:10.1021/nl061412u | Ferrari, M. Cancer Nanotechnology: Opportunities and Challenges, Nature Reviews/Cancer, 5; 1-11 (2005). | Gaither, A., Lourgenko, V., RNA Interference Technologies and their Use in Cancer Research, Curr. Opin. Oncol., 19:50-54 (2007). DOI:10.1097/CCO.0b013e328011a8b0 | Lasic, D. D., Martin, F. J., Gabizon, A., Huang, S. K., Papahadjopoulos, D., Sterically Stabilized Liposomes: A Hypothesis on the Molecular Origin of the Extended Circulation Times, Biochimica et Biophysica Acta (BBA)Biomembranes 1070, 187-92 (1991). DOI:10.1016/0005-2736(91)90162-2 31 | Burm, J.-P., Jhee, S. S., Chin, A., Moon, Y. S. K., Jeong, E., Nii, L., Fox, J. L., Gill, M. A., Stability of Paclitaxel with Ondansetron Hydrochloride or Ranitidine Hydrochloride During Simulated Y-Site Administration, American Journal of Hospital Pharmacy 51, 1201-1204 (1994). | Minko, T., Dharap, S. S., Pakunlu, R. I., Wang, Y., Molecular Targeting of Drug Delivery Systems to Cancer, Current Drug Targets, 5, 389-406 (2004). DOI:10.2174/1389450043345443 12 | Trail, P. A., Wilner, D., Lasch, S. J., Henderson, A. J., Hofstead, H., Casazza, A. M., Firestone, R. A., Hellstrom, K. E., Cure of Xenografted Human Carcinomas by BR96-Doxorubicin Immunoconjugates, Science 261, 212-15 (1993). DOI:10.1126/science.8327892 93 | Cancer Nanotechnology (Going Small for Big Advances: Using Nanotechnology to Advance Cancer Diagnosis, Prevention and Treatment). U.S. Department of Health and Human Services, National Institutes of Health/National Cancer Institute. NIH Publication No. 04-5489, 2004). | Eric M Pridgen, Robert Langer, Omid C Farokhzad Biodegradable, polymeric nanoparticle delivery systems for cancer therapy, Nanomedicine, 2(5), 669-80 (Oct. 2007). DOI:10.2217/17435889.2.5.669 | Longnecker, S. M., Donehower, R. C., Cates, A. E., Chen, T.-L., Brundrett, R. B., Grochow, L. B., Ettinger, D. S., Colvin, M., High-Performance Liquid Chromatography Assay for Taxol in Human Plasma and Urine and Pharmacokinetics in a Phase I Trial, Cancer Treatment Reports 71, 53-59 (1987). 15 | Nugroho, M. B., Kawaguchi, S., Ito, K., Winnik, M. A, Control of Particle Size in Dispersion Polymerization Using Poly (ethylene oxide) Macromonomers, Macromolecular Reports A32, 593-601 (1995). | Sant, S et al., Effect of polymer architecture on surface properties, plasma protein adsorption, and cellular interactions of pegylated nanoparticles, Journal Biomedical Materials Research Part 87A(4): 885-895 (2008). DOI:10.1002/jbm.a.31800 | Scheler, S et al., Cellular uptake and degradation behavior of biodegradable poly(ethylene glycol-graft-methyl methacrylate) nanoparticles crosslinked with dimethacryloyl hydroxylamine, International Journal Pharmaceutical 103, 207-218 (2011) (available online Oct. 2010). | Yin, W et al., Design of naltrexone-loaded hydrolyzable crosslinked nanoparticles, International Journal Pharmaceutical 244, 9-19 (2002). DOI:10.1016/S0378-5173(02)00297-1 | Daniel Horak et al., Poly(2-hydroxyethyl methacrylate)-based slabs as a mouse embryonic stem cell support, Biomaterials 25 (2004) 5249-5260. DOI:10.1016/j.biomaterials.2003.12.031 | European Patent Office Extended European Search Report dated May 21, 2014 for European Application No. 11842912.5, 6 pages. | 1 | < 0.1% |
| Evaluation Report for Chinese Application No. 201020138464.6. | Novelty Evaluation Report for Chinese Application No. 201020138464.6. | Chinese Office Action for CN 201010127191.0 mailed Aug. 2, 2012. | Report of Utility Model Technical Opinion for JP 2010-001169 mailed Jun. 15, 2011. | International Search Report and Written Opinion for PCT/US2010/048043 mailed May 26, 2011. | International Preliminary Report on Patentability for PCT/US2010/048043 mailed Apr. 5, 2012. | 1 | < 0.1% |
| International Search Report and Written Opinion of PCT/US2011/059967, mailed Mar. 21, 2013, 20 pages. | International Search Report and Written Opinion for PCT/US2011/059973, mailed Feb. 14, 2013, 13 pages. | Peter J. Westervelt; Parametric Acoustic Array, The Journal of the Acoustical Society of America, vol. 35, No. 4, Apr. 1963, pp. 535-537. DOI:10.1121/1.1918525 52 | International Search Report and Written Opinion for PCT International Patent Application No. PCT/US2009/047934, mailed Jan. 12, 2009. | Johnson et al., Nonlinear Generation of Elastic waves in Crystalline Rock, Journal of Geophysical Research, vol. 92, No. B5, pp. 3597-3602, Apr. 10, 1987. DOI:10.1029/JB092iB05p03597 24 | International Search Report and Written Opinion for PCT International Patent Application No. PCT/US2009/047184, mailed Dec. 21, 2009. | International Preliminary Report on Patentability for PCT International Patent Application No. PCT/US2009/047184, mailed Dec. 23, 2010. | International Search Report and Written Opinion for PCT International Patent Application No. PCT/US2010/031485, mailed Aug. 2, 2010. | International Search Report and Written Opinion for PCT International Patent Application No. PCT/US2010/031490, mailed Sep. 14, 2010. | Aas et al.; 3-D Acoustic Scanner, SPE, Society of Petroleum Engineers, Sep. 23-26, 1990, pp. 725-732. | Ostrovsky. L.A., and Johnson, P.A., Dynamic Nonlinear Elasticity in Geomaterials, Rivista del Nuovo Cimento, vol. 24, No. 7., 2001. 18 | Johnson, Paul A., and Shankland, Thomas J., Nonlinear Generation of Elastic Waves in Granite and Sandstone: Continuous Wave and Travel Time Observations, Journal of Geophysical Research, vol. 94, No. B12, 1989, pp. 17, 729-17, 733. DOI:10.1029/JB094iB12p17729 20 | Jones, G.L. and Kobett, D.R., Interaction of Elastic Waves in an Isotropic Solid, The Journal of the Acoustical Society of America, vol. 35, No. 1, 1963, pp. 5-10. DOI:10.1121/1.1918405 23 | Rollins, F.R., Taylor, L.H. and Todd, P.H., Ultrasonic Study of Three-Phonon Interactions. II. Experimental Results, Physical Review, vol. 136, No. 3A, 1964, pp. 597-601. | Korneev, Valeri A., Nihei, Kurt T. and Myer, Larry R., Nonlinear Interaction of Plane Elastic Waves, Lawrence Berkeley National Laboratory Report LBNL-41914, 1998. | International Preliminary Report on Patentability for PCT International Patent Application No. PCT/US2010/031490, mailed Oct. 27, 2011. | International Preliminary Report on Patentability for PCT International Patent Application No. PCT/US2010/031485, mailed Oct. 27, 2011. | Tserkovnyak et al.; Non-linear tube waves in permeable formations: Difference frequency generation, Journal of the Acoustical Society of America, Jul. 1, 2004, vol. 116, Issue 1, pp. 209-216. DOI:10.1121/1.1753293 15 | Singapore Office Action for Appln. No. 201009640-2, mailed Dec. 2, 2011. | PCT International Search Report and Written Opinion for PCT International Patent Application No. PCT/US2011/035608, mailed Dec. 22, 2011. | PCT International Search Report and Written Opinion for PCT International Patent Application No. PCT/US2011/035595, mailed Dec. 27, 2011. | PCT International Search Report and Written Opinion for PCT International Patent Application No. PCT/US2011/035358, mailed Dec. 29, 2011. | International Preliminary Report on Patentability for PCT International Patent Application No. PCT/US2009/047934, mailed Jan. 13, 2011. | International Preliminary Report on Patentability for PCT International Patent Application No. PCT/US2009/047184, mailed Dec. 14, 2010. | International Preliminary Report on Patentability for PCT International Patent Application No. PCT/US2009/047934, mailed Dec. 1, 2009. | Australian Examination Report dated Feb. 7, 2014 for 2011326567. | Mexican Office Action dated Jun. 5, 2014 for Appln. No. MX/A/2013/005333. | U.S. Notice of Allowance 'dated Sep. 5, 2014 for U.S. Appl. No. 13/292, 924. | U.S. Office Action dated Aug. 25, 2014 for U.S. Appl. No. 13/292, 908. | Australian Office Action dated Aug. 28, 2014 for Appln. No. 2011326570. | Mexican Office Action dated Sep. 25, 2014 for Appln. No. 2014-005694. | 1 | < 0.1% |
| Other values (1859) | 1859 | |
| (Missing) | 911 |
Length
| Value | Count | Frequency (%) |
| 22958 | 4.7% | |
| of | 12542 | 2.6% |
| et | 9434 | 1.9% |
| al | 9319 | 1.9% |
| no | 8707 | 1.8% |
| and | 8383 | 1.7% |
| for | 6060 | 1.3% |
| in | 5685 | 1.2% |
| | 5586 | 1.2% |
| pp | 5517 | 1.1% |
| Other values (66512) | 390450 |
Most occurring characters
| Value | Count | Frequency (%) |
| 507763 | 14.7% | |
| e | 209574 | 6.1% |
| a | 161733 | 4.7% |
| o | 159675 | 4.6% |
| i | 159202 | 4.6% |
| n | 157892 | 4.6% |
| t | 149781 | 4.3% |
| r | 119939 | 3.5% |
| . | 118705 | 3.4% |
| l | 100715 | 2.9% |
| Other values (116) | 1612703 |
Most occurring categories
| Value | Count | Frequency (%) |
| Lowercase Letter | 1832797 | |
| Space Separator | 507763 | 14.7% |
| Decimal Number | 432812 | 12.5% |
| Uppercase Letter | 326322 | 9.4% |
| Other Punctuation | 256332 | 7.4% |
| Dash Punctuation | 27882 | 0.8% |
| Control | 26338 | 0.8% |
| Math Symbol | 22938 | 0.7% |
| Open Punctuation | 12150 | 0.4% |
| Close Punctuation | 12146 | 0.4% |
| Other values (4) | 202 | < 0.1% |
Most frequent character per category
Lowercase Letter
| Value | Count | Frequency (%) |
| e | 209574 | |
| a | 161733 | 8.8% |
| o | 159675 | 8.7% |
| i | 159202 | 8.7% |
| n | 157892 | 8.6% |
| t | 149781 | 8.2% |
| r | 119939 | 6.5% |
| l | 100715 | 5.5% |
| s | 90719 | 4.9% |
| c | 82256 | 4.5% |
| Other values (33) | 441311 |
Uppercase Letter
| Value | Count | Frequency (%) |
| S | 32560 | 10.0% |
| A | 32152 | 9.9% |
| P | 23564 | 7.2% |
| C | 23548 | 7.2% |
| I | 23072 | 7.1% |
| D | 19047 | 5.8% |
| N | 19008 | 5.8% |
| O | 17568 | 5.4% |
| M | 17003 | 5.2% |
| E | 16464 | 5.0% |
| Other values (18) | 102336 |
Other Punctuation
| Value | Count | Frequency (%) |
| . | 118705 | |
| , | 90698 | |
| / | 21634 | 8.4% |
| : | 15729 | 6.1% |
| ; | 6513 | 2.5% |
| ' | 1058 | 0.4% |
| & | 833 | 0.3% |
| ? | 601 | 0.2% |
| # | 271 | 0.1% |
| % | 125 | < 0.1% |
| Other values (6) | 165 | 0.1% |
Decimal Number
| Value | Count | Frequency (%) |
| 0 | 92556 | |
| 1 | 86346 | |
| 2 | 64099 | |
| 9 | 34333 | 7.9% |
| 3 | 32434 | 7.5% |
| 4 | 26059 | 6.0% |
| 5 | 24945 | 5.8% |
| 6 | 24856 | 5.7% |
| 8 | 23879 | 5.5% |
| 7 | 23305 | 5.4% |
Control
| Value | Count | Frequency (%) |
| | 11778 | |
| | 11774 | |
| | 2425 | 9.2% |
| | 92 | 0.3% |
| | 91 | 0.3% |
| | 91 | 0.3% |
| | 76 | 0.3% |
| | 11 | < 0.1% |
Math Symbol
| Value | Count | Frequency (%) |
| | | 21489 | |
| > | 473 | 2.1% |
| < | 470 | 2.0% |
| = | 339 | 1.5% |
| + | 156 | 0.7% |
| × | 11 | < 0.1% |
Open Punctuation
| Value | Count | Frequency (%) |
| ( | 11774 | |
| [ | 356 | 2.9% |
| { | 20 | 0.2% |
Close Punctuation
| Value | Count | Frequency (%) |
| ) | 11772 | |
| ] | 352 | 2.9% |
| } | 22 | 0.2% |
Other Symbol
| Value | Count | Frequency (%) |
| ® | 109 | |
| © | 67 | |
| ° | 14 | 7.4% |
Modifier Symbol
| Value | Count | Frequency (%) |
| ^ | 1 | |
| ´ | 1 |
Space Separator
| Value | Count | Frequency (%) |
| 507763 |
Dash Punctuation
| Value | Count | Frequency (%) |
| - | 27882 |
Currency Symbol
| Value | Count | Frequency (%) |
| $ | 6 |
Connector Punctuation
| Value | Count | Frequency (%) |
| _ | 4 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Latin | 2159119 | |
| Common | 1298563 |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| e | 209574 | 9.7% |
| a | 161733 | 7.5% |
| o | 159675 | 7.4% |
| i | 159202 | 7.4% |
| n | 157892 | 7.3% |
| t | 149781 | 6.9% |
| r | 119939 | 5.6% |
| l | 100715 | 4.7% |
| s | 90719 | 4.2% |
| c | 82256 | 3.8% |
| Other values (61) | 767633 |
Common
| Value | Count | Frequency (%) |
| 507763 | ||
| . | 118705 | 9.1% |
| 0 | 92556 | 7.1% |
| , | 90698 | 7.0% |
| 1 | 86346 | 6.6% |
| 2 | 64099 | 4.9% |
| 9 | 34333 | 2.6% |
| 3 | 32434 | 2.5% |
| - | 27882 | 2.1% |
| 4 | 26059 | 2.0% |
| Other values (45) | 217688 |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 3430928 | |
| None | 26754 | 0.8% |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 507763 | 14.8% | |
| e | 209574 | 6.1% |
| a | 161733 | 4.7% |
| o | 159675 | 4.7% |
| i | 159202 | 4.6% |
| n | 157892 | 4.6% |
| t | 149781 | 4.4% |
| r | 119939 | 3.5% |
| . | 118705 | 3.5% |
| l | 100715 | 2.9% |
| Other values (81) | 1585949 |
None
| Value | Count | Frequency (%) |
| | 11778 | |
| | 11774 | |
| | 2425 | 9.1% |
| ® | 109 | 0.4% |
| | 92 | 0.3% |
| | 91 | 0.3% |
| | 91 | 0.3% |
| | 76 | 0.3% |
| © | 67 | 0.3% |
| é | 61 | 0.2% |
| Other values (25) | 190 | 0.7% |
Count of Cited Refs - Non-patent
Real number (ℝ)
| Distinct | 120 |
|---|---|
| Distinct (%) | 4.3% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Infinite | 0 |
| Infinite (%) | 0.0% |
| Mean | 9.6271552 |
| Minimum | 0 |
|---|---|
| Maximum | 1180 |
| Zeros | 911 |
| Zeros (%) | 32.7% |
| Negative | 0 |
| Negative (%) | 0.0% |
| Memory size | 21.9 KiB |
Quantile statistics
| Minimum | 0 |
|---|---|
| 5-th percentile | 0 |
| Q1 | 0 |
| median | 2 |
| Q3 | 5 |
| 95-th percentile | 38.85 |
| Maximum | 1180 |
| Range | 1180 |
| Interquartile range (IQR) | 5 |
Descriptive statistics
| Standard deviation | 41.288156 |
|---|---|
| Coefficient of variation (CV) | 4.2887182 |
| Kurtosis | 327.04155 |
| Mean | 9.6271552 |
| Median Absolute Deviation (MAD) | 2 |
| Skewness | 15.138009 |
| Sum | 26802 |
| Variance | 1704.7118 |
| Monotonicity | Not monotonic |
| Value | Count | Frequency (%) |
| 0 | 911 | |
| 1 | 429 | |
| 2 | 315 | 11.3% |
| 3 | 203 | 7.3% |
| 4 | 152 | 5.5% |
| 5 | 98 | 3.5% |
| 6 | 76 | 2.7% |
| 7 | 60 | 2.2% |
| 8 | 48 | 1.7% |
| 9 | 42 | 1.5% |
| Other values (110) | 450 |
| Value | Count | Frequency (%) |
| 0 | 911 | |
| 1 | 429 | |
| 2 | 315 | 11.3% |
| 3 | 203 | 7.3% |
| 4 | 152 | 5.5% |
| 5 | 98 | 3.5% |
| 6 | 76 | 2.7% |
| 7 | 60 | 2.2% |
| 8 | 48 | 1.7% |
| 9 | 42 | 1.5% |
| Value | Count | Frequency (%) |
| 1180 | 1 | |
| 814 | 1 | |
| 622 | 1 | |
| 543 | 1 | |
| 477 | 1 | |
| 402 | 1 | |
| 385 | 1 | |
| 360 | 1 | |
| 333 | 1 | |
| 294 | 1 |
Citing Patents
Categorical
HIGH CARDINALITY  MISSING  UNIFORM 
| Distinct | 2039 |
|---|---|
| Distinct (%) | 99.8% |
| Missing | 741 |
| Missing (%) | 26.6% |
| Memory size | 476.5 KiB |
| US10478364B2 | US9951904B2 | 3 |
|---|---|
| US20120319729A1 | 2 |
| US11174288B2 | 2 |
| US10107982B2 | US20180143392A1 | 1 |
| US11561732B2 | US20220011975A1 | 1 |
| Other values (2034) |
Length
| Max length | 15517 |
|---|---|
| Median length | 1353 |
| Mean length | 170.14097 |
| Min length | 10 |
Characters and Unicode
| Total characters | 347598 |
|---|---|
| Distinct characters | 34 |
| Distinct categories | 4 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 2036 ? |
|---|---|
| Unique (%) | 99.7% |
Sample
| 1st row | US20160128536A1 | US20160128537A1 | US9549651B2 | US9549652B2 | USD806333S1 |
|---|---|
| 2nd row | US10167079B2 | US10308355B2 | US10400851B2 | US10443674B2 | US10443675B2 | US10527123B2 | US10543910B2 | US10619698B2 | US10654565B2 | US10717521B2 | US10822076B2 | US10974822B2 | US11021241B2 | US11040770B2 | US11396369B2 | US11440650B2 | US11472540B2 | US11555528B2 | US20160325828A1 | US9212559B2 | WO2018187178A1 | WO2019005249A1 | WO2019005250A1 |
| 3rd row | US10561613B2 | US20160243039A1 | WO2022047047A1 |
| 4th row | US11020465B2 |
| 5th row | US20150381359A1 | US9467287B2 |
Common Values
| Value | Count | Frequency (%) |
| US10478364B2 | US9951904B2 | 3 | 0.1% |
| US20120319729A1 | 2 | 0.1% |
| US11174288B2 | 2 | 0.1% |
| US10107982B2 | US20180143392A1 | 1 | < 0.1% |
| US11561732B2 | US20220011975A1 | 1 | < 0.1% |
| CN108891449A | CN109978219A | CN109978219B | FR3123863A1 | US10346784B1 | US10443511B2 | US10745038B2 | US10882399B2 | US10919409B2 | US10928217B2 | US11005720B2 | US11008950B2 | US11084377B2 | US11180025B2 | US11186173B2 | US11186174B2 | US11186175B2 | US11207980B2 | US11207981B2 | US11214144B2 | US11220179B2 | US11225144B2 | US11230190B2 | US11247564B2 | US11254211B2 | US11267338B2 | US11267339B2 | US11279233B2 | US11279234B2 | US11285810B2 | US11325468B2 | US11345236B2 | US11351863B2 | US11370302B2 | US11390165B2 | US20140257748A1 | US20150120101A1 | US20150149003A1 | US20150151740A1 | US20160044364A1 | US20190055890A1 | US20190144023A1 | US9354034B2 | US9457820B2 | US9462319B2 | US9555800B2 | US9676403B2 | 1 | < 0.1% |
| US9207599B2 | 1 | < 0.1% |
| US10070879B2 | US10143482B2 | US10208410B2 | US10238482B2 | US10376275B2 | US10456236B2 | US10512479B2 | US10568755B2 | US10695539B2 | US11471175B2 | US11490913B2 | US11510691B2 | US9307998B2 | US9314326B2 | US9730822B2 | US9744062B2 | US9844386B2 | US9913744B2 | US9999493B2 | 1 | < 0.1% |
| US10700571B2 | US11183901B2 | 1 | < 0.1% |
| DE102018205736A1 | DE102018205736B4 | FR3075111A1 | US10450939B2 | US10704456B2 | US10752263B2 | US20140318735A1 | US20160016617A1 | US20190039630A1 | US9592780B2 | US9694858B2 | US9897121B1 | US9988969B2 | 1 | < 0.1% |
| Other values (2029) | 2029 | |
| (Missing) | 741 | 26.6% |
Length
| Value | Count | Frequency (%) |
| 21236 | ||
| us11291447b2 | 5 | < 0.1% |
| us11246618b2 | 5 | < 0.1% |
| us11266405b2 | 5 | < 0.1% |
| us11259805b2 | 5 | < 0.1% |
| us11259803b2 | 5 | < 0.1% |
| us11259799b2 | 5 | < 0.1% |
| us11253256b2 | 5 | < 0.1% |
| us11253254b2 | 5 | < 0.1% |
| us11246678b2 | 5 | < 0.1% |
| Other values (19834) | 23234 |
Most occurring characters
| Value | Count | Frequency (%) |
| 1 | 43832 | |
| 42472 | ||
| 2 | 36262 | |
| 0 | 29476 | 8.5% |
| S | 22553 | 6.5% |
| U | 21963 | 6.3% |
| | | 21236 | 6.1% |
| B | 18683 | 5.4% |
| 9 | 17915 | 5.2% |
| 3 | 14940 | 4.3% |
| Other values (24) | 78266 |
Most occurring categories
| Value | Count | Frequency (%) |
| Decimal Number | 213323 | |
| Uppercase Letter | 70567 | 20.3% |
| Space Separator | 42472 | 12.2% |
| Math Symbol | 21236 | 6.1% |
Most frequent character per category
Uppercase Letter
| Value | Count | Frequency (%) |
| S | 22553 | |
| U | 21963 | |
| B | 18683 | |
| A | 3926 | 5.6% |
| D | 683 | 1.0% |
| C | 495 | 0.7% |
| W | 493 | 0.7% |
| N | 472 | 0.7% |
| O | 456 | 0.6% |
| E | 271 | 0.4% |
| Other values (12) | 572 | 0.8% |
Decimal Number
| Value | Count | Frequency (%) |
| 1 | 43832 | |
| 2 | 36262 | |
| 0 | 29476 | |
| 9 | 17915 | |
| 3 | 14940 | 7.0% |
| 5 | 14589 | 6.8% |
| 8 | 14275 | 6.7% |
| 4 | 14260 | 6.7% |
| 6 | 14133 | 6.6% |
| 7 | 13641 | 6.4% |
Space Separator
| Value | Count | Frequency (%) |
| 42472 |
Math Symbol
| Value | Count | Frequency (%) |
| | | 21236 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Common | 277031 | |
| Latin | 70567 | 20.3% |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| S | 22553 | |
| U | 21963 | |
| B | 18683 | |
| A | 3926 | 5.6% |
| D | 683 | 1.0% |
| C | 495 | 0.7% |
| W | 493 | 0.7% |
| N | 472 | 0.7% |
| O | 456 | 0.6% |
| E | 271 | 0.4% |
| Other values (12) | 572 | 0.8% |
Common
| Value | Count | Frequency (%) |
| 1 | 43832 | |
| 42472 | ||
| 2 | 36262 | |
| 0 | 29476 | |
| | | 21236 | |
| 9 | 17915 | |
| 3 | 14940 | 5.4% |
| 5 | 14589 | 5.3% |
| 8 | 14275 | 5.2% |
| 4 | 14260 | 5.1% |
| Other values (2) | 27774 |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 347598 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 1 | 43832 | |
| 42472 | ||
| 2 | 36262 | |
| 0 | 29476 | 8.5% |
| S | 22553 | 6.5% |
| U | 21963 | 6.3% |
| | | 21236 | 6.1% |
| B | 18683 | 5.4% |
| 9 | 17915 | 5.2% |
| 3 | 14940 | 4.3% |
| Other values (24) | 78266 |
Count of Citing Patents
Real number (ℝ)
| Distinct | 94 |
|---|---|
| Distinct (%) | 3.4% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Infinite | 0 |
| Infinite (%) | 0.0% |
| Mean | 8.3617098 |
| Minimum | 0 |
|---|---|
| Maximum | 1050 |
| Zeros | 741 |
| Zeros (%) | 26.6% |
| Negative | 0 |
| Negative (%) | 0.0% |
| Memory size | 21.9 KiB |
Quantile statistics
| Minimum | 0 |
|---|---|
| 5-th percentile | 0 |
| Q1 | 0 |
| median | 2 |
| Q3 | 7 |
| 95-th percentile | 28 |
| Maximum | 1050 |
| Range | 1050 |
| Interquartile range (IQR) | 7 |
Descriptive statistics
| Standard deviation | 37.604638 |
|---|---|
| Coefficient of variation (CV) | 4.4972427 |
| Kurtosis | 438.76683 |
| Mean | 8.3617098 |
| Median Absolute Deviation (MAD) | 2 |
| Skewness | 19.09216 |
| Sum | 23279 |
| Variance | 1414.1088 |
| Monotonicity | Not monotonic |
| Value | Count | Frequency (%) |
| 0 | 741 | |
| 2 | 368 | |
| 1 | 295 | 10.6% |
| 3 | 202 | 7.3% |
| 4 | 190 | 6.8% |
| 5 | 127 | 4.6% |
| 6 | 117 | 4.2% |
| 8 | 81 | 2.9% |
| 7 | 78 | 2.8% |
| 9 | 74 | 2.7% |
| Other values (84) | 511 |
| Value | Count | Frequency (%) |
| 0 | 741 | |
| 1 | 295 | 10.6% |
| 2 | 368 | |
| 3 | 202 | 7.3% |
| 4 | 190 | 6.8% |
| 5 | 127 | 4.6% |
| 6 | 117 | 4.2% |
| 7 | 78 | 2.8% |
| 8 | 81 | 2.9% |
| 9 | 74 | 2.7% |
| Value | Count | Frequency (%) |
| 1050 | 1 | |
| 866 | 1 | |
| 840 | 1 | |
| 678 | 1 | |
| 380 | 1 | |
| 376 | 1 | |
| 331 | 1 | |
| 207 | 1 | |
| 185 | 2 | |
| 184 | 1 |
INPADOC Legal Status
Categorical
HIGH CARDINALITY  UNIFORM 
| Distinct | 2680 |
|---|---|
| Distinct (%) | 96.3% |
| Missing | 1 |
| Missing (%) | < 0.1% |
| Memory size | 2.8 MiB |
| 2019-02-26 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - 2018-12-30 | 2019-02-04 STCH INFORMATION ON STATUS: PATENT DISCONTINUATION - PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362 | 2019-02-04 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY | 2018-08-13 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY | 30 |
|---|---|
| 2019-02-26 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - 2018-12-30 | 2019-02-04 STCH INFORMATION ON STATUS: PATENT DISCONTINUATION - PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362 | 2019-02-04 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | 2018-08-13 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | 14 |
| 2022-06-30 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 8TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1552); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY FEE PAYMENT YEAR 8 | 2018-07-02 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) FEE PAYMENT YEAR 4 | 2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE | 12 |
| 2022-06-15 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 8TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1552); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY FEE PAYMENT YEAR 8 | 2018-06-14 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) FEE PAYMENT YEAR 4 | 2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE | 12 |
| 2019-02-26 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - 2018-12-30 | 2019-02-04 STCH INFORMATION ON STATUS: PATENT DISCONTINUATION - PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362 | 2019-02-04 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: MICROENTITY | 2018-08-13 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: MICROENTITY | 10 |
| Other values (2675) |
Length
| Max length | 21095 |
|---|---|
| Median length | 1770 |
| Mean length | 987.33309 |
| Min length | 311 |
Characters and Unicode
| Total characters | 2747748 |
|---|---|
| Distinct characters | 67 |
| Distinct categories | 10 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 2656 ? |
|---|---|
| Unique (%) | 95.4% |
Sample
| 1st row | 2022-06-30 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 8TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1552); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY FEE PAYMENT YEAR 8 | 2020-04-03 AS ASSIGNMENT COMPASS CAYMAN SPV 2 LIMITED, MASSACHUSETTS RELEASE BY SECURED PARTY;ASSIGNOR:JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT;REEL/FRAME:052311/0585 2020-04-02 | 2020-04-03 AS ASSIGNMENT COMPASS CAYMAN SPV, LTD., MASSACHUSETTS RELEASE BY SECURED PARTY;ASSIGNOR:JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT;REEL/FRAME:052311/0585 2020-04-02 | 2020-04-03 AS ASSIGNMENT EP MIDCO LLC, MASSACHUSETTS RELEASE BY SECURED PARTY;ASSIGNOR:JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT;REEL/FRAME:052311/0585 2020-04-02 | 2020-04-03 AS ASSIGNMENT EURO-PRO HOLDCO, LLC, MASSACHUSETTS RELEASE BY SECURED PARTY;ASSIGNOR:JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT;REEL/FRAME:052311/0585 2020-04-02 | 2020-04-03 AS ASSIGNMENT GLOBAL APPLIANCE INC., MASSACHUSETTS RELEASE BY SECURED PARTY;ASSIGNOR:JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT;REEL/FRAME:052311/0585 2020-04-02 | 2020-04-03 AS ASSIGNMENT GLOBAL APPLIANCE UK HOLDCO LIMITED, MASSACHUSETTS RELEASE BY SECURED PARTY;ASSIGNOR:JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT;REEL/FRAME:052311/0585 2020-04-02 | 2020-04-03 AS ASSIGNMENT SHARKNINJA MANAGEMENT COMPANY, MASSACHUSETTS RELEASE BY SECURED PARTY;ASSIGNOR:JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT;REEL/FRAME:052311/0585 2020-04-02 | 2020-04-03 AS ASSIGNMENT SHARKNINJA OPERATING LLC, MASSACHUSETTS RELEASE BY SECURED PARTY;ASSIGNOR:JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT;REEL/FRAME:052311/0585 2020-04-02 | 2020-04-03 AS ASSIGNMENT SHARKNINJA SALES COMPANY, MASSACHUSETTS RELEASE BY SECURED PARTY;ASSIGNOR:JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT;REEL/FRAME:052311/0585 2020-04-02 | 2018-07-02 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) FEE PAYMENT YEAR 4 | 2017-10-13 AS ASSIGNMENT SHARKNINJA OPERATING LLC, MASSACHUSETTS RELEASE BY SECURED PARTY;ASSIGNOR:BANK OF AMERICA, N.A.;REEL/FRAME:044207/0652 2017-09-29 | 2017-10-03 AS ASSIGNMENT JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT SECURITY INTEREST;ASSIGNORS:GLOBAL APPLIANCE INC.;SHARKNINJA OPERATING LLC;SHARKNINJA MANAGEMENT COMPANY;AND OTHERS;REEL/FRAME:044321/0885 2017-09-29 | 2017-10-03 AS ASSIGNMENT JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT, NEW YORK SECURITY INTEREST;ASSIGNORS:GLOBAL APPLIANCE INC.;SHARKNINJA OPERATING LLC;SHARKNINJA MANAGEMENT COMPANY;AND OTHERS;REEL/FRAME:044321/0885 2017-09-29 | 2015-11-17 AS ASSIGNMENT BANK OF AMERICA, N.A., AS AGENT, MASSACHUSETTS FOURTH SUPPLEMENT TO PATENT SECURITY AGREEMENT;ASSIGNOR:SHARKNINJA OPERATING LLC;REEL/FRAME:037124/0386 2015-08-25 | 2015-08-12 AS ASSIGNMENT SHARKNINJA OPERATING LLC, MASSACHUSETTS CHANGE OF NAME;ASSIGNOR:EURO-PRO OPERATING LLC;REEL/FRAME:036333/0287 2015-07-13 | 2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE | 2012-11-16 AS ASSIGNMENT EURO-PRO OPERATING, LLC, MASSACHUSETTS ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:BREIT, OLIVER RUDOLPH;REEL/FRAME:029309/0231 2010-02-22 |
|---|---|
| 2nd row | 2022-06-30 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 8TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1552); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY FEE PAYMENT YEAR 8 | 2018-07-02 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) FEE PAYMENT YEAR 4 | 2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE |
| 3rd row | 2019-02-26 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - 2018-12-30 | 2019-02-04 STCH INFORMATION ON STATUS: PATENT DISCONTINUATION - PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362 | 2019-02-04 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | 2018-08-13 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY |
| 4th row | 2023-02-28 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - 2022-12-30 | 2023-02-06 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | 2022-08-22 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | 2018-06-22 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) FEE PAYMENT YEAR 4 | 2016-08-02 AS ASSIGNMENT OXFORD UNIVERSITY INNOVATION LIMITED, GREAT BRITAI CHANGE OF NAME;ASSIGNOR:ISIS INNOVATION LIMITED;REEL/FRAME:039550/0045 2016-06-16 | 2016-08-02 AS ASSIGNMENT OXFORD UNIVERSITY INNOVATION LIMITED, GREAT BRITAIN CHANGE OF NAME;ASSIGNOR:ISIS INNOVATION LIMITED;REEL/FRAME:039550/0045 2016-06-16 | 2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE | 2012-10-23 AS ASSIGNMENT ISIS INNOVATION LIMITED, UNITED KINGDOM ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:WALDMANN, HERMAN;FAIRCHILD, PAUL;GARDNER, RICHARD;AND OTHERS;SIGNING DATES FROM 19981130 TO 19981204;REEL/FRAME:029175/0237 |
| 5th row | 2021-11-04 AS ASSIGNMENT REDWOOD TECHNOLOGIES, LLC, TEXAS ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:WI-FI ONE, LLC;REEL/FRAME:058026/0232 2021-11-03 | 2021-11-03 AS ASSIGNMENT WI-FI ONE, LLC, TEXAS RELEASE BY SECURED PARTY;ASSIGNOR:CORTLAND CAPITAL MARKET SERVICES LLC;REEL/FRAME:058014/0725 2021-11-03 | 2019-02-26 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - 2018-12-30 | 2019-02-04 STCH INFORMATION ON STATUS: PATENT DISCONTINUATION - PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362 | 2019-02-04 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | 2018-08-13 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | 2018-05-23 AS ASSIGNMENT CORTLAND CAPITAL MARKET SERVICES LLC, AS COLLATERA INTELLECTUAL PROPERTY SECURITY AGREEMENT;ASSIGNOR:WI-FI ONE, LLC;REEL/FRAME:046222/0786 2018-05-21 | 2018-04-06 AS ASSIGNMENT WI-FI ONE, LLC, TEXAS ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:SONY CORPORATION;REEL/FRAME:045853/0047 2018-01-26 |
Common Values
| Value | Count | Frequency (%) |
| 2019-02-26 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - 2018-12-30 | 2019-02-04 STCH INFORMATION ON STATUS: PATENT DISCONTINUATION - PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362 | 2019-02-04 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY | 2018-08-13 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY | 30 | 1.1% |
| 2019-02-26 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - 2018-12-30 | 2019-02-04 STCH INFORMATION ON STATUS: PATENT DISCONTINUATION - PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362 | 2019-02-04 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | 2018-08-13 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | 14 | 0.5% |
| 2022-06-30 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 8TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1552); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY FEE PAYMENT YEAR 8 | 2018-07-02 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) FEE PAYMENT YEAR 4 | 2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE | 12 | 0.4% |
| 2022-06-15 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 8TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1552); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY FEE PAYMENT YEAR 8 | 2018-06-14 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) FEE PAYMENT YEAR 4 | 2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE | 12 | 0.4% |
| 2019-02-26 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - 2018-12-30 | 2019-02-04 STCH INFORMATION ON STATUS: PATENT DISCONTINUATION - PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362 | 2019-02-04 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: MICROENTITY | 2018-08-13 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: MICROENTITY | 10 | 0.4% |
| 2022-06-30 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 8TH YR, SMALL ENTITY (ORIGINAL EVENT CODE: M2552); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY FEE PAYMENT YEAR 8 | 2018-07-02 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YR, SMALL ENTITY (ORIGINAL EVENT CODE: M2551) FEE PAYMENT YEAR 4 | 2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE | 5 | 0.2% |
| 2022-05-19 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 8TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1552); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY FEE PAYMENT YEAR 8 | 2018-05-22 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) FEE PAYMENT YEAR 4 | 2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE | 4 | 0.1% |
| 2023-02-28 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - 2022-12-30 | 2023-02-06 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | 2022-08-22 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | 2018-06-19 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) FEE PAYMENT YEAR 4 | 2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE | 3 | 0.1% |
| 2022-06-21 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 8TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1552); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY FEE PAYMENT YEAR 8 | 2019-11-12 AS ASSIGNMENT MICRON SEMICONDUCTOR PRODUCTS, INC., IDAHO RELEASE BY SECURED PARTY;ASSIGNOR:JPMORGAN CHASE BANK, N.A., AS COLLATERAL AGENT;REEL/FRAME:051028/0001 2019-07-31 | 2019-11-12 AS ASSIGNMENT MICRON TECHNOLOGY, INC., IDAHO RELEASE BY SECURED PARTY;ASSIGNOR:JPMORGAN CHASE BANK, N.A., AS COLLATERAL AGENT;REEL/FRAME:051028/0001 2019-07-31 | 2019-10-09 AS ASSIGNMENT MICRON TECHNOLOGY, INC., IDAHO RELEASE BY SECURED PARTY;ASSIGNOR:MORGAN STANLEY SENIOR FUNDING, INC., AS COLLATERAL AGENT;REEL/FRAME:050937/0001 2019-07-31 | 2018-08-23 AS ASSIGNMENT MICRON TECHNOLOGY, INC., IDAHO RELEASE BY SECURED PARTY;ASSIGNOR:U.S. BANK NATIONAL ASSOCIATION, AS COLLATERAL AGENT;REEL/FRAME:047243/0001 2018-06-29 | 2018-07-13 AS ASSIGNMENT JPMORGAN CHASE BANK, N.A., AS COLLATERAL AGENT, IL SECURITY INTEREST;ASSIGNORS:MICRON TECHNOLOGY, INC.;MICRON SEMICONDUCTOR PRODUCTS, INC.;REEL/FRAME:047540/0001 2018-07-03 | 2018-07-13 AS ASSIGNMENT JPMORGAN CHASE BANK, N.A., AS COLLATERAL AGENT, ILLINOIS SECURITY INTEREST;ASSIGNORS:MICRON TECHNOLOGY, INC.;MICRON SEMICONDUCTOR PRODUCTS, INC.;REEL/FRAME:047540/0001 2018-07-03 | 2018-06-14 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) FEE PAYMENT YEAR 4 | 2017-06-08 AS ASSIGNMENT U.S. BANK NATIONAL ASSOCIATION, AS COLLATERAL AGEN CORRECTIVE ASSIGNMENT TO CORRECT THE REPLACE ERRONEOUSLY FILED PATENT #7358718 WITH THE CORRECT PATENT #7358178 PREVIOUSLY RECORDED ON REEL 038669 FRAME 0001. ASSIGNOR(S) HEREBY CONFIRMS THE SECURITY INTEREST;ASSIGNOR:MICRON TECHNOLOGY, INC.;REEL/FRAME:043079/0001 2016-04-26 | 2017-06-08 AS ASSIGNMENT U.S. BANK NATIONAL ASSOCIATION, AS COLLATERAL AGENT, CALIFORNIA CORRECTIVE ASSIGNMENT TO CORRECT THE REPLACE ERRONEOUSLY FILED PATENT #7358718 WITH THE CORRECT PATENT #7358178 PREVIOUSLY RECORDED ON REEL 038669 FRAME 0001. ASSIGNOR(S) HEREBY CONFIRMS THE SECURITY INTEREST;ASSIGNOR:MICRON TECHNOLOGY, INC.;REEL/FRAME:043079/0001 2016-04-26 | 2016-06-02 AS ASSIGNMENT MORGAN STANLEY SENIOR FUNDING, INC., AS COLLATERAL PATENT SECURITY AGREEMENT;ASSIGNOR:MICRON TECHNOLOGY, INC.;REEL/FRAME:038954/0001 2016-04-26 | 2016-06-02 AS ASSIGNMENT MORGAN STANLEY SENIOR FUNDING, INC., AS COLLATERAL AGENT, MARYLAND PATENT SECURITY AGREEMENT;ASSIGNOR:MICRON TECHNOLOGY, INC.;REEL/FRAME:038954/0001 2016-04-26 | 2016-05-12 AS ASSIGNMENT U.S. BANK NATIONAL ASSOCIATION, AS COLLATERAL AGEN SECURITY INTEREST;ASSIGNOR:MICRON TECHNOLOGY, INC.;REEL/FRAME:038669/0001 2016-04-26 | 2016-05-12 AS ASSIGNMENT U.S. BANK NATIONAL ASSOCIATION, AS COLLATERAL AGENT, CALIFORNIA SECURITY INTEREST;ASSIGNOR:MICRON TECHNOLOGY, INC.;REEL/FRAME:038669/0001 2016-04-26 | 2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE | 3 | 0.1% |
| 2023-02-28 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - 2022-12-30 | 2023-02-06 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY | 2022-08-22 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY | 2018-07-02 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YR, SMALL ENTITY (ORIGINAL EVENT CODE: M2551) FEE PAYMENT YEAR 4 | 2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE | 3 | 0.1% |
| Other values (2670) | 2687 |
Length
| Value | Count | Frequency (%) |
| 21980 | 6.2% | |
| fee | 16101 | 4.6% |
| of | 15283 | 4.3% |
| payment | 14069 | 4.0% |
| maintenance | 12952 | 3.7% |
| entity | 12737 | 3.6% |
| assignment | 11105 | 3.1% |
| patent | 8837 | 2.5% |
| as | 8620 | 2.4% |
| year | 7711 | 2.2% |
| Other values (21618) | 223828 |
Most occurring characters
| Value | Count | Frequency (%) |
| 365567 | 13.3% | |
| E | 265099 | 9.6% |
| A | 198778 | 7.2% |
| N | 196572 | 7.2% |
| T | 174699 | 6.4% |
| S | 126991 | 4.6% |
| I | 124599 | 4.5% |
| R | 117169 | 4.3% |
| O | 102381 | 3.7% |
| 0 | 87734 | 3.2% |
| Other values (57) | 988159 |
Most occurring categories
| Value | Count | Frequency (%) |
| Uppercase Letter | 1856444 | |
| Space Separator | 365567 | 13.3% |
| Decimal Number | 326181 | 11.9% |
| Other Punctuation | 111570 | 4.1% |
| Dash Punctuation | 53242 | 1.9% |
| Math Symbol | 19270 | 0.7% |
| Open Punctuation | 7682 | 0.3% |
| Close Punctuation | 7667 | 0.3% |
| Lowercase Letter | 124 | < 0.1% |
| Modifier Symbol | 1 | < 0.1% |
Most frequent character per category
Uppercase Letter
| Value | Count | Frequency (%) |
| E | 265099 | |
| A | 198778 | |
| N | 196572 | |
| T | 174699 | |
| S | 126991 | 6.8% |
| I | 124599 | 6.7% |
| R | 117169 | 6.3% |
| O | 102381 | 5.5% |
| M | 79901 | 4.3% |
| F | 65052 | 3.5% |
| Other values (16) | 405203 |
Other Punctuation
| Value | Count | Frequency (%) |
| , | 29402 | |
| : | 28085 | |
| ; | 25060 | |
| / | 15141 | |
| . | 13416 | |
| & | 272 | 0.2% |
| ' | 84 | 0.1% |
| " | 59 | 0.1% |
| # | 34 | < 0.1% |
| % | 8 | < 0.1% |
| Other values (2) | 9 | < 0.1% |
Lowercase Letter
| Value | Count | Frequency (%) |
| e | 29 | |
| t | 17 | |
| i | 16 | |
| r | 12 | |
| n | 11 | 8.9% |
| h | 6 | 4.8% |
| f | 6 | 4.8% |
| c | 6 | 4.8% |
| o | 6 | 4.8% |
| l | 5 | 4.0% |
| Other values (2) | 10 | 8.1% |
Decimal Number
| Value | Count | Frequency (%) |
| 0 | 87734 | |
| 2 | 70957 | |
| 1 | 57374 | |
| 5 | 20557 | 6.3% |
| 4 | 19716 | 6.0% |
| 8 | 18251 | 5.6% |
| 3 | 16810 | 5.2% |
| 6 | 13470 | 4.1% |
| 9 | 11405 | 3.5% |
| 7 | 9907 | 3.0% |
Math Symbol
| Value | Count | Frequency (%) |
| | | 15052 | |
| + | 4218 | 21.9% |
Space Separator
| Value | Count | Frequency (%) |
| 365567 |
Dash Punctuation
| Value | Count | Frequency (%) |
| - | 53242 |
Open Punctuation
| Value | Count | Frequency (%) |
| ( | 7682 |
Close Punctuation
| Value | Count | Frequency (%) |
| ) | 7667 |
Modifier Symbol
| Value | Count | Frequency (%) |
| ` | 1 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Latin | 1856568 | |
| Common | 891180 |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| E | 265099 | |
| A | 198778 | |
| N | 196572 | |
| T | 174699 | |
| S | 126991 | 6.8% |
| I | 124599 | 6.7% |
| R | 117169 | 6.3% |
| O | 102381 | 5.5% |
| M | 79901 | 4.3% |
| F | 65052 | 3.5% |
| Other values (28) | 405327 |
Common
| Value | Count | Frequency (%) |
| 365567 | ||
| 0 | 87734 | 9.8% |
| 2 | 70957 | 8.0% |
| 1 | 57374 | 6.4% |
| - | 53242 | 6.0% |
| , | 29402 | 3.3% |
| : | 28085 | 3.2% |
| ; | 25060 | 2.8% |
| 5 | 20557 | 2.3% |
| 4 | 19716 | 2.2% |
| Other values (19) | 133486 | 15.0% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 2747748 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 365567 | 13.3% | |
| E | 265099 | 9.6% |
| A | 198778 | 7.2% |
| N | 196572 | 7.2% |
| T | 174699 | 6.4% |
| S | 126991 | 4.6% |
| I | 124599 | 4.5% |
| R | 117169 | 4.3% |
| O | 102381 | 3.7% |
| 0 | 87734 | 3.2% |
| Other values (57) | 988159 |
INPADOC Family Members
Categorical
HIGH CARDINALITY  UNIFORM  UNIQUE 
| Distinct | 2784 |
|---|---|
| Distinct (%) | 100.0% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 811.6 KiB |
| US8919357B2 | CN102029266A | CN102029266B | CN201625643U | JP03160354U | US20110073135A1 | US20130160803A1 | WO2011037744A2 | WO2011037744A3 | 1 |
|---|---|
| US8921157B2 | CN102695373A | CN102695373B | JP05662855B2 | JP2012204570A | KR1391346B1 | KR2012108938A | US20120244666A1 | 1 |
| US8919110B2 | BR112012015467A2 | BR112012015467B1 | BRPI1013395A2 | BRPI1013395B1 | BRPI1013401A2 | BRPI1013401B1 | CN102333579A | CN102413906A | CN102762283A | CN105642116A | CN105642116B | CN105909349A | CN107654273A | CN110030064A | CN110043350A | DE102010002425A1 | DE102010002425B4 | DE102010056223A1 | DE202010018079U1 | DE202010018081U1 | EP2401056A1 | EP2401056B1 | EP2401059A1 | EP2401059B1 | EP2516044A1 | EP2516044B1 | EP2589427A2 | EP2589427A3 | EP2589427B1 | EP2750783A1 | EP3320964A1 | EP3372301A1 | EP3777998A1 | GB200903262D0 | GB200922612D0 | GB201003244D0 | GB201014027D0 | GB201021957D0 | GB201118038D0 | GB201204258D0 | GB201301760D0 | GB201301761D0 | GB201301893D0 | GB2468210A | GB2468210B | GB2476585A | GB2476585B | GB2485260A | GB2485260B | GB2487850A | GB2487850B | GB2497440A | GB2497440B | GB2497441A | GB2497441B | GB2497442A | GB2497442B | JP05717654B2 | JP05876727B2 | JP06687666B2 | JP2012518537A | JP2012518753A | JP2013515902A | JP2017006904A | JP2018159380A | KR1718574B1 | KR1833549B1 | KR1899919B1 | KR1945677B1 | KR2011119748A | KR2011127225A | KR2012113234A | KR2018021243A | KR2018104189A | KR2072505B1 | RU2011139081A | RU2011139134A | RU2012131517A | RU2527462C2 | RU2529532C2 | RU2548997C2 | US20100239478A1 | US20110158871A1 | US20120097033A1 | US20120107203A1 | US20130330259A1 | US20140186228A1 | US20150093300A1 | US20160193594A1 | US20180361364A1 | US8012439B2 | US8211393B2 | US8512657B2 | US8608820B2 | US9261004B2 | US9415344B2 | WO2010097634A1 | WO2010097638A1 | WO2011077168A1 | WO2013030584A1 | 1 |
| US8920467B2 | CN102791226A | CN102791226B | EP2572685A1 | EP2572685A4 | EP2572685B1 | HK1175390A1 | JP05462280B2 | JP2012124175A1 | KR2013127561A | TW201236668A | TWI507186B | US20130030464A1 | WO2012124175A1 | 1 |
| US8922204B2 | DE102012204514A1 | DE102012204514B4 | JP2012202861A | US20120242330A1 | 1 |
| Other values (2779) |
Length
| Max length | 23210 |
|---|---|
| Median length | 1488 |
| Mean length | 241.48815 |
| Min length | 11 |
Characters and Unicode
| Total characters | 672303 |
|---|---|
| Distinct characters | 38 |
| Distinct categories | 4 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 2784 ? |
|---|---|
| Unique (%) | 100.0% |
Sample
| 1st row | US8919357B2 | CN102029266A | CN102029266B | CN201625643U | JP03160354U | US20110073135A1 | US20130160803A1 | WO2011037744A2 | WO2011037744A3 |
|---|---|
| 2nd row | US8920125B2 | US20090236468A1 | US20130164132A1 | US8403643B2 |
| 3rd row | US8920781B2 | AT256450T | AT355822T | AT526946T | AU199645456A | AU699131B | BG101858A | BR199607490A | BRPI9607490B8 | BRPI9612950B1 | BRPI9612950B8 | CA2211874A1 | CA2211874C | CN1179097A | CN1303974C | CZ199702443A3 | CZ294259B6 | DE69631119D1 | DE69631119T2 | DE69636961D1 | DE69636961T2 | DK1232745T3 | DK1666023T3 | DK806938T3 | EA20199700153A1 | EA352B1 | EE199700176A | EP1159955A1 | EP1232745A1 | EP1232745B1 | EP1666023A2 | EP1666023A3 | EP1666023B1 | EP2213279A2 | EP2213279A3 | EP2258342A2 | EP2258342A3 | EP806938A1 | EP806938B1 | ES2213172T3 | ES2278828T3 | ES2375007T3 | FI119676B | FI199703151A0 | FI199703151A | FI973151A0 | GB199501841D0 | GB199521937D0 | GEP199901687B | HK1084897A1 | HU199802209A2 | HU199802209A3 | HU229965B1 | IS4531A | JP04042867B2 | JP10513174A | KR1998701844A | KR500694B1 | MX199705847A | NO199703502A | NO199703502D0 | NO324037B1 | NZ300654A | PL186757B1 | PL321572A1 | PT1232745E | PT1666023E | PT806938E | SI1232745T1 | SI1666023T1 | SK199701036A3 | SK282630B6 | TR199700722T1 | UA61051C2 | US20030170183A1 | US20060029552A1 | US20100330188A1 | US6153224A | US6521260B1 | US7011818B2 | US7718163B2 | WO1996023485A1 | ZA199600721B |
| 4th row | US8921104B2 | AU200010584A | AU768267B2 | CA2350210A1 | CA2350210C | EP1127108A2 | GB199824306D0 | US20020019047A1 | US20020131962A1 | US20070269885A1 | US20090155898A1 | US20110014696A1 | US20130171627A1 | US7247480B2 | US7473556B2 | US7781213B2 | US8232100B2 | WO2000028000A2 | WO2000028000A3 |
| 5th row | US8923511B2 | CN100418317C | CN1190033C | CN1206272A | CN1632710A | DE69836450D1 | DE69836450T2 | EP1298517A1 | EP1298517B1 | EP1742137A1 | EP1742137B1 | EP1742138A1 | EP2385439A1 | EP2781985A1 | EP2781985B1 | EP2781986A1 | EP2781986B1 | EP2998820A1 | EP2998820B1 | EP875813A2 | EP875813A3 | EP875813B1 | HK1022060A1 | HK1080562A1 | ID20227A | JP10301492A | KR1998081634A | KR466474B1 | MY122244A | RU2239954C2 | TW379308B | US20030191956A1 | US20060140402A1 | US20070140484A1 | US20080013723A1 | US20100290619A1 | US20120257744A1 | US20130236009A1 | US20150381359A1 | US6256391B1 | US7233665B1 | US7242769B2 | US7298842B2 | US7860248B2 | US8170206B2 | US8594325B2 | US9467287B2 |
Common Values
| Value | Count | Frequency (%) |
| US8919357B2 | CN102029266A | CN102029266B | CN201625643U | JP03160354U | US20110073135A1 | US20130160803A1 | WO2011037744A2 | WO2011037744A3 | 1 | < 0.1% |
| US8921157B2 | CN102695373A | CN102695373B | JP05662855B2 | JP2012204570A | KR1391346B1 | KR2012108938A | US20120244666A1 | 1 | < 0.1% |
| US8919110B2 | BR112012015467A2 | BR112012015467B1 | BRPI1013395A2 | BRPI1013395B1 | BRPI1013401A2 | BRPI1013401B1 | CN102333579A | CN102413906A | CN102762283A | CN105642116A | CN105642116B | CN105909349A | CN107654273A | CN110030064A | CN110043350A | DE102010002425A1 | DE102010002425B4 | DE102010056223A1 | DE202010018079U1 | DE202010018081U1 | EP2401056A1 | EP2401056B1 | EP2401059A1 | EP2401059B1 | EP2516044A1 | EP2516044B1 | EP2589427A2 | EP2589427A3 | EP2589427B1 | EP2750783A1 | EP3320964A1 | EP3372301A1 | EP3777998A1 | GB200903262D0 | GB200922612D0 | GB201003244D0 | GB201014027D0 | GB201021957D0 | GB201118038D0 | GB201204258D0 | GB201301760D0 | GB201301761D0 | GB201301893D0 | GB2468210A | GB2468210B | GB2476585A | GB2476585B | GB2485260A | GB2485260B | GB2487850A | GB2487850B | GB2497440A | GB2497440B | GB2497441A | GB2497441B | GB2497442A | GB2497442B | JP05717654B2 | JP05876727B2 | JP06687666B2 | JP2012518537A | JP2012518753A | JP2013515902A | JP2017006904A | JP2018159380A | KR1718574B1 | KR1833549B1 | KR1899919B1 | KR1945677B1 | KR2011119748A | KR2011127225A | KR2012113234A | KR2018021243A | KR2018104189A | KR2072505B1 | RU2011139081A | RU2011139134A | RU2012131517A | RU2527462C2 | RU2529532C2 | RU2548997C2 | US20100239478A1 | US20110158871A1 | US20120097033A1 | US20120107203A1 | US20130330259A1 | US20140186228A1 | US20150093300A1 | US20160193594A1 | US20180361364A1 | US8012439B2 | US8211393B2 | US8512657B2 | US8608820B2 | US9261004B2 | US9415344B2 | WO2010097634A1 | WO2010097638A1 | WO2011077168A1 | WO2013030584A1 | 1 | < 0.1% |
| US8920467B2 | CN102791226A | CN102791226B | EP2572685A1 | EP2572685A4 | EP2572685B1 | HK1175390A1 | JP05462280B2 | JP2012124175A1 | KR2013127561A | TW201236668A | TWI507186B | US20130030464A1 | WO2012124175A1 | 1 | < 0.1% |
| US8922204B2 | DE102012204514A1 | DE102012204514B4 | JP2012202861A | US20120242330A1 | 1 | < 0.1% |
| US8923129B1 | US8274996B1 | US8363550B1 | US9356738B1 | 1 | < 0.1% |
| US8920967B2 | CN102832370A | CN102832370B | EP2535967A1 | EP2535967B1 | JP05987465B2 | JP2013020944A | KR2013004078A | US20120321943A1 | 1 | < 0.1% |
| US8923012B2 | EP2536263A2 | EP2536263A3 | EP2536263B1 | US20120320537A1 | US20150103453A1 | US9627884B2 | 1 | < 0.1% |
| US8923185B2 | EP2575389A1 | EP2575389B1 | FR2980938A1 | FR2980938B1 | SG188780A1 | US20130083716A1 | 1 | < 0.1% |
| US8922793B2 | CN102694938A | CN102694938B | JP2012203152A | US20120243017A1 | 1 | < 0.1% |
| Other values (2774) | 2774 |
Length
| Value | Count | Frequency (%) |
| 41018 | ||
| us9372539b2 | 3 | < 0.1% |
| us9207795b2 | 3 | < 0.1% |
| us9557915b2 | 3 | < 0.1% |
| us9552065b2 | 3 | < 0.1% |
| us9524025b2 | 3 | < 0.1% |
| us9495055b2 | 3 | < 0.1% |
| us9477308b2 | 3 | < 0.1% |
| us9448630b2 | 3 | < 0.1% |
| us9430074b2 | 3 | < 0.1% |
| Other values (41418) | 43775 |
Most occurring characters
| Value | Count | Frequency (%) |
| 82036 | ||
| 0 | 74928 | |
| 1 | 74530 | |
| 2 | 74151 | |
| | | 41018 | 6.1% |
| 3 | 31969 | 4.8% |
| A | 29868 | 4.4% |
| 9 | 29508 | 4.4% |
| 8 | 28723 | 4.3% |
| 5 | 27778 | 4.1% |
| Other values (28) | 177794 |
Most occurring categories
| Value | Count | Frequency (%) |
| Decimal Number | 416708 | |
| Uppercase Letter | 132541 | 19.7% |
| Space Separator | 82036 | 12.2% |
| Math Symbol | 41018 | 6.1% |
Most frequent character per category
Uppercase Letter
| Value | Count | Frequency (%) |
| A | 29868 | |
| U | 19276 | |
| S | 17785 | |
| B | 16118 | |
| P | 9475 | 7.1% |
| E | 6672 | 5.0% |
| C | 6103 | 4.6% |
| W | 4172 | 3.1% |
| N | 3790 | 2.9% |
| R | 3554 | 2.7% |
| Other values (16) | 15728 |
Decimal Number
| Value | Count | Frequency (%) |
| 0 | 74928 | |
| 1 | 74530 | |
| 2 | 74151 | |
| 3 | 31969 | |
| 9 | 29508 | 7.1% |
| 8 | 28723 | 6.9% |
| 5 | 27778 | 6.7% |
| 4 | 25983 | 6.2% |
| 6 | 24811 | 6.0% |
| 7 | 24327 | 5.8% |
Space Separator
| Value | Count | Frequency (%) |
| 82036 |
Math Symbol
| Value | Count | Frequency (%) |
| | | 41018 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Common | 539762 | |
| Latin | 132541 | 19.7% |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| A | 29868 | |
| U | 19276 | |
| S | 17785 | |
| B | 16118 | |
| P | 9475 | 7.1% |
| E | 6672 | 5.0% |
| C | 6103 | 4.6% |
| W | 4172 | 3.1% |
| N | 3790 | 2.9% |
| R | 3554 | 2.7% |
| Other values (16) | 15728 |
Common
| Value | Count | Frequency (%) |
| 82036 | ||
| 0 | 74928 | |
| 1 | 74530 | |
| 2 | 74151 | |
| | | 41018 | |
| 3 | 31969 | 5.9% |
| 9 | 29508 | 5.5% |
| 8 | 28723 | 5.3% |
| 5 | 27778 | 5.1% |
| 4 | 25983 | 4.8% |
| Other values (2) | 49138 |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 672303 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 82036 | ||
| 0 | 74928 | |
| 1 | 74530 | |
| 2 | 74151 | |
| | | 41018 | 6.1% |
| 3 | 31969 | 4.8% |
| A | 29868 | 4.4% |
| 9 | 29508 | 4.4% |
| 8 | 28723 | 4.3% |
| 5 | 27778 | 4.1% |
| Other values (28) | 177794 |
INPADOC Family ID
Categorical
HIGH CARDINALITY  UNIFORM 
| Distinct | 2770 |
|---|---|
| Distinct (%) | 99.5% |
| Missing | 0 |
| Missing (%) | 0.0% |
| Memory size | 214.0 KiB |
| 20070425IT2006MI1910A1 | 3 |
|---|---|
| 20130502US20130105674A1 | 3 |
| 20120329WO2012040302A1 | 3 |
| 20090820AU2009214990A1 | 2 |
| 20051218IL164591A0 | 2 |
| Other values (2765) |
Length
| Max length | 24 |
|---|---|
| Median length | 23 |
| Mean length | 21.669899 |
| Min length | 17 |
Characters and Unicode
| Total characters | 60329 |
|---|---|
| Distinct characters | 37 |
| Distinct categories | 3 ? |
| Distinct scripts | 2 ? |
| Distinct blocks | 1 ? |
Unique
| Unique | 2759 ? |
|---|---|
| Unique (%) | 99.1% |
Sample
| 1st row | 20100624JP03160354U_ |
|---|---|
| 2nd row | 20090924US20090236468A1 |
| 3rd row | 19950322GB199501841D0 |
| 4th row | 19981230GB199824306D0 |
| 5th row | 19981029ID20227A_ |
Common Values
| Value | Count | Frequency (%) |
| 20070425IT2006MI1910A1 | 3 | 0.1% |
| 20130502US20130105674A1 | 3 | 0.1% |
| 20120329WO2012040302A1 | 3 | 0.1% |
| 20090820AU2009214990A1 | 2 | 0.1% |
| 20051218IL164591A0 | 2 | 0.1% |
| 20100304US20100053030A1 | 2 | 0.1% |
| 20100513US20100121324A1 | 2 | 0.1% |
| 20100304WO2010024975A1 | 2 | 0.1% |
| 20070407CA2562469A1 | 2 | 0.1% |
| 20120126WO2012012429A1 | 2 | 0.1% |
| Other values (2760) | 2761 |
Length
| Value | Count | Frequency (%) |
| 20070425it2006mi1910a1 | 3 | 0.1% |
| 20120329wo2012040302a1 | 3 | 0.1% |
| 20130502us20130105674a1 | 3 | 0.1% |
| 20100304wo2010024975a1 | 2 | 0.1% |
| 20120126wo2012012429a1 | 2 | 0.1% |
| 20070407ca2562469a1 | 2 | 0.1% |
| 20141230us8919622b1 | 2 | 0.1% |
| 20100513us20100121324a1 | 2 | 0.1% |
| 20100304us20100053030a1 | 2 | 0.1% |
| 20051218il164591a0 | 2 | 0.1% |
| Other values (2760) | 2761 |
Most occurring characters
| Value | Count | Frequency (%) |
| 0 | 13641 | |
| 1 | 11453 | |
| 2 | 10121 | |
| 3 | 3588 | 5.9% |
| A | 2720 | 4.5% |
| 9 | 2435 | 4.0% |
| 8 | 2309 | 3.8% |
| 4 | 2121 | 3.5% |
| 6 | 2017 | 3.3% |
| 5 | 2000 | 3.3% |
| Other values (27) | 7924 |
Most occurring categories
| Value | Count | Frequency (%) |
| Decimal Number | 51684 | |
| Uppercase Letter | 8387 | 13.9% |
| Connector Punctuation | 258 | 0.4% |
Most frequent character per category
Uppercase Letter
| Value | Count | Frequency (%) |
| A | 2720 | |
| U | 1462 | |
| S | 1365 | |
| W | 511 | 6.1% |
| O | 492 | 5.9% |
| C | 415 | 4.9% |
| B | 327 | 3.9% |
| E | 253 | 3.0% |
| N | 189 | 2.3% |
| D | 187 | 2.2% |
| Other values (16) | 466 | 5.6% |
Decimal Number
| Value | Count | Frequency (%) |
| 0 | 13641 | |
| 1 | 11453 | |
| 2 | 10121 | |
| 3 | 3588 | 6.9% |
| 9 | 2435 | 4.7% |
| 8 | 2309 | 4.5% |
| 4 | 2121 | 4.1% |
| 6 | 2017 | 3.9% |
| 5 | 2000 | 3.9% |
| 7 | 1999 | 3.9% |
Connector Punctuation
| Value | Count | Frequency (%) |
| _ | 258 |
Most occurring scripts
| Value | Count | Frequency (%) |
| Common | 51942 | |
| Latin | 8387 | 13.9% |
Most frequent character per script
Latin
| Value | Count | Frequency (%) |
| A | 2720 | |
| U | 1462 | |
| S | 1365 | |
| W | 511 | 6.1% |
| O | 492 | 5.9% |
| C | 415 | 4.9% |
| B | 327 | 3.9% |
| E | 253 | 3.0% |
| N | 189 | 2.3% |
| D | 187 | 2.2% |
| Other values (16) | 466 | 5.6% |
Common
| Value | Count | Frequency (%) |
| 0 | 13641 | |
| 1 | 11453 | |
| 2 | 10121 | |
| 3 | 3588 | 6.9% |
| 9 | 2435 | 4.7% |
| 8 | 2309 | 4.4% |
| 4 | 2121 | 4.1% |
| 6 | 2017 | 3.9% |
| 5 | 2000 | 3.9% |
| 7 | 1999 | 3.8% |
Most occurring blocks
| Value | Count | Frequency (%) |
| ASCII | 60329 |
Most frequent character per block
ASCII
| Value | Count | Frequency (%) |
| 0 | 13641 | |
| 1 | 11453 | |
| 2 | 10121 | |
| 3 | 3588 | 5.9% |
| A | 2720 | 4.5% |
| 9 | 2435 | 4.0% |
| 8 | 2309 | 3.8% |
| 4 | 2121 | 3.5% |
| 6 | 2017 | 3.3% |
| 5 | 2000 | 3.3% |
| Other values (27) | 7924 |
| Claims Count | Inventor Count | Application Month | Application Year | Earliest Priority Year | Count of Cited Refs - Patent | Count of Cited Refs - Non-patent | Count of Citing Patents | Publication Kind Code | Dead/Alive | |
|---|---|---|---|---|---|---|---|---|---|---|
| Claims Count | 1.000 | 0.057 | 0.011 | -0.072 | -0.000 | 0.145 | 0.148 | 0.183 | 0.052 | 0.014 |
| Inventor Count | 0.057 | 1.000 | 0.012 | -0.036 | -0.065 | 0.072 | 0.156 | 0.036 | 0.038 | 0.000 |
| Application Month | 0.011 | 0.012 | 1.000 | -0.275 | -0.083 | 0.011 | 0.001 | 0.030 | 0.069 | 0.000 |
| Application Year | -0.072 | -0.036 | -0.275 | 1.000 | 0.541 | -0.172 | -0.142 | -0.025 | 0.237 | 0.000 |
| Earliest Priority Year | -0.000 | -0.065 | -0.083 | 0.541 | 1.000 | -0.277 | -0.283 | 0.046 | 0.543 | 0.130 |
| Count of Cited Refs - Patent | 0.145 | 0.072 | 0.011 | -0.172 | -0.277 | 1.000 | 0.379 | 0.217 | 0.000 | 0.033 |
| Count of Cited Refs - Non-patent | 0.148 | 0.156 | 0.001 | -0.142 | -0.283 | 0.379 | 1.000 | 0.067 | 0.000 | 0.000 |
| Count of Citing Patents | 0.183 | 0.036 | 0.030 | -0.025 | 0.046 | 0.217 | 0.067 | 1.000 | 0.098 | 0.000 |
| Publication Kind Code | 0.052 | 0.038 | 0.069 | 0.237 | 0.543 | 0.000 | 0.000 | 0.098 | 1.000 | 0.000 |
| Dead/Alive | 0.014 | 0.000 | 0.000 | 0.000 | 0.130 | 0.033 | 0.000 | 0.000 | 0.000 | 1.000 |
| Publication Number | Title | Priority Number | Priority Date | Application Number | Application Date | Publication Kind Code | Publication Date | Inventor - w/address | Assignee/Applicant | Assignee - Current US | DWPI Class | DWPI Manual Codes | IPC - Current | CPC - Current | US Class | ECLA | Abstract | Title (Original language) | Claims | Claims Count | First Claim | Independent Claims | Description | Assignee/Applicant (Original Language) | Assignee - Original | Optimized Assignee | Ultimate Parent | Inventor | Inventor Count | Attorney/Agent | Correspondent | Examiner | Publication Country Code | Dead/Alive | Publication Month | Publication Year | Application Country/Region | Application Month | Application Year | Priority Date - Earliest | Earliest Priority Year | IPC Class | CPC Class | US Class - Original | Cited Refs - Patent | Count of Cited Refs - Patent | Cited Refs - Non-patent | Count of Cited Refs - Non-patent | Citing Patents | Count of Citing Patents | INPADOC Legal Status | INPADOC Family Members | INPADOC Family ID | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 0 | US8919357B2 | Steam appliance | US2009567718A | 2009-09-25 | US13653717A | 2012-10-17 | B2 | 2014-12-30 | Breit Oliver Rudolph|Mid Levels, HK | Euro-Pro Operating LLC,Newton,MA,US | GLOBAL APPLIANCE INC. | SHARKNINJA OPERATING LLC | SHARKNINJA MANAGEMENT COMPANY | SHARKNINJA SALES COMPANY | EURO-PRO HOLDCO LLC | GLOBAL APPLIANCE UK HOLDCO LIMITED | COMPASS CAYMAN SPV LTD. | COMPASS CAYMAN SPV 2 LIMITED | EP MIDCO LLC | P43 N | NaN | B08B000300 | A47L001140 | B08B000300 | A47L00114086 | B08B223001 | 134105 | NaN | A steam appliance includes a steam applicator which is connectable to the steam appliance, but the steam applicator is permitted to rotate without loosening or disengaging the connection of the steam applicator to the steam appliance. Embodiments may be particularly suitable for use with a portable, handheld steam appliance that employs steam pocket technology. | Steam appliance | The invention claimed is: \n1. A steam cleaning appliance, comprising: \na steam generation unit; \na steam cleaning applicator; and \na flexible steam conduit configured to guide steam from the steam generation unit to a steam inlet for the steam cleaning applicator; \nwherein the steam cleaning applicator is connectable to the steam conduit; \nthe steam cleaning applicator is rotatable relative to the steam conduit in either rotational direction without loosening the connection of the steam applicator to the steam conduit; \nthe steam cleaning applicator has an end-to-end direction and \nthe steam cleaning applicator is rotatable by at least 360 degrees relative to the steam conduit in either rotational direction about the end-to-end direction of the steam cleaning applicator, without loosening the connection of the steam cleaning applicator to the steam conduit. \n2. A steam cleaning appliance as in claim 1, wherein the steam applicator is connectable to the steam conduit via a handle.\n3. A steam cleaning appliance as in claim 2, wherein the handle has an end-to-end direction, and the handle is rotatable relative to the steam conduit about the end-to-end direction of the handle in either rotational direction without loosening the connection of the steam cleaning applicator to the steam conduit.\n4. A steam cleaning appliance as in claim 1, wherein the steam cleaning applicator is repeatedly rotatable relative to the steam conduit in either rotational direction about an end-to-end direction of the steam cleaning applicator without loosening the connection of the steam cleaning applicator to the steam conduit.\n5. A steam cleaning appliance as in claim 1, wherein the steam cleaning applicator is connectable to the steam conduit with a tool-free connection.\n6. A steam cleaning appliance as in claim 5, wherein at least two distinct user actions are required to remove the steam cleaning applicator from the steam conduit.\n7. A steam cleaning appliance as in claim 6, wherein the at least two distinct user actions comprise applying an end-to-end force on a handle relative to the steam conduit, and applying a twisting force on the handle relative to the steam conduit.\n8. A steam cleaning appliance as in claim 5, further comprising a connector that is constructed and arranged to permit rotation of the steam cleaning applicator relative to the steam conduit about an end-to-end direction of the steam applicator in either rotational direction without loosening the connection of the steam cleaning applicator to the steam conduit.\n9. A steam cleaning appliance as in claim 8, wherein the connector comprises a threaded connector having: (a) an external thread portion positioned on either the steam cleaning applicator or the steam conduit, and (b) an internal thread portion positioned on the other of the steam applicator and the steam conduit.\n10. A steam cleaning appliance as in claim 9, wherein: \nthe external thread portion is selectively rotatable relative to whichever of the steam cleaning applicator and the steam conduit that the external thread portion is positioned on, and/or the internal thread portion is selectively rotatable relative to whichever of the steam cleaning applicator and the steam conduit that the internal thread portion is positioned on. \n11. A steam cleaning appliance as in claim 10, wherein when a user applies at least a threshold force in an end-to-end direction of a handle of the steam applicator, the selectively rotatable thread portion(s) is prevented from rotating more than 180 degrees in either rotational direction relative to whichever of the steam applicator and the steam conduit that the selectively rotatable thread portion(s) is positioned on, as long as the user continues to apply the at least a threshold force.\n12. A steam cleaning appliance as in claim 11, wherein when the at least a threshold force is applied, the at least a threshold force overcomes a force provided by a resilient element.\n13. A steam cleaning appliance as in claim 12, wherein the at least a threshold force is transferred to the thread portions of the connector.\n14. A steam cleaning appliance as in claim 13, wherein the resilient element comprises a coil spring, and the at least a threshold force compresses the spring such that engagement elements on the selectively rotatable thread portion(s) engage with complementary engagement elements fixed to whichever of the steam cleaning applicator and the steam conduit that the selectively rotatable thread portion(s) is positioned on.\n15. A steam cleaning appliance as in claim 14, wherein the internal thread portion is selectively rotatable relative to whichever of the steam cleaning applicator and the steam conduit that the internal thread portion is positioned on.\n16. A steam cleaning appliance as in claim 15, wherein the internal thread portion is positioned on the handle of the steam cleaning applicator.\n17. A steam cleaning appliance as in claim 1, wherein the steam conduit comprises a flexible hose.\n18. A steam cleaning appliance as in claim 1, wherein the steam cleaning applicator includes a handle that is connected to the steam conduit.\n19. A steam cleaning appliance as in claim 2, wherein the handle is detachably connectable to the steam applicator. | 19 | 1. A steam cleaning appliance, comprising: \na steam generation unit; \na steam cleaning applicator; and \na flexible steam conduit configured to guide steam from the steam generation unit to a steam inlet for the steam cleaning applicator; \nwherein the steam cleaning applicator is connectable to the steam conduit; \nthe steam cleaning applicator is rotatable relative to the steam conduit in either rotational direction without loosening the connection of the steam applicator to the steam conduit; \nthe steam cleaning applicator has an end-to-end direction and \nthe steam cleaning applicator is rotatable by at least 360 degrees relative to the steam conduit in either rotational direction about the end-to-end direction of the steam cleaning applicator, without loosening the connection of the steam cleaning applicator to the steam conduit. | 1. A steam cleaning appliance, comprising: a steam generation unit; a steam cleaning applicator; and a flexible steam conduit configured to guide steam from the steam generation unit to a steam inlet for the steam cleaning applicator; wherein the steam cleaning applicator is connectable to the steam conduit; the steam cleaning applicator is rotatable relative to the steam conduit in either rotational direction without loosening the connection of the steam applicator to the steam conduit; the steam cleaning applicator has an end-to-end direction and the steam cleaning applicator is rotatable by at least 360 degrees relative to the steam conduit in either rotational direction about the end-to-end direction of the steam cleaning applicator, without loosening the connection of the steam cleaning applicator to the steam conduit. | CROSS-REFERENCE TO RELATED APPLICATIONS \n\nThis application is a continuation of U.S. application Ser. No. 12/567,718, entitled Steam Appliance, filed Sep. 25, 2009, which is herein incorporated by reference in its entirety. \n\nBRIEF DESCRIPTION OF THE DRAWINGS \n\nThe accompanying drawings are not intended to be drawn to scale. For purposes of clarity, not every component may be labeled in every drawing. In the drawings: \n\nFIG. 1 is a side view of a steam appliance system according to one embodiment of the invention;\n\nFIG. 2 is a side view of a first portion of a connector according to one embodiment of the invention;\n\nFIG. 3 is a cross-sectional view of a second portion of a connector configured to engage with the first portion illustrated in FIG. 2; and\n\nFIG. 4 is an exploded perspective view of components of the second connector portion illustrated in FIG. 3.\n\nFIELD OF THE INVENTION \n\nThe invention relates generally to steam appliances, and more specifically to a steam applicator that is connectable to a conduit but constructed and arranged be rotated without loosening or disengaging the connection. \n\nDISCUSSION OF THE RELATED ART \n\nSteam appliances are used in the home to apply steam to floors for cleaning and sanitizing. Various types of steam appliances are known, including canister steam appliances and self-contained steam mops for example. Canister steam appliances typically include a rollable steam generation unit, a hose to transfer the steam from the steam generation unit, a pole, and a mop head or other accessory which is connected to the end of the pole. Self-contained steam mops include a steam generation unit mounted directly on the pole. Handheld steam appliances typically include a container and a nozzle for discharging steam directly from the mouth of the container. \n\nSUMMARY \n\nEmbodiments of the invention provided herein are directed to steam appliances in which a steam applicator is connectable to the steam appliance, but the steam applicator is permitted to rotate without loosening or disengaging the connection of the steam applicator to the steam appliance. \n\nAccording to one embodiment of the invention, a steam appliance includes a steam generation unit, a steam applicator, and a steam conduit configured to guide steam from the steam generation unit to a steam inlet for the steam applicator. The steam applicator is connectable to the steam conduit, and the steam applicator is rotatable relative to the steam conduit in either rotational direction without loosening the connection of the steam applicator to the steam conduit. \n\nAccording to another embodiment of the invention, a method of using a steam applicator having a handle with a end-to-end direction includes acts of grasping the handle with a first hand, grasping a steam conduit with a second hand, bringing a first threaded portion of the steam applicator into contact with a second threaded portion of the steam conduit, and connecting the steam applicator to the steam conduit. The method further includes using the steam applicator to apply steam to an object, and rotating the handle in either rotational direction about the end-to-end direction of the handle to rotate the steam applicator, wherein the rotation of the handle does not loosen the connection of the steam applicator to the steam conduit. Also included is a method of disconnecting the steam applicator from the steam conduit by simultaneously rotating the first threaded portion relative to the second threaded portion and applying an axial force between the conduit and the steam applicator, the axial force being sufficient to overcome a force applied by a resilient element, such that at least one of the first and second threaded portions is altered from a configuration in which the at least one threaded portion is rotatable relative to whichever of the steam applicator and the steam conduit that it is positioned on, to a configuration in which the at least one threaded portion is not rotatable relative to whichever of the steam applicator and the steam conduit that it is positioned on. \n\nAccording to a further embodiment of the invention, a steam appliance includes a steam generation unit, a steam applicator having a handle, a steam conduit to guide steam from the steam generation unit to the steam applicator, and means for mechanically connecting the steam conduit to the handle of the steam applicator. The handle is permitted to repeatedly rotate relative to the steam conduit in either rotation direction about an end-to-end direction of the handle without loosening the connection of the handle to the steam conduit. \n\nVarious embodiments of the present invention provide certain advantages. Not all embodiments of the invention share the same advantages and those that do may not share them under all circumstances. \n\nFurther features and advantages of the present invention, as well as the structure of various embodiments of the present invention are described in detail below with reference to the accompanying drawings. \n\nDETAILED DESCRIPTION \n\nApplicants have recognized the importance of providing a steam applicator assembly which can be freely rotated without compromising the connection of the applicator assembly to a steam conduit. The ability to rotate the steam applicator can be particularly important when the steam applicator assembly is a handheld assembly that is attached to a flexible hose or other flexible conduit because a user may wish to rotate the steam applicator without twisting or kinking the hose. It is also desirable to prevent unintentional disengagement of the steam applicator during rotation of the steam applicator to avoid steam loss and the inconvenience of reconnecting the steam applicator. \n\nAccording to some embodiments of the invention, a steam appliance permits a user to engage and disengage the steam applicator with the same type of motion and without detaching any components. In some embodiments, disconnecting the steam applicator requires two distinct motions. For example, a user may need to push the steam applicator toward the steam conduit and then twist the conduit to separate the steam conduit and the steam applicator. \n\nAccording to one embodiment of the invention, a steam applicator is connected to a flexible steam conduit with a threaded connector configuration which allows rotation of the steam applicator relative to the steam conduit during use without compromising the connection. The threaded connector includes an external thread portion and an internal thread portion. One of the thread portions, for example the internal thread portion, is positioned within an element such as a handle on the steam applicator. The internal thread portion is constructed and arranged to rotate within the handle. By allowing the internal thread portion to float within the handle, friction between the thread portions rotates the internal thread portion within the handle, thereby substantially preventing the complementary external thread portion from being fully twisted into or out of the internal thread portion. To successfully twist the external thread portion into or out of the internal thread portion, the user pushes the two thread portions toward each other, which temporarily fixes the internal thread portion to the handle, thereby permitting relative rotation of the two thread portions. \n\nA steam appliance system 100 including two attachable steam applicators 102, 104 is shown in FIG. 1. Steam applicators 102, 104 each may include a handle 107 which is permanently or detachably attached to the applicator. In the embodiment of FIG. 1, steam appliance system 100 includes a steam generation unit 108, a steam conduit 110, and attached steam applicator 102. Steam generation unit 108 may include any suitable type of steam generation system, for example a cool water reservoir 112 and an aluminum die-cast steam generator (not shown). In some embodiments, water may be heated to its boiling point within its reservoir to create steam. It should be noted that the method of steam generation is not intended to be a limiting aspect of the invention.\n\nIn some embodiments, the steam generation unit 108 is handheld, while in other embodiments the steam generation unit may include a shoulder strap, or include wheels or other rollers.\n\nSteam conduit 110 is a flexible hose in some embodiments. Steam conduit 110 may be attachable to steam generation unit 108 with any suitable attachment 114, including a removable connector, such as a bayonet connector.\n\nOne particular embodiment of a steam appliance which permits rotation a steam applicator without compromising the connection of the steam applicator to the steam appliance is shown in FIGS. 2-4. In this embodiment, a steam appliance includes an externally-threaded connector portion 202 attached to steam conduit 110. A hand grasp portion 206 is attached to steam conduit 110 and threaded connector portion 202 for the user to grip when attaching or detaching steam conduit 110 and handle 107.\n\nSteam conduit includes an elongated stem 208 to guide steam through handle 107 and to a steam outlet 212. O-rings 210 or other seal elements may be positioned on stem 208 to establish a seal with the steam applicator, whether that seal be within the handle of the steam applicator, or within the steam applicator itself. The stem and sealing aspects of the illustrated embodiment are not intended to be limiting. A stress release sleeve 214 may be included at the junction of steam conduit 110 and hand grasp portion 206 in some embodiments.\n\nAn internally-threaded connector portion 302 with threads 304 is positioned within handle 107 in the embodiment illustrated in FIG. 3. Connector portion 302 is permitted to rotate within handle 107, and is also permitted to move axially between stops 306 and 308. Connector portion 302 is biased away from a lock element 310 by a coil spring 312. Instead of a spring, any suitable resilient element may be used to bias connector portion 302 away from lock element 310. For example, a compressible resilient foam gasket may be used in some embodiments. In still other embodiments, a constant force spring, an elastic band, or any other suitable tensioning device, may bias connector portion 302 away from locking element 310 by pulling on connector portion 302.\n\nWhen a user initially inserts externally-threaded connector portion 202 into internally-threaded connector portion 302, rotating the two portions relative to each other will not result in a mating of the threaded portions because connector portion 302 rotates with connector portion 202. However, when the user pushes connector portion 302 against locking element 310 by providing an axial force of at least a threshold force t to overcome the force provided by coil spring 312 connector portion is prevented from rotating by more than a small angle because locking tabs 314 on connector portion 302 are rotated into abutment with locking tabs 316 on the locking element 310. With locking element 310 prevented from rotating, connector portion 202 can be twisted into mating engagement with connector portion 302. Locking element 310 is prevented from moving axially away from connector portion 302 by a stop 318.\n\nIn this manner, two distinct motions are required of the user to attach or remove a steam applicator from steam conduit 110. While in the illustrated embodiment the two distinct motions include an axial force and a twisting force acting simultaneously, other multiple distinct action configurations may be used. For example, in some embodiments, a ball and groove quick disconnect coupling is used to connect a steam conduit to a steam applicator. In such an embodiment, a first motion may include moving a locking collar, and a second motion may include pulling the handle of the steam applicator away from the steam conduit. Some embodiments may require two or more distinct motions to remove a steam applicator, while allowing attachment of a steam applicator with only a single motion.\n\nBy requiring two or more distinct motions to remove a steam applicator, unintended disengagement or loosening of the steam applicator during use of the steam appliance may be prevented. For example, the user may rotate the steam applicator in either direction about an end-to-end direction of the steam application when cleaning surfaces, and it may be beneficial to avoid having the steam conduit rotate as a result of the steam applicator rotations. By allowing connector portion 302 to rotate relative to handle 107, handle 107 can rotate without twisting steam conduit 110 and with loosening the engagement of the two threaded connectors. For purposes herein, loosening a connection is intended to include compromising a connection. For example, in some embodiments, a connection may become less than fully engaged such that the connection is at risk of disengaging, yet the connection may not permit perceptible movement of the two connected components relative to one another.\n\nIn some embodiments, one or more rotation stops may be included to limit the rotation angle of the steam applicator in either rotation direction (e.g., clockwise and counterclockwise about an end-to-end direction of the steam applicator). In such an embodiment, the steam applicator is permitted to rotate a certain amount, for example by permitting connector portion 302 to rotate, but the steam applicator rotation is prevented from further rotations by the rotation stops. The rotation stops may include one or more tabs (not shown) protruding from an interior wall of handle 107 between stops 306 and 308. In some embodiments, the steam applicator is permitted to rotate 180 degrees in either direction, and in some embodiments, the steam applicator is permitted to rotate 360 degrees in either direction.\n\nThe embodiments described above allow for a tool-free attachment and removal of steam applicators from the steam appliance. In some embodiments, however, a tool may be used. \n\nWhile embodiments described herein are directed to rotations of a steam applicator or a handle about an end-to-end direction of the steam application or the handle, in some embodiments, pitch and/or yaw rotations may be permitted as well. A universal joint may be used in addition to, or instead of, the structures described herein. \n\nFor purposes herein, the terms connect, connected, connection, attach, attached and attachment refer to direct connections and attachments, indirect connections and attachments, and operative connections and attachments. For example, steam applicator 102 is considered to be connected to steam conduit 110 even though steam applicator is directly connected to handle 107 which is, in turn, connected to steam conduit 110. Also for purposes herein, the terms connectable, attachable, removable, etc. refer both to components which can be connected, attached, removed, etc., and also refer to components which are connected, attached and removed.\n\nFor ease of understanding, and without limiting the scope of the invention, the embodiments to which this disclosure is addressed are described above particularly in connection with a handheld portable steam appliance. It should be appreciated, however, that the present invention can be embodied in other types of steam appliances. Additionally, while the steam applicators described above employ steam pocket technology, other types of steam applicators may be used in conjunction with embodiments disclosed herein. \n\nHaving thus described several aspects of at least one embodiment of this invention, it is to be appreciated various alterations, modifications, and improvements will readily occur to those skilled in the art. Such alterations, modifications, and improvements are intended to be part of this disclosure, and are intended to be within the spirit and scope of the invention. Accordingly, the foregoing description and drawings are by way of example only. | Euro-Pro Operating LLC,Newton,MA,US | Euro-Pro Operating LLC | SHARKNINJA OPERATING LLC (FORMERLY EURO-PRO OPERATING LLC) | COMPASS CAYMAN SPV 2 LIMITED | SHARKNINJA SALES COMPANY | COMPASS CAYMAN SPV LTD. | EP MIDCO LLC | SHARKNINJA MANAGEMENT COMPANY | EURO-PRO HOLDCO LLC | GLOBAL APPLIANCE UK HOLDCO LIMITED | GLOBAL APPLIANCE TECHNOLOGIES INC | SHARKNINJA OPERATING LLC (FORMERLY EURO-PRO OPERATING LLC) | COMPASS CAYMAN SPV 2 LIMITED | SHARKNINJA SALES COMPANY | COMPASS CAYMAN SPV LTD. | EP MIDCO LLC | SHARKNINJA MANAGEMENT COMPANY | EURO-PRO HOLDCO LLC | GLOBAL APPLIANCE UK HOLDCO LIMITED | GLOBAL APPLIANCE TECHNOLOGIES INC | Breit, Oliver Rudolph | 1 | Wolf, Greenfield & Sacks, P.C. | NaN | Ko, Jason | US | Alive | 12 | 2014 | US | 10 | 2012 | 2009-09-25 | 2009 | B08, A47 | B08, A47 | 134105 | CN2544162Y | US7516565B1 | CN2741495Y | US5609047A | US6295691B1 | US20050274403A1 | CN101022898A | JP2001327449A | WO2008012661A2 | WO2001021054A1 | WO2006014311A1 | CN2639658Y | CN2644027Y | EP1223844A1 | JP9154569A | KR2007119256A | CN2577987Y | DE202004014412U1 | US20060000049A1 | CN2389017Y | CN1500565A | JP2003526489A | US7237409B2 | EP719516A2 | JP58156587U | KR2007016449A | US7475448B2 | US20050125934A1 | CN1439836A | DE2004014412U1 | US3000036A | US20030145880A1 | US20050161538A1 | US20110073135A1 | CN2568904Y | CN2689033Y | 36 | Evaluation Report for Chinese Application No. 201020138464.6. | Novelty Evaluation Report for Chinese Application No. 201020138464.6. | Chinese Office Action for CN 201010127191.0 mailed Aug. 2, 2012. | Report of Utility Model Technical Opinion for JP 2010-001169 mailed Jun. 15, 2011. | International Search Report and Written Opinion for PCT/US2010/048043 mailed May 26, 2011. | International Preliminary Report on Patentability for PCT/US2010/048043 mailed Apr. 5, 2012. | 6 | US20160128536A1 | US20160128537A1 | US9549651B2 | US9549652B2 | USD806333S1 | 5 | 2022-06-30 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 8TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1552); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY FEE PAYMENT YEAR 8 | 2020-04-03 AS ASSIGNMENT COMPASS CAYMAN SPV 2 LIMITED, MASSACHUSETTS RELEASE BY SECURED PARTY;ASSIGNOR:JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT;REEL/FRAME:052311/0585 2020-04-02 | 2020-04-03 AS ASSIGNMENT COMPASS CAYMAN SPV, LTD., MASSACHUSETTS RELEASE BY SECURED PARTY;ASSIGNOR:JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT;REEL/FRAME:052311/0585 2020-04-02 | 2020-04-03 AS ASSIGNMENT EP MIDCO LLC, MASSACHUSETTS RELEASE BY SECURED PARTY;ASSIGNOR:JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT;REEL/FRAME:052311/0585 2020-04-02 | 2020-04-03 AS ASSIGNMENT EURO-PRO HOLDCO, LLC, MASSACHUSETTS RELEASE BY SECURED PARTY;ASSIGNOR:JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT;REEL/FRAME:052311/0585 2020-04-02 | 2020-04-03 AS ASSIGNMENT GLOBAL APPLIANCE INC., MASSACHUSETTS RELEASE BY SECURED PARTY;ASSIGNOR:JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT;REEL/FRAME:052311/0585 2020-04-02 | 2020-04-03 AS ASSIGNMENT GLOBAL APPLIANCE UK HOLDCO LIMITED, MASSACHUSETTS RELEASE BY SECURED PARTY;ASSIGNOR:JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT;REEL/FRAME:052311/0585 2020-04-02 | 2020-04-03 AS ASSIGNMENT SHARKNINJA MANAGEMENT COMPANY, MASSACHUSETTS RELEASE BY SECURED PARTY;ASSIGNOR:JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT;REEL/FRAME:052311/0585 2020-04-02 | 2020-04-03 AS ASSIGNMENT SHARKNINJA OPERATING LLC, MASSACHUSETTS RELEASE BY SECURED PARTY;ASSIGNOR:JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT;REEL/FRAME:052311/0585 2020-04-02 | 2020-04-03 AS ASSIGNMENT SHARKNINJA SALES COMPANY, MASSACHUSETTS RELEASE BY SECURED PARTY;ASSIGNOR:JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT;REEL/FRAME:052311/0585 2020-04-02 | 2018-07-02 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) FEE PAYMENT YEAR 4 | 2017-10-13 AS ASSIGNMENT SHARKNINJA OPERATING LLC, MASSACHUSETTS RELEASE BY SECURED PARTY;ASSIGNOR:BANK OF AMERICA, N.A.;REEL/FRAME:044207/0652 2017-09-29 | 2017-10-03 AS ASSIGNMENT JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT SECURITY INTEREST;ASSIGNORS:GLOBAL APPLIANCE INC.;SHARKNINJA OPERATING LLC;SHARKNINJA MANAGEMENT COMPANY;AND OTHERS;REEL/FRAME:044321/0885 2017-09-29 | 2017-10-03 AS ASSIGNMENT JPMORGAN CHASE BANK, N.A., AS ADMINISTRATIVE AGENT, NEW YORK SECURITY INTEREST;ASSIGNORS:GLOBAL APPLIANCE INC.;SHARKNINJA OPERATING LLC;SHARKNINJA MANAGEMENT COMPANY;AND OTHERS;REEL/FRAME:044321/0885 2017-09-29 | 2015-11-17 AS ASSIGNMENT BANK OF AMERICA, N.A., AS AGENT, MASSACHUSETTS FOURTH SUPPLEMENT TO PATENT SECURITY AGREEMENT;ASSIGNOR:SHARKNINJA OPERATING LLC;REEL/FRAME:037124/0386 2015-08-25 | 2015-08-12 AS ASSIGNMENT SHARKNINJA OPERATING LLC, MASSACHUSETTS CHANGE OF NAME;ASSIGNOR:EURO-PRO OPERATING LLC;REEL/FRAME:036333/0287 2015-07-13 | 2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE | 2012-11-16 AS ASSIGNMENT EURO-PRO OPERATING, LLC, MASSACHUSETTS ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:BREIT, OLIVER RUDOLPH;REEL/FRAME:029309/0231 2010-02-22 | US8919357B2 | CN102029266A | CN102029266B | CN201625643U | JP03160354U | US20110073135A1 | US20130160803A1 | WO2011037744A2 | WO2011037744A3 | 20100624JP03160354U_ |
| 1 | US8920125B2 | Dual frequency hub mounted vibration suppressor system | US200870097P | US2009353217A | 2008-03-20 | 2009-01-13 | US13774011A | 2013-02-22 | B2 | 2014-12-30 | Welsh William A.|North Haven, CT, US | Sikorsky Aircraft Corporation,Stratford,CT,US | SIKORSKY AIRCRAFT CORP | W06 E | X11 E | X13 E | W06-B01 | W06-B15B | X11-A01A2 | X11-A01C | X11-A10B | X11-J05X | X11-U04 | X13-F03X | X13-G | X13-U03 | B64C002700 | F01D000502 | F16F000710 | F16F001522 | G01M000136 | H02K000714 | H02K0041025 | H02P000552 | H02K000704 | H02K001602 | B64C0027001 | F01D000502 | F16F00071011 | F16F0015223 | G01M000136 | H02K000714 | H02K0041025 | H02P000556 | B64C2027003 | H02K000704 | H02K001602 | Y10T00742121 | Y10T00742127 | 416145 | 0745741 | 310081 | NaN | A vibration suppressor system includes an annular electric motor system which independently controls rotation of at least two masses about the axis of rotation to reduce in-plane vibration of the rotating system. A method of reducing vibrations in a rotary-wing aircraft includes independently controlling a relative angular position of a multiple of independently rotatable masses to reduce vibrations of a main rotor system. | Dual frequency hub mounted vibration suppressor system | What is claimed is: \n1. A vibration suppressor system for reducing vibrations in a rotating system, comprising: \nan annular electric motor system provided about an axis of rotation of the rotating system, said annular electric motor system including an annular bearing and a first mass supported within said annular bearing, said first mass guided about said axis of rotation by said annular bearing, wherein said first mass is eccentric, said first mass including a truck being at least partially conductive, said annular electric motor system further including a stator axially spaced-apart, relative to said axis of rotation, from said truck; \na control system in communication with said annular electric motor system to control rotation of said first mass about said axis of rotation to reduce in-plane vibration of the rotating system; \nwherein a second mass is supported within said annular bearing, and wherein said second mass is eccentric; and \nwherein said control system independently controls rotation of said first and second masses about said axis of rotation. \n2. The system as recited in claim 1, wherein said first and second masses each include an eccentric mass positioned between said annular bearing.\n3. The system as recited in claim 1, wherein said first and second masses are configured to rotate about said axis of rotation, and wherein a majority of the mass of each of said first and second masses is radially disposed on one side of said axis of rotation.\n4. The system as recited in claim 1, wherein said first and second masses each include trucks, and wherein said trucks are eccentric.\n5. The system as recited in claim 1, further comprising: \na rotor system having an N number of blades which rotates about an axis of rotation at a rotational speed of 1P, such that said rotor system produces NP vibrations; \na sensor system which senses the NP vibrations; and \nwherein said control system is in communication with said sensor system, said control system operable to identify variations of the NP vibrations to control an angular velocity of each of said first mass and said second mass to reduce the NP in-plane rotor system vibrations. \n6. The system as recited in claim 5, further comprising a generator driven by said rotor system.\n7. The system as recited in claim 6, wherein a phase of the voltage from said generator provides a phase reference to said control system indicative of a rotational speed of said rotor system.\n8. The system as recited in claim 1, wherein said axis of rotation intersects said first mass.\n9. A vibration suppressor system for reducing vibrations in a rotating system, comprising: \nan annular electric motor system provided about an axis of rotation of the rotating system, said annular electric motor system including an annular bearing and a first mass supported within said annular bearing, said first mass guided about said axis of rotation by said annular bearing, wherein said first mass is eccentric, and wherein said axis of rotation intersects said first mass; and \na control system in communication with said annular electric motor system to control rotation of said first mass about said axis of rotation to reduce in-plane vibration of the rotating system; \nwherein a second mass is supported within said annular bearing, wherein said second mass is eccentric, and wherein said axis of rotation intersects said second mass; and \nwherein said control system independently controls rotation of said first and second masses about said axis of rotation. \n10. The system as recited in claim 9, wherein said first and second masses each include trucks, and wherein said trucks are eccentric.\n11. The system as recited in claim 10, wherein said axis of rotation intersects said trucks.\n12. A vibration suppressor system for reducing vibrations in a rotating system, comprising: \nan annular electric motor system provided about an axis of rotation of the rotating system, said annular electric motor system including an annular bearing and first and second masses supported within said annular bearing, said first and second masses guided about said axis of rotation by said annular bearing, wherein said first and second masses are eccentric, said first and second masses each including a truck which is at least partially conductive, said annular electric motor system further including at least one stator axially spaced-apart, relative to said axis of rotation, from said trucks; \na control system in communication with said annular electric motor system to control rotation of said first and second masses about said axis of rotation to reduce in-plane vibration of the rotating system; and \nwherein said first and second masses are disk-shaped and each span substantially an entirety of an inner diameter of said annular bearing. | 12 | 1. A vibration suppressor system for reducing vibrations in a rotating system, comprising: \nan annular electric motor system provided about an axis of rotation of the rotating system, said annular electric motor system including an annular bearing and a first mass supported within said annular bearing, said first mass guided about said axis of rotation by said annular bearing, wherein said first mass is eccentric, said first mass including a truck being at least partially conductive, said annular electric motor system further including a stator axially spaced-apart, relative to said axis of rotation, from said truck; \na control system in communication with said annular electric motor system to control rotation of said first mass about said axis of rotation to reduce in-plane vibration of the rotating system; \nwherein a second mass is supported within said annular bearing, and wherein said second mass is eccentric; and \nwherein said control system independently controls rotation of said first and second masses about said axis of rotation. | 1. A vibration suppressor system for reducing vibrations in a rotating system, comprising: an annular electric motor system provided about an axis of rotation of the rotating system, said annular electric motor system including an annular bearing and a first mass supported within said annular bearing, said first mass guided about said axis of rotation by said annular bearing, wherein said first mass is eccentric, said first mass including a truck being at least partially conductive, said annular electric motor system further including a stator axially spaced-apart, relative to said axis of rotation, from said truck; a control system in communication with said annular electric motor system to control rotation of said first mass about said axis of rotation to reduce in-plane vibration of the rotating system; wherein a second mass is supported within said annular bearing, and wherein said second mass is eccentric; and wherein said control system independently controls rotation of said first and second masses about said axis of rotation. | 9. A vibration suppressor system for reducing vibrations in a rotating system, comprising: an annular electric motor system provided about an axis of rotation of the rotating system, said annular electric motor system including an annular bearing and a first mass supported within said annular bearing, said first mass guided about said axis of rotation by said annular bearing, wherein said first mass is eccentric, and wherein said axis of rotation intersects said first mass; and a control system in communication with said annular electric motor system to control rotation of said first mass about said axis of rotation to reduce in-plane vibration of the rotating system; wherein a second mass is supported within said annular bearing, wherein said second mass is eccentric, and wherein said axis of rotation intersects said second mass; and wherein said control system independently controls rotation of said first and second masses about said axis of rotation. | 12. A vibration suppressor system for reducing vibrations in a rotating system, comprising: an annular electric motor system provided about an axis of rotation of the rotating system, said annular electric motor system including an annular bearing and first and second masses supported within said annular bearing, said first and second masses guided about said axis of rotation by said annular bearing, wherein said first and second masses are eccentric, said first and second masses each including a truck which is at least partially conductive, said annular electric motor system further including at least one stator axially spaced-apart, relative to said axis of rotation, from said trucks; a control system in communication with said annular electric motor system to control rotation of said first and second masses about said axis of rotation to reduce in-plane vibration of the rotating system; and wherein said first and second masses are disk-shaped and each span substantially an entirety of an inner diameter of said annular bearing. | RELATED APPLICATIONS \n\nThe present application is a divisional of prior U.S. patent application Ser. No. 12/353,217, filed Jan. 13, 2009, which claims the benefit U.S. Provisional Application No. 61/070,097, filed Mar. 20, 2008. The '217 and '097 applications are herein incorporated by reference in their entirety. \n\nBRIEF DESCRIPTION OF THE DRAWINGS \n\nThe various features and advantages of this disclosure will become apparent to those skilled in the art from the following detailed description of the currently disclosed embodiment. The drawings that accompany the detailed description can be briefly described as follows: \n\nFIG. 1 is a general perspective view of an exemplary rotary wing aircraft embodiment for use with the present disclosure;\n\nFIG. 2 is a side sectional view of a helicopter main rotor, including a main rotor shaft having a vibration suppression system mounted to the upper mast or shaft extension member of the main rotor system;\n\nFIG. 3A is a schematic perspective view of a vibration suppressor system having adjacent annular stators;\n\nFIG. 3B is a sectional view through the system of FIG. 3A along line 3B-3B;\n\nFIG. 3C is an expanded perspective view of a single mass which rotates upon an annular stator;\n\nFIG. 4A is a top view of another non-limiting embodiment of a vibration suppressor system;\n\nFIG. 4B is a cross-sectional view taken along line 4B-4B in FIG. 4A;\n\nFIG. 4C is a cross-sectional view taken along line 4C-4C in FIG. 4B;\n\nFIG. 5A is another non-limiting embodiment of a vibration suppressor system with ring bearings that support disk-shaped eccentric masses;\n\nFIG. 5B is a cross-sectional view taken along line 5B-5B in FIG. 5A;\n\nFIG. 5C is a cross-sectional view taken along line 5B-5B in FIG. 5A of another non-limiting embodiment that radially compresses the vibration suppressor system by location of eccentric masses between the two ring bearings;\n\nFIGS. 6A-6E are schematic top views of a vibration suppressor system with segmental propulsion;\n\nFIG. 7A is another embodiment of the vibration suppressor system having electromagnets arranged around an inner ring;\n\nFIG. 7B is a top view of another vibrating suppressor system having electromagnets arranged around an outer ring;\n\nFIG. 8A is a schematic representation of a condition where the maximum force is produced by one annular stator of the vibration suppressor system; and\n\nFIG. 8B is a schematic representation of a condition where an intermediate force is produced by one annular stator of the vibration suppressor system; and\n\nFIG. 8C is a schematic representation of a condition where a minimum force is produced by one annular stator of the vibration suppressor system.\n\nBACKGROUND \n\nThe present disclosure relates to a vibration suppressor system. \n\nVibration suppression is often utilized to null vibrations associated with a rotating system. Such vibrations, when left unattenuated may lead to crew and structural fatigue and premature failure of system components. The vibrations may also be transmitted through adjacent support structure to other areas and systems remote from the vibration source. Consequently, it may be desirable to suppress these vibrations proximal the vibration source. \n\nOne application which exemplifies vibration isolation/absorption is the main rotor system of a rotary-wing aircraft. Typically, the main rotor system includes a hub system which drives a plurality of rotor blades subject to a variety of aerodynamic and gyroscopic loads. For example, as each rotor blade advances or retreats relative to the freestream airflow, each rotor blade experiences a rise and fall of in-plane aerodynamic drag. Furthermore, as the tip of each rotor blade advances with each revolution of the rotor system, the relative velocity at the blade tip may approach supersonic Mach numbers. As such, variations may occur at various coefficients which define blade performance (e.g., moment, lift and drag coefficients). Moreover, gyroscopic and Coriolis forces are generated which may cause the blades to lead or lag. These effects, as well as others, generate vibrations, which, if not suppressed, are transmitted to the airframe, typically through the main rotor gearbox mount structure. \n\nVarious vibration suppressor systems have been devised to suppress vibrations. Mast-mounted vibration isolators suppress or isolate in-plane vibrations at a location proximal to the source. Transmission, cabin or cockpit absorbers reduce vibrations at a location remote from the source. \n\nMast-mounted vibration isolators having a plurality of resilient arms (i.e., springs) extend in a spaced-apart spiral pattern between a hub attachment fitting and a ring-shaped inertial mass. Several pairs of spiral springs are mounted to and equiangularly arranged with respect to both the hub attachment fitting and the inertial mass so as to produce substantially symmetric spring stiffness in an in-plane direction. The spring-mass system, i.e., spiral springs in combination with the ring-shaped mass, is tuned in the non-rotating system to a frequency equal to N*rotor RPM (e.g., 4P for a four-bladed rotor) at normal operating speed, so that in the rotating system the spring mass system will respond to both N+1 and N?1 frequency vibrations (i.e., 3P and 5P for a four-bladed rotor). N is the number of rotor blades. \n\nWhile the spiral spring arrangement produces a relatively small width dimension (i.e., the spiraling of the springs increases the effective spring rate), the height dimension of each vibration isolator is increased to react out-of-plane loads via upper and lower pairs of spiral springs. This increased profile dimension increases the profile area, and consequently the profile drag produced by the isolator. The spiral springs must also be manufactured to relatively precise tolerances to obtain the relatively exact spring rates necessary for efficient operation. As such, manufacturing costs may be significant. Additionally, the weight of this device is very high, thus reducing the useful payload of the helicopter. Furthermore, these vibration isolators are passive devices which are tuned to a predetermined in-plane frequency and cannot be adjusted in-flight to isolate in-plane loads which may vary in frequency depending upon flight regime. \n\nYet another general configuration of a mast-mounted vibration isolator is referred to as a bifilar. Bifilars include a hub attachment fitting connected to and driven by the rotorshaft with a plurality of radial arms which project outwardly from the fitting with a mass coupled to the end of each arm via a rolling pin arrangement. A pin rolls within a cycloidally-shaped bushing to permit edgewise motion of each mass relative to its respective arm. The geometry of the pin arrangement in combination with the centrifugal forces acting on the mass (imposed by rotation of the bifilar) results in an edgewise anti-vibration force at a 4 per revolution frequency which is out-of-phase with the large 4 per revolution (4P) in-plane vibrations of the rotor hub for a 4 bladed rotor system. The frequency of 4P is the frequency as observed in a nonrotating reference system such as the airframe. \n\nPairs of opposed masses act in unison to produce forces which counteract forces active on the rotor hub. For the masses to produce the necessary shear forces to react the in-plane vibratory loads of the rotor system, counteracting bending moments are also produced. These force couples may impose relatively large edgewise bending loads in the radial arms, and consequently, the geometry thereof must produce the necessary stiffness (EI) at the root end of the arms. As such, these increased stiffness requirements result in relatively large and heavy bifilar arms. \n\nWhile the bifilar system has proven effective and reliable, the weight of the system, nearly 210 lbs for one typical system, may be detrimental to the overall lifting capacity of the aircraft. Furthermore, the pin mount for coupling each mass to the respective radial arm may require periodic removal and replacement, which may increase the Direct Maintenance Costs (DMC) of aircraft operations. \n\nSUMMARY \n\nA vibration suppressor according to an exemplary aspect of the present disclosure includes an annular electric motor system defined about an axis of rotation of a rotating system, and a control system in communication with the annular electric motor system to independently control rotation of at least two masses about the axis of rotation to reduce in-plane vibration of the rotating system. \n\nA method of reducing vibrations in a rotary-wing aircraft main rotor system having N number of blades which rotate about an axis of rotation at a rotational speed of 1P such that the main rotor system produces NP vibrations according to an exemplary aspect of the present disclosure includes independently rotating a multiple of independently rotatable masses disposed about an axis of rotation defined by the main rotor system and controlling a relative angular position of the multiple of independently rotatable masses to reduce the NP vibrations of the main rotor system. \n\nDETAILED DESCRIPTION OF THE DISCLOSED EMBODIMENT \n\nFIG. 1 schematically illustrates a rotary-wing aircraft 10 having a main rotor system 12. The aircraft 10 includes an airframe 14 having an extended tail 16 which mounts an anti-torque system such as a tail rotor system 18. The main rotor assembly 12 is driven about an axis of rotation R through a main rotor gearbox (illustrated schematically at MRG) which is powered by one or more engines E. The main rotor system 12 includes a multiple of rotor blades 20 mounted to a rotor hub 22. The rotor hub 22 is driven about the axis of rotation R by a main rotor shaft 24 which is driven by the main rotor gearbox MRG. Although a particular helicopter configuration is illustrated and described in the disclosed non-limiting embodiment, other configurations and/or machines, such as high speed compound rotary wing aircraft with supplemental translational thrust systems, dual contra-rotating, coaxial rotor system aircraft, turbo-props, tilt-rotors and tilt-wing aircraft, will also benefit herefrom.\n\nA vibration suppressor system 30 is mounted to the main rotor system 12 for rotation therewith and may thereby be referred to as a hub mounted vibration suppressor (HMVS). Vibratory forces active on the main rotor system 12 are generated by a variety of factors, although the dominant vibrations originate from aerodynamic and/or gyroscopic forces generated by each rotor blade 20.\n\nA four bladed rotor system, for example, produces 3P vibratory loads, i.e., in a single revolution, the magnitude of the load vector varies from a minimum to a maximum value three times in the rotating frame of reference. The 3P vibratory loads resolve into 4P vibration in a non-rotating frame of reference such as the airframe 14 due to the addition of the 1P rotor rotational speed. In addition, 5P vibratory loads are produced in a direction opposite the rotational direction of the main rotor system. The 5P vibratory loads also resolve into 4P vibration in the non-rotating frame of reference due to the subtraction of the opposite 1P rotor rotational speed. While a variety of factors influence the vibratory spectrum of a rotor system, such vibrations are generally a result of each rotor blade experiencing maximum lift when advancing and minimum lift when retreating. In another example, a seven bladed rotor systemhaving 6P co-rotation and 8P counter-rotational vibratory load resolve into a 7P vibration in the non-rotating frame of reference such as the airframe 14.\n\nReferring to FIG. 2, the vibration suppressor system 30 generally includes an annular electric motor system 32, a control system 34 and a power system 36. The controller can be included in the electric motor system 32 i.e. it is typically in the rotating system) The annular electric motor system 32 may be contained within a housing 38 for rotation with the main rotor system 12. The annular electric motor system 32 in one non-limiting embodiment includes a first and second annular stator 40A, 40B mounted within the housing 38. Each stator 40A, 40B represents a primary analogous to a fixed portion of a linear electric motor. The first stator 40A is defined about the axis of rotation R to support a first set of masses MA1, MA2, which are independently rotatable about the first stator 40A (also illustrated in FIG. 3A). The second stator 40B is defined about the axis of rotation R to support a second set of masses MB1, MB2 which are independently rotatable about the second stator 40B (also illustrated in FIG. 3A). The first stator 40A may be located adjacent the second stator 40B in a stacked arrangement which facilitates a light weight and low profile arrangement which may be readily mounted atop the main rotor hub 22 within the housing 38.\n\nAlternatively, the first stator 40A and second stator 40B may be located in the non-rotating system, i.e., in under the main rotor gearbox MRG. In this non-limiting embodiment, the MA1, MA2 would rotate at 4P and MB1 and MB2 would also rotate at 4P but in the opposite direction.\n\nThe control system 34 issues control signals to an amplifier 34A of the annular electric motor system 32 to control the rotational speed and relative angular position of the masses MA1, MA2, MB1, MB2 of the vibration suppressor system 30. The power system 36 in one non-limiting embodiment may be the aircraft electrical bus, which delivers electrical power created by a main rotor gearbox powered generator 44. The masses MA1, MA2, MB1, MB2 each represent an independent secondary analogous to a moving part of a linear electric motor. The control system 34 may include a speed sensor 42 which senses the instantaneous rotational speed 1P of the main rotor shaft 24 to control the rotational velocity and relative angular position of each of the masses the masses MA1, MA2, MB1, MB2.\n\nAlthough the speed sensor 42 in one non-limiting embodiment may be a dedicated unit which directly measures the main rotor system 12 speed, the control system 34 may alternatively or additionally obtain the speed information from the generator 44 within the power system 36. The generator 44 turns at a predefined speed relative to the main rotor system 12 and may, in one non-limiting embodiment include a 5 kVa generator which provides a 115 volt, 400 Hz 3 phase potential to generate power for the vibration suppressor system 30 as well as provide the main rotor system speed reference signal. The generator 44 is mechanically driven by the MRG such that the rotational speed of the generator is a fixed multiple of the main rotor NP frequency. The electrical phase of the generator voltage is a fixed multiple of the generator rotational speed. Thus, the electrical voltage phase signal is a reflection of the NP frequency. As the rotor speed and NP frequency vary while in flight, the electrical voltage phase signal also varies and is perfectly slaved thereto, i.e. a fixed multiple of the main rotor speed. This makes the voltage signal an effective reference signal that will exactly track main rotor system speed. Hence, the control system 34 may use the phase information to issue the appropriate low power control signals to the amplifier 34A which issues high power signals to the vibration suppression system 30.\n\nWhile the vibration suppressor system 30 may employ a control system 34 with a predefined schedule or model of the vibrations, e.g., at prescribed rotor speeds, another non-limiting embodiment utilizes a vibration sensing system 46 with at least one vibration feedback sensor 48 for issuing vibration signals indicative of the vibrations (e.g., amplitude, frequency and phase) at one or more locations within the fixed frame of reference, e.g., MRG, fuselage, cabin, or cockpit. It should be understood that the vibration sensing system 46 may alternatively be integrated within the control system 34. The control system 34 samples vibration levels at predefined intervals or rates to identify a trendpositive (lower vibration levels) or negative (larger vibration levels) such that as vibration levels change, the control system 34 issues modified control signals the vibration suppressor system 30 until a combination of rotational speed and angular position of the masses MA1, MA2, MB1, MB2 minimize vibratory loads in the main rotor system 12.\n\nPower may be transferred from the stationary system to the rotating system via a slip ring 50 or the like. Only a small amount of additional weight is required inasmuch as the slip ring 50 is typically pre-existing in a rotary wing aircraft for other systems e.g., a rotor blade de-ice system. This slip ring 50 may also be used to communicate control signals when the control system 34 is mounted in the airframe 14 rather than on the main rotor system 12. Alternatively, the control system 34 may be located within the vibration suppressor system 30 such that the power system 36 communicates power to the slip ring 50 then to the control system 34.\n\nReferring to FIG. 3A, one non-limiting embodiment of the vibration suppressor system 30 includes the first annular stator 40A, the second annular stator 40B with respective masses MA1, MA2 and MB1, MB2 which independently transit therein. The first annular stator 40A and the second annular stator 40B include a multitude of electro-magnets 52A, 52B arranged around each respective stator 40A, 40B. It should be understood that many different magnet configurations are possible, for example, a continuous iron portion with wire wound slots powered by the amplifier 34A. The multitude of electro-magnets 52A, 52B receive power from the amplifier 34A in response to the control system 34 to independently drive the masses MA1, MA2, MB1, MB2. Masses MA1, MA2 in this non-limiting embodiment operate to suppress 5P vibration such that for a rotor system 12 which operates at 1P of 4.3 Hz, the masses MA1, MA2 transit the first annular stator 40A at 21.5 Hz in a rotational direction opposite that of the main rotor system 12. Masses MB1, MB2 in this non-limiting embodiment operate to suppress 3P vibration such that for a rotor system 12 which operates at 1P of 4.3 Hz, the masses MB1, MB2 transit the second annular stator 40B at 12.9 Hz in a rotational direction the same as that of the main rotor system 12. It should be understood that this non-limiting embodiment is for a four-bladed main rotor system 12 and that other main rotor systems 12 as well as other rotational systems will also benefit therefrom.\n\nAs the first and second annular stator 40A, 40B are mounted to the main rotor system 12 for rotation therewith, the masses MA1, MA2, MB1, MB2 need only be driven at five revolutions per cycle of the rotor system (for masses MA1, MA2) and at three revolutions per cycle in the opposite direction (for masses MB1, MB2) to achieve the desired 4P frequency. That is, since the masses MA1, MA2, MB1, MB2 are, in the rotating reference system of the main rotor system 12 which rotates at one revolution per cycle (1P), the masses MA1, MA2, MB1, MB2 need only augment the rotational speed by the difference (3P+1P) to achieve the necessary 4P in the stationary reference system for masses MB1, MB2 which rotate in the direction of the rotor system 12 and 5P?1P to achieve the necessary 4P in the stationary reference system for masses MA1, MA2 which rotate in a direction opposite of the rotor system 12.\n\nThe first annular stator 40A and the second annular stator 40B are generally of a channel shape in cross-section (FIG. 3B) such that the respective masses MA1, MA2 and MB1, MB2 are guided therein as well as are retained therein when the electro-magnets 52A, 52B are unpowered. That is, the first annular stator 40A and the second annular stator 40B are shaped to retain the masses MA1, MA2, MB1, MB2 when centrifugal force is unavailable.\n\nAlthough only a single mass (e.g., mass MA 1) will be described in detail herein, it should be understood that each of the masses MA1, MA2, MB1, MB2 may be generally alike in configuration. Furthermore, each of the masses MA1, MA2 and MB1, MB2 provide the desired xP suppression by providing a particular masshere the masses MA1, MA2 may weigh approximately one pound (1 lb.), while the masses MB1, MB2 may weigh approximately two and one half pounds (2.5 lbs.) for stators 40A, 40B with a radius of approximately one foot. It should be understood that these dimensions are for example only and various arrangements may be provided in accordance with the present disclosure.\n\nReferring to FIG. 3C, each of the masses MA1, MA2, MB1, MB2 in this non-limiting embodiment generally include a first wheel 54, a second wheel 56, a truck 58 which supports the wheels 54, 56 and a conductor 60 (FIG. 3C). The conductor 60 may be poles (permanent magnets) for a brushless electric motor embodiment or a conductive element for an inductive motor embodiment. Bearings 62 or the like may be utilized to support the wheels 54, 56 on the truck 58. Each truck 58 represents an independent secondary analogous to the moving part of a linear electric motor.\n\nThe truck 58 and/or the conductor 60 may provide the majority of the mass to provide the required anti-vibration forces. Furthermore, either or both of the wheels 54, 56 may be utilized to carry the majority of the mass. For the non-limited embodiment where low bearing loads in the truck 58 are desired, either or both of the wheels 54, 56 may operate as the conductor, i.e. no separate conductive plate type conductor 60 need be provided on the truck 58. The other wheel 56, 54 may thereby carry the majority of the mass. That is, one wheel 54 is relatively light in weight and conductive to provide propulsion, while the other wheel 56 of the same truck 58 is heavy in weight to define the eccentric mass.\n\nReferring to FIG. 4A, each of the masses MA1, MA2, MB1, MB2 in this non-limiting embodiment includes a first wheel 80, a second wheel 82 and a truck 84 which supports the wheels 80, 82 with a radial-oriented conductor 86 (FIG. 4B) formed in part by the truck 84. At least a portion of the truck 84 forms the conductor 86 which is acted upon by a stator 88. Each stator 88 represents a primary analogous to a fixed portion of a linear electric motor. The stator 88 in this non-limiting embodiment is a wire wound slotted and laminated iron component.\n\nEach of the masses MA 1, MA2, MB1, MB2 represents the independent secondary analogous to the moving part of a linear electric motor. The conductor 86 may be manufactured of a conductive material such as copper or aluminum. In this non-limiting embodiment, the conductor 86 is oriented to be in-plane with the plane formed by the primary stator 88 such that the wheels 80, 82 need not provide propulsion. The wheels 80, 82 ride within an outer guide ring 90 (see FIGS. 4B and 4C). The truck 84 may form and/or include a relatively significant mass M between the wheels 80, 82 (FIG. 4C).\n\nReferring to FIG. 5A, each of the masses MA1, MA2, MB1, MB2 in this non-limiting embodiment are supported within an annular bearing 100A, 100B formed within an outer bearing support 102. Each of the masses MA1, MA2, MB1, MB2 in this non-limiting embodiment includes a radial-oriented conductor 104A, 104B formed in part by a truck 106A, 106B. At least a portion of the truck 106A, 106B forms the conductor 104A, 104B which is acted upon by a stator 110 which represents the primary analogous to a fixed portion of a linear electric motor.\n\nEach truck 106A, 106B may form a relatively significant eccentric mass M which is supported adjacent the annular bearing 100A, 100B (FIG. 5B). That is, each truck 106A, 106B forms an eccentric mass M which rides within the annular bearing 100A, 100B.\n\nAlternatively, each truck 106A?, 106B? forms an eccentric mass M which is arranged between the annular bearing 100A, 100B (FIG. 5C). This arrangement locates the eccentric mass M in a more radial outboard position which facilitates a lighter weight mass for an equivalent diameter annular bearing 100A, 100B.\n\nReferring to FIG. 6A, the two individual masses MA1, MA2 located on the first annular stator 40A and the two individual masses MB1, MB2 located on the second annular stator 40B (not shown) are independent controlled through primary sector power transmission. The sixty degree (60°)primary sectors in FIGS. 6A-6E facilitate the minimization of electronic components required to independently control the motion of each of the masses MA1, MA2 and MB1, MB2. Although only the first annular stator 40A with masses MA1, MA2 will be described in the examples herein, it should be understood that each of the two individual masses MB1, MB2 located on the second annular stator 40Bor additional annular statorsare generally alike in configuration and operation.\n\nThe primary sectors are independently commanded when only one mass MA 1, MB1 overlap that primary sector. In this way, one secondary mass MA1 is driven relative to the other mass MA2.\n\nIn the examples illustrated in FIGS. 6A-6E masses MA1, MA2 are close together; thus a large anti-vibration force is produced. At this instant the primary sector 1 propels mass MA2 and the primary sector 6 propels mass MA2 thus independently regulating the velocities of masses MA1, MA2. As the two masses MA1, MA2 move clockwise, their dimension precludes both masses MA1, MA2 from occupying the same primary sector at the same time. Notice on subsequent Figures, that MAR2 departs sector 2 before MA1 enters sector 2. This permits independent control of the motions of masses MA1, MA2. Notice that MA1 and MA2 can of any dimension since the positions of masses MA1, MA2 may be tracked with a sensor system and can not be entirely within the same primary sector at the same time.\n\nAs the masses MA 1, MA2 move around the first annular stator 40A, the primary sectors which are at the same azimuth as the respective masses MA1, MA2 are selectively powered to control the respective masses MA1, MA2.\n\nOn occasion one of the masses MA 1, MA2 may abridge two primary sectors (FIGS. 6B-6E) such that two primary sectors are powered and commanded to control the motion.\n\nReferring to FIG. 7A, each of the masses MA1, MA2, MB1, MB2 in this non-limiting embodiment generally include an independent wheel 64 in which the wheel 64 itself operates as the mass and the conducting secondary with no truck whatsoever. This eliminates the need for bearings. Each wheel 64 may travel within an outer guide ring 66 and an inner guide ring 68 which define a respective groove 66?, 68?. The inner guide ring 68 may be formed of electromagnets 70 which both power each wheel 64 as well as restrains each wheel 64 when not powered. It should be understood that other electro-magnet system arrangement may alternatively or additionally be utilized, e.g., the electro-magnet guide ring 70A may be the outer ring 66A (FIG. 7B).\n\nIn operation, the masses MB 1, MB2 (FIGS. 8A-8C) are propelled by the electro-magnets 52A within the annular stator 40B at a rotational speed greater than the rotational speed of the main rotor system 12 and appropriately positioned to yield a load vector P1 which is equal and opposite to the load vector R1 produced by the main rotor system 12. This counteracting load vector P1 may be interpreted as a vector which attempts to cancel or null the displacement of the main rotor system 12 and rotor shaft 24.\n\nFIGS. 8A-8C depict various operating positions of masses MB1, MB2. Masses MA1, MA2 operate in an analogous manner which therefore need not be described in further detail. The vibration suppressor system 30 controls the rotational speed of the masses MA1, MA2, MB1, MB2 to produce a counteracting load of the correct magnitude and phase to suppress vibrations.\n\nReferring to FIG. 8A, the masses MB1, MB2 are essentially adjacent and act in unison to produce a maximum force vector P1MAX. It should be understood that bumpers or such like may be provided to minimize impact between each mass MB 1, MB2, which may occur during some operational conditions.\n\nReferring to FIG. 8B, the masses MB1, MB2 define a right angle (90 degrees) therebetween thereby producing a force vector P1MAX/(sqrt(2)) that is a fraction of the magnitude of the maximum force vector.\n\nReferring to FIG. 8C, the masses MB1, MB2 are directly opposite (180 degree separation) and are essentially opposing to cancel the vectors produced by each of the masses MB1, MB2 such that essentially zero net force is generated at P1MIN.\n\nThe ability to independently vary the relative angular position of the masses is especially valuable in applications wherein the magnitude of the vibratory load active in/on the rotating system varies as a function of operating regime or operating speed. In a rotary-wing aircraft, for example, it is common to require the highest levels of vibration isolation in high speed forward flight i.e., where the rotor blades are experiencing the largest differential in aerodynamic loading from advancing to retreating sides of the rotor system. Consequently, it may be expected that the vibration suppressor system 30 produce the maximum load vector P1MAX (FIG. 8A). In yet another example, it is anticipated that the lowest levels of vibration isolation would occur in a loiter or hovering operating mode, where the rotor blades are exposed to the generally equivalent aerodynamic and gyroscopic affects. Consequently, it may be expected that the vibration suppressor system 30 a minimal load vector P1MIN (FIG. 8C).\n\nIt should be understood that relative positional terms such as forward, aft, upper, lower, above, below, and the like are with reference to the normal operational attitude of the vehicle and should not be considered otherwise limiting. \n\nAlthough particular step sequences are shown, described, and claimed, it should be understood that steps may be performed in any order, separated or combined unless otherwise indicated and will still benefit from the present disclosure. \n\nThe foregoing description is exemplary rather than defined by the limitations within. Many modifications and variations of the present disclosure are possible in light of the above teachings. The disclosed embodiments of this disclosure have been disclosed, however, one of ordinary skill in the art would recognize that certain modifications would come within the scope of this disclosure. It is, therefore, to be understood that within the scope of the appended claims, the disclosure may be practiced otherwise than as specifically described. For that reason the following claims should be studied to determine the true scope and content of this disclosure. | Sikorsky Aircraft Corporation,Stratford,CT,US | Sikorsky Aircraft Corporation | SIKORSKY AIRCRAFT CORPORATION | LOCKHEED MARTIN CORP. | Welsh, William A. | 1 | Carlson, Gaskey & Olds P.C. | NaN | Dinh, Tien / Kreiner, Michael | US | Alive | 12 | 2014 | US | 2 | 2013 | 2008-03-20 | 2008 | B64, F01, F16, G01, H02 | B64, F01, F16, G01, H02, Y10 | 416145 | 0745741 | 310081 | US4326158A | US5310137A | US5757662A | US6907800B1 | US7958801B2 | US4953098A | US5676025A | US7350749B2 | US4728837A | US2664763A | US4901573A | US5586505A | US6568291B1 | US7047109B2 | US20090180882A1 | US7492074B1 | US4218187A | US5497861A | US7942633B2 | US20050079056A1 | US3219120A | US5553514A | US6236934B1 | US4951514A | US5831354A | US6210099B1 | US7267029B2 | US7722322B2 | US20010035068A1 | US20090116963A1 | JP61164109A | US20060083617A1 | US3538469A | US5372478A | 34 | Kayler, Kimberly. LORD Corporation's Technology to be Presented at American Helicopter Society's Annual Forum 67. Apr. 28, 2011. Retrieved from <http://www.lord.com/News-Center/News-Stories/LORD-Technology-Presented-at-American-Helicopter-Societys-Annual-Forum-67.xml>. | Anonymous. Carolina Transparency: Dual Frequency Hub-Mounted Vibration Suppressor. Date unknown. Retrieved from <http://www.carolinatransparency.com/earmarks/popup.php?id=62098>. Retrieved Sep. 21, 2011. | Kayler, Kimberly. LORD Selected to Team with Sikorsky for Hub-Mounted Vibration. Jan. 29, 2009. Retrieved from <http://www.lord.com/News-Center/Press-Releases/LORD-Selected-to-Team-with-Sikorsky-for-Hub-Mounted-Vibration-Suppression-(HMVS).xml>. | 3 | US10167079B2 | US10308355B2 | US10400851B2 | US10443674B2 | US10443675B2 | US10527123B2 | US10543910B2 | US10619698B2 | US10654565B2 | US10717521B2 | US10822076B2 | US10974822B2 | US11021241B2 | US11040770B2 | US11396369B2 | US11440650B2 | US11472540B2 | US11555528B2 | US20160325828A1 | US9212559B2 | WO2018187178A1 | WO2019005249A1 | WO2019005250A1 | 23 | 2022-06-30 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 8TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1552); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY FEE PAYMENT YEAR 8 | 2018-07-02 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) FEE PAYMENT YEAR 4 | 2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE | US8920125B2 | US20090236468A1 | US20130164132A1 | US8403643B2 | 20090924US20090236468A1 |
| 2 | US8920781B2 | Carrier particles for use in dry powder inhalers | GB19951841A | GB199521937A | WO1996GB215A | US1997875391A | US2000680863A | US2002306865A | US2005202741A | 1995-01-31 | 1995-10-26 | 1996-01-31 | 1997-09-25 | 2000-10-06 | 2002-11-27 | 2005-08-11 | US2010748275A | 2010-03-26 | B2 | 2014-12-30 | Staniforth John Nicholas|Bath, GB | Vectura Limited,Chippenham, Wiltshire,GB | Staniforth John Nicholas,Bath,GB | VECTURA LTD | STANIFORTH JOHN NICHOLAS | B07 C | P32 N | P34 N | B01-B03 | B04-B01B | B04-C01 | B04-D01 | B05-B01P | B10-B02B | B10-B03B | B12-M01B | B12-M11G | B14-D01 | A61K000914 | A61K000900 | A61K000912 | A61K000916 | A61K000972 | A61K0031195 | A61K00317012 | A61P001100 | A61K00090075 | A61K000900 | A61K000912 | A61K0009145 | A61K00317012 | A61P001100 | A61P001106 | A61P001108 | 424046 | 424489 | 424490 | 424493 | 424499 | 514951 | NaN | A powder for use in a dry powder inhaler includes active particles and carrier particles for carrying the active particles. The powder further includes additive material on the surfaces of the carrier particles to promote the release of the active particles from the carrier particles on actuation of the inhaler. The powder is such that the active particles are not liable to be released from the carrier particles before actuation of the inhaler. The inclusion of additive material in the powder has been found to give an increased respirable fraction of the active material. | Carrier particles for use in dry powder inhalers | The invention claimed is: \n1. A powder for use in a dry powder inhaler, the powder comprising active particles and carrier particles for carrying the active particles, the powder further including particles of additive material attached to the surfaces of the carrier particles, wherein particles of additive material adhere to the high energy sites on the surfaces of the carrier particles and wherein the powder comprises more than one additive material, wherein the additive material includes one or more surface active materials; wherein additive particles are also present as agglomerates and act as carriers of the active particles and are separate from or separable from the surfaces of the carrier particles with active particles attached to surfaces of the agglomerates.\n2. A powder according to claim 1 wherein the powder includes not more than 5% by weight of additive material based on the weight of the powder.\n3. A powder according to claim 2 wherein the powder includes not more than 2% by weight of additive material based on the weight of the powder.\n4. A powder according to 1 wherein the carrier particles are comprised of one or more crystalline sugars.\n5. A powder according to claim 4 wherein the carrier particles are particles of lactose.\n6. A powder according to claim 1 wherein the additive material consists of physiologically acceptable material.\n7. A powder according to claim 1, wherein the additive material is an anti-adherent material.\n8. A powder according to claim 1, wherein the additive material is an anti-friction agent.\n9. A powder according to claim 1, wherein the additive material includes magnesium stearate.\n10. A powder according to claim 1, wherein the additive particles are angular or dendritic in shape.\n11. A powder according to claim 1, wherein the additive particles are plate-like particles.\n12. A powder according to claim 1, wherein the powder consists of not less than 0.1% by weight of additive particles based on the weight of the carrier particles.\n13. A powder according to claim 1, wherein the additive material forms a discontinuous covering on the surfaces of the carrier particles.\n14. A powder according to claim 1, wherein the active particles include a ?2-agonist.\n15. A method of producing particles according to claim 1, the method including the step of mixing carrier particles of a size suitable for use in dry powder inhalers with additive material which becomes attached to the surfaces of the carrier particles.\n16. A method according to claim 15 wherein the method further includes the step of treating the carrier particles to dislodge small grains from the surfaces of the carrier particles, without substantially changing the size of the carrier particles during the treatment.\n17. A method according to claim 16 wherein the small grains become reattached to the surfaces of the carrier particles.\n18. A powder for use in a dry powder inhaler, the powder including additive and carrier particles for carrying the additive particles, the powder further including active particles which adhere to the additive particles on the carrier particles, wherein the additive material is magnesium stearate, wherein the additive material is present in an amount of not more than 1% by weight based on the weight of the powder; wherein additive particles are also present as agglomerates and act as carriers of the active particles and are separate from or separable from the surfaces of the carrier particles with active particles attached to surfaces of the agglomerates.\n19. A powder according to claim 1, wherein the more than one additive material comprises magnesium stearate.\n20. A powder according to claim 1, wherein the additive particles are non-spherical.\n21. A powder according to claim 20, wherein the particles are plate-like, angular or dendritic.\n22. A powder according to claim 18, wherein the additive particles are non-spherical.\n23. A powder according to claim 22, wherein the particles are plate-like, angular or dendritic.\n24. A powder for use in a dry powder inhaler, the powder comprising: \nactive particles; \ncarrier particles for carrying the active particles; and \nparticles of additive material attached to surfaces of the carrier particles; \nwherein the particles of additive material adhere to high energy sites on the surfaces of the carrier particles and provide a discontinuous covering for the carrier particles, wherein the powder comprises more than one additive material in the form of a powder, and wherein the additive material includes one or more surface active materials; wherein additive particles are also present as agglomerates and act as carriers of the active particles and are separate from or separable from the surfaces of the carrier particles with active particles attached to surfaces of the agglomerates. | 24 | 1. A powder for use in a dry powder inhaler, the powder comprising active particles and carrier particles for carrying the active particles, the powder further including particles of additive material attached to the surfaces of the carrier particles, wherein particles of additive material adhere to the high energy sites on the surfaces of the carrier particles and wherein the powder comprises more than one additive material, wherein the additive material includes one or more surface active materials; wherein additive particles are also present as agglomerates and act as carriers of the active particles and are separate from or separable from the surfaces of the carrier particles with active particles attached to surfaces of the agglomerates. | 1. A powder for use in a dry powder inhaler, the powder comprising active particles and carrier particles for carrying the active particles, the powder further including particles of additive material attached to the surfaces of the carrier particles, wherein particles of additive material adhere to the high energy sites on the surfaces of the carrier particles and wherein the powder comprises more than one additive material, wherein the additive material includes one or more surface active materials; wherein additive particles are also present as agglomerates and act as carriers of the active particles and are separate from or separable from the surfaces of the carrier particles with active particles attached to surfaces of the agglomerates. | 18. A powder for use in a dry powder inhaler, the powder including additive and carrier particles for carrying the additive particles, the powder further including active particles which adhere to the additive particles on the carrier particles, wherein the additive material is magnesium stearate, wherein the additive material is present in an amount of not more than 1% by weight based on the weight of the powder; wherein additive particles are also present as agglomerates and act as carriers of the active particles and are separate from or separable from the surfaces of the carrier particles with active particles attached to surfaces of the agglomerates. | 24. A powder for use in a dry powder inhaler, the powder comprising: active particles; carrier particles for carrying the active particles; and particles of additive material attached to surfaces of the carrier particles; wherein the particles of additive material adhere to high energy sites on the surfaces of the carrier particles and provide a discontinuous covering for the carrier particles, wherein the powder comprises more than one additive material in the form of a powder, and wherein the additive material includes one or more surface active materials; wherein additive particles are also present as agglomerates and act as carriers of the active particles and are separate from or separable from the surfaces of the carrier particles with active particles attached to surfaces of the agglomerates. | This application is a Continuation of Ser. No. 11/202,741, filed 11 Aug. 2005 in the United States, which is a Continuation of Ser. No. 10/306,865, now issued as U.S. Pat. No. 7,011,818, filed 27 Nov. 2002 in the United States, which is a Continuation of Ser. No. 09/680,863, now issued as U.S. Pat. No. 6,521,260, filed 6 Oct. 2000 in the United States which is a Continuation of Ser. No. 08/875,391, now issued as U.S. Pat. No. 6,153,224, filed 25 Sep. 1997 in the United States which is a National Stage of PCT/GB96/00215, filed 31 Jan. 1996 which claims benefit of United Kingdom application no. 9521937.4 filed 26 Oct. 1995 and United Kingdom application no. 9501841.2 filed 31 Jan. 1995 and which applications are incorporated herein by reference. To the extent appropriate, a claim of priority is made to each of the above disclosed applications. \n\nEmbodiments of the invention will now be described by way of example with reference to the accompanying drawings, of which: \n\nFIG. 1 shows a section through a carrier particle including additive particles on its surfaces;\n\nFIG. 2 is a perspective view of a dry powder inhaler;\n\nFIG. 3 is a sectional diagram of a twin stage impinger; and\n\nFIGS. 4 a & 4b show the effect of a milling treatment on the carrier particle of FIG. 1.\n\nThis invention relates to carrier particles for use in dry powder inhalers. More particularly the invention relates to a method of producing such particles, to a dry powder incorporating the particles and to the particles themselves. \n\nInhalers are well known devices for administering pharmaceutical products to the respiratory tract by inhalation. Inhalers are widely used particularly in the treatment of diseases of the respiratory tract. \n\nThere are a number of types of inhaler currently available. The most widely used type is a pressurised metered dose inhaler (MDI) which uses a propellant to expel droplets containing the pharmaceutical product to the respiratory tract. Those devices are disadvantageous on environmental grounds as they often use CFC propellants, and on clinical grounds related to the inhalation characteristics of the devices. \n\nAn alternative device to the MDI is the dry powder inhaler. The delivery of dry powder particles of pharmaceutical products to the respiratory tract presents certain problems. The inhaler should deliver the maximum possible proportion of the active particles expelled to the lungs, including a significant proportion to the lower lung, preferably at the low inhalation capabilities to which some patients, especially asthmatics, are limited. It has been found, however, that, when currently available dry powder inhaler devices are used, in many cases only about 10% of the active particles that leave the device on inhalation are deposited in the lower lung. More efficient dry powder inhalers would give clinical benefits. \n\nThe type of dry powder inhaler used is of significant importance to the efficiency of delivery over a range of airflow conditions of the active particles to the respiratory tract. Also, the physical properties of the active particles used affect both the efficiency and reproducibility of delivery of the active particles and the site of deposition in the respiratory tract. \n\nOn exit from the inhaler device, the active particles should form a physically and chemically stable aerocolloid which remains in suspension until it reaches a conducting bronchiole or smaller branching of the pulmonary tree or other absorption site preferably in the lower lung. Once at the absorption site, the active particle should be capable of efficient collection by the pulmonary mucosa with no active particles being exhaled from the absorption site. \n\nThe size of the active particles is important. For effective delivery of active particles deep into the lungs, the active particles should be small, with an equivalent aerodynamic diameter substantially in the range of 0.1 to 5 ?m, approximately spherical and monodispersed in the respiratory tract. Small particles are, however, thermodynamically unstable due to their high surface area to volume ratio, which provides significant excess surface free energy and encourages particles to agglomerate. In the inhaler, agglomeration of small particles and adherence of particles to the walls of the inhaler are problems that result in the active particles leaving the inhaler as large agglomerates or being unable to leave the inhaler and remaining adhered to the interior of the inhaler. \n\nThe uncertainty as to the extent of agglomeration of the particles between each actuation of the inhaler and also between different inhalers and different batches of particles, leads to poor dose reproducibility. It has been found that powders are reproducibly fluidisable, and therefore reliably removable from an inhaler device, when the particles have a diameter greater than 90 ?m. \n\nTo give the most effective dry powder aerosol, therefore, the particles should be large while in the inhaler, but small when in the respiratory tract. \n\nIn an attempt to achieve that situation, one type of dry powder for use in dry powder inhalers may include carrier particles to which the fine active particles adhere whilst in the inhaler device, but which are dispersed from the surfaces of the carrier particles on inhalation into the respiratory tract to give a fine suspension. The carrier particles are often large particles greater than 90 ?m in diameter to give good flow properties as indicated above. Small particles with a diameter of less than 10 ?m may be deposited on the wall of the delivery device and have poor flow and entrainment properties leading to poor dose uniformity. \n\nThe increased efficiency of redispersion of the fine active particles from the agglomerates or from the surfaces of carrier particles during inhalation is regarded as a critical step in improving the efficiency of the dry powder inhalers. \n\nIt is known that the surface properties of a carrier particle are important. The shape and texture of the carrier particle should be such as to give sufficient adhesion force to hold the active particles to the surface of the carrier particle during fabrication of the dry powder and in the delivery device before use, but that force of adhesion should be low enough to allow the dispersion of the active particles in the respiratory tract. \n\nIn order to reduce the force of adhesion between carrier particles and active particles, it has been proposed to add a ternary component. In particular, using carrier particles of lactose and active particles of salbutamol, it has been proposed to add particles of magnesium stearate or Aerosil 200 (trade name of Degussa for colloidal silicon dioxide) in an amount of 1.5% by weight based on the weight of the carrier particles to a lactose-salbutamol mix. \n\nThe conclusion of that proposal, however, was that, although the adhesion between the carrier particles and the active particles was reduced by the presence of the additive particles, the addition of the additive particles was undesirable. \n\nIt is an object of the invention to provide a method for producing carrier particles and a powder for use in dry powder inhalers, and to provide carrier particles and a powder that mitigates the problems referred to above. \n\nWe have found that, contrary to the teaching of the prior art referred to above, the presence of additive particles which are attached to the surfaces of the carrier particles to promote the release of the active particles from the carrier particles is advantageous provided that the additive particles are not added in such a quantity that the active particles segregate from the surfaces of the carrier particles during fabrication of the dry powder and in the delivery device before use. Furthermore, we have found that the required amount of the additive particles is surprisingly small and that, if a greater amount is added, there will be no additional benefit in terms of inhalation performance but it will adversely affect the ability to process the mix. The required amount of additive particles varies according to the composition of the particlesin the case where the additive particles are of magnesium stearate (that being a material that may be used but is not preferred), we have found that an amount of 1.5 percent by weight based on the total weight of the powder is too great and causes premature segregation of the active particles from the carrier particles. We believe that the same considerations apply in the case of Aerosil 200. \n\nThe present invention provides a powder for use in a dry powder inhaler, the powder including active particles and carrier particles for carrying the active particles, the powder further including additive material on the surfaces of the carrier particles to promote the release of the active particles from the carrier particles on actuation of the inhaler, the powder being such that the active particles are not liable to be released from the carrier particles before actuation of the inhaler. \n\nActuation of the inhaler refers to the process during which a dose of the powder is removed from its rest position in the inhaler, usually by a patient inhaling. That step takes place after the powder has been loaded into the inhaler ready for use. \n\nIn this specification we give many examples of powders for which the amount of the additive material is so small that the active particles are not liable to be released from the carrier particles before actuation of the inhaler but are released during use of the inhaler. If it is desired to test whether or not the active particles of a powder are liable to be released from the carrier particles before actuation of the inhaler a test can be carried out. A suitable test is described at the end of this specification; a powder whose post-vibration homogeneity measured as a percentage coefficient of variation, after being subjected to the described test, is less than about 5% can be regarded as acceptable. In an example of the invention described below the coefficient is about 2% which is excellent, whereas in an example also described below and employing 1.5% by weight of magnesium stearate the coefficient is about 15% which is unacceptable. \n\nThe surface of a carrier particle is not usually smooth but has asperities and clefts in its surface. The site of an asperity or of a cleft is believed to be an area of high surface energy. The active particles are preferentially attracted to and adhere most strongly to those high energy sites causing uneven and reduced deposition of the active particles on the carrier surface. If an active particle adheres to a high energy site, it is subjected to a greater adhesion force than a particle at a lower energy site on the carrier particle and will therefore be less likely to be able to leave the surface of the carrier particle on actuation of the inhaler and be dispersed in the respiratory tract. It would therefore be highly advantageous to decrease the number of those high energy sites available to the active particles. \n\nAdditive material is attracted to and adheres to the high energy sites on the surfaces of the carrier particles. On introduction of the active particles, many of the high energy sites are now occupied, and the active particles therefore occupy the lower energy sites on the surfaces of the carrier particles. That results in the easier and more efficient release of the active particles in the airstream created on inhalation, thereby giving increased deposition of the active particles in the lungs. \n\nHowever, as indicated above, it has been found that the addition of more than a small amount of additive material is disadvantageous because of the adverse effect on the ability to process the mix during commercial manufacture. \n\nIt is also advantageous for as little as possible of the additive material to reach the lungs on inhalation of the powder. Although the additive material will most advantageously be one that is safe to inhale into the lungs, it is still preferred that only a very small proportion, if any, of the additive material reaches the lung, in particular the lower lung. The considerations that apply when selecting the additive material and other features of the powder are therefore different from the considerations when a third component is added to carrier and active material for certain other reasons, for example to improve absorption of the active material in the lung, in which case it would of course be advantageous for as much as possible of the additive material in the powder to reach the lung. \n\nIn the present case, as indicated above, there will be an optimum amount of additive material, which amount will depend on the chemical composition and other properties of the additive material. However, it is thought that for most additives the amount of additive material in the powder should be not more than 10%, more advantageously not more than 5%, preferably not more than 4% and for most materials will be not more than 2% or less by weight based on the weight of the powder. In certain Examples described below the amount is about 1%. \n\nAdvantageously the additive material is an anti-adherent material and will tend to decrease the cohesion between the active particles and the carrier particles. \n\nAdvantageously the additive material is an anti-friction agent (glidant) and will give better flow of powder in the dry powder inhaler which will lead to better dose reproducibility from the inhaler. \n\nWhere reference is made to an anti-adherent material, or to an anti-friction agent, the reference is to include those materials which will tend to decrease the cohesion between the active particles and the carrier particles, or which will tend to improve the flow of powder in the inhaler, even though they may not usually be referred to as an anti-adherent material or an anti-friction agent. For example, leucine is an anti-adherent material as herein defined and is generally thought of as an anti-adherent material but lecithin is also an anti-adherent material as herein defined, even though it is not generally thought of as being anti-adherent, because it will tend to decrease the cohesion between the active particles and the carrier particles. \n\nThe carrier particles may be composed of any pharmacologically inert material or combination of materials which is acceptable for inhalation. Advantageously, the carrier particles are composed of one or more crystalline sugars; the carrier particles may be composed of one or more sugar alcohols or polyols. Preferably, the carrier particles are particles of lactose. \n\nAdvantageously, substantially all (by weight) of the carrier particles have a diameter which lies between 20 ?m and 1000 ?m, more preferably 50 ?m and 1000 ?m. Preferably, the diameter of substantially all (by weight) of the carrier particles is less than 355 ?m and lies between 20 ?m and 250 ?m. Preferably at least 90% by weight of the carrier particles have a diameter between from 60 ?m to 180 ?m. The relatively large diameter of the carrier particles improves the opportunity for other, smaller particles to become attached to the surfaces of the carrier particles and to provide good flow and entrainment characteristics and improved release of the active particles in the airways to increase deposition of the active particles in the lower lung. \n\nIt will be understood that, throughout, the diameter of the particles referred to is the aerodynamic diameter of the particles. \n\nAdvantageously, the additive material consists of physiologically acceptable material. As already indicated, it is preferable for only small amounts of additive material to reach the lower lung, and it is also highly preferable for the additive material to be a material which may be safely inhaled into the lower lung where it may be absorbed into the blood stream. That is especially important where the additive material is in the form of particles. \n\nThe additive material may include a combination of one or more materials. \n\nIt will be appreciated that the chemical composition of the additive material is of particular importance. \n\nPreferably the additive material is a naturally occurring animal or plant substance. \n\nAdvantageously the additive material includes one or more compounds selected from amino acids and derivatives thereof, and peptides and polypeptides having molecular weight from 0.25 to 1000 KDa, and derivatives thereof. Amino acids, peptides or polypeptides and their derivatives are both physiologically acceptable and give acceptable release of the active particles on inhalation. \n\nIt is particularly advantageous for the additive material to comprise an amino acid. Amino acids have been found to give, when present in low amounts in the powders as additive material, high respirable fraction of the active materials with little segregation of the powder and also with very little of the amino acid being transported into the lower lung. In respect of leucine, a preferred amino acid, it is found that, for example, for an average dose of powder only about 10 ?g of leucine would reach the lower lung. The additive material may comprise one or more of any of the following amino acids: leucine, isoleucine, lysine, valine, methionine, phenylalanine. The additive may be a salt or a derivative of an amino acid, for example aspartame or acesulfame K. Preferably the additive particles consist substantially of leucine, advantageously L-leucine. As indicated above, leucine has been found to give particularly efficient release of the active particles on inhalation. Whilst the L-form of the amino acids is used in Examples described below, the D- and DL-forms may also be used. \n\nThe additive material may include one or more water soluble substances. This helps absorption of the substance by the body if the additive reaches the lower lung. The additive material may include dipolar ions, which may consist of zwitterions. \n\nAlternatively, the additive material may comprise particles of a phospholipid or a derivative thereof. Lecithin has been found to be a good material for the additive material. \n\nThe additive material may include or consist of one or more surface active materials, in particular materials that are surface active in the solid state, which may be water soluble, for example lecithin, in particular soya lecithin, or substantially water insoluble, for example solid state fatty acids such as lauric acid, palmitic acid, stearic acid, erucic acid, behenic acid, or derivatives (such as esters and salts) thereof. Specific examples of such materials are: magnesium stearate; sodium stearyl fumarate; sodium stearyl lactylate; phospatidylcholines, phosphatidylglycerols and other examples of natural and synthetic lung surfactants; Liposomal formulations; lauric acid and its salts, for example, sodium lauryl sulphate, magnesium lauryl sulphate; triglycerides such as Dynsan 118 and Cutina HR; and sugar esters in general. \n\nOther possible additive materials include talc, titanium dioxide, aluminium dioxide, silicon dioxide and starch. \n\nAs indicated above, it is most important for the additive material to be added in a small amount. For example, magnesium stearate is highly surface active and should therefore be added in particularly small amounts; phosphatidylcholines and phosphatidylglycerols on the other hand are less active and can usefully be added in greater amounts; in respect of leucine, which is still less active, an addition of 2% by weight leucine based on the weight of the powder gives good results in respect of the respirable fraction of the active particles, low segregation and low amount of leucine reaching the lower lung; an addition of a greater amount does not improve the results and in particular does not significantly improve the respirable fraction and therefore whilst even with 6% leucine a reasonable result is obtained that is not preferred since it results in an increased quantity of additive material being taken into the body and will adversely affect the processing properties of the mix. \n\nThe additive material will often be added in particulate form but it may be added in liquid or solid form and for some materials, especially where it may not be easy to form particles of the material and/or where those particles should be especially small, it may be preferred to add the material in a liquid, for example as a suspension or a solution. Even then, however, the additive material of the finished powder may be in particulate form. An alternative possibility, however, that is within the scope of the invention is to use an additive material which remains liquid even in the final essentially particulate material which can still be described as a dry powder. \n\nIn some cases improved clinical benefits will be obtained where the additive material is not in the form of particles of material. In particular, the additive material is less likely to leave the surface of the carrier particle and be transported into the lower lung. \n\nWhere the additive material of the finished powder is particulate, the nature of the particles may be significant. The additive particles may be non-spherical in shape. In Examples 1 to 3 below, the additive particles are plate-like particles. Alternatively the additive particles may be angular for example prisms, or dendritic in shape. Additive particles which are non-spherical may be easier to remove from the surfaces of the carrier particles than spherical, non-angular particles and plate-like particles may give improved surface interaction and glidant action between the carrier particles. \n\nThe surface area of the additive particles is also thought to be important. The surface area of the additive particles, as measured using gas absorption techniques, is preferably at least 5 m 2g?1. In many cases it is found that additive material comprising small plate-like particles is preferred.\n\nAdvantageously, at least 95% by weight of the additive particles have a diameter less than 150 ?m, more advantageously less than 100 ?m, preferably less than 50 ?m. Preferably, the mass median diameter of the additive particles is not more than about 10 ?m. The additive particles preferably have a mass median diameter less than the mass median diameter of the carrier particles and will usually have a mass median diameter of approximately between a tenth and a hundredth that of the carrier particles. The diameter of the particles may be calculated by laser diffraction or by another method by which the aerodynamic diameter of the particles can be determined. \n\nThe ratio in which the carrier particles, additive material and active particles are mixed will, of course, depend on the type of inhaler device used, the type of active particles used and the required dose. As indicated above, the amount of additive material is of particular importance. Advantageously the amount is in the range of from 0.1 to 10% by weight of the additive material based on the weight of the carrier particles. For the examples given below, the powder preferably consists of not less than 0.1% by weight of additive material based on the weight of the carrier particles and the powder preferably consists of at least 0.1% by weight of active particles based on the weight of the powder. Furthermore, the carrier particles are preferably present in an amount of at least 90%, more preferably at least 95%, by weight based on the weight of the powder. \n\nConventional calculations of the extent of surface coverage of the carrier particles by the additive material shows that for the preferred carrier particles and preferred additive materials mixed in their preferred amounts, the amount of additive material is much more than that necessary to provide a monolayer coating of the carrier particle. For example, in the case of Example 1 described below, calculation shows that a small fraction of a percent of leucine by weight is sufficient to provide a monolayer coating, whereas 1% leucine by weight is employed. Furthermore, it is found that even with 1% leucine there is no coating of the carrier particles in the sense in which that word is normally used in the art, namely to refer to a continuous envelope around the carrier particle; rather inspection of the carrier particles under an electron microscope shows much of the surface of each lactose particle remaining exposed with leucine particles covering only limited portions of each lactose particle and forming a discontinuous covering on each lactose particle. It is believed that the presence of such a discontinuous covering, as opposed to a coating is an important and advantageous feature of the present invention. \n\nPreferably the additive material, whilst providing only a discontinuous covering for the carrier particles, does saturate the surfaces of the carrier particles in the sense that even if more additive material were provided substantially the same covering of the carrier particles would be achieved. When the additive material in the finished powder is particulate, some of the additive particles, either individually or as agglomerates, may act as carriers of active particles and may be separate from or may separate from the surfaces of the carrier particles with active particles attached to their surfaces. The dimensions of the combined active particle and additive particle may still be within the optimum values for good deposition in the lower lung. It is believed that active particles which adhere to the additive particles on the carrier particles may in some cases be preferentially released from the surfaces of the carrier particles and thereafter be deposited in the lower lung without the additive particles. \n\nAdvantageously, the mass median diameter of the active particles is not more than 10 ?m, preferably not more than 5 ?m. The particles therefore give a good suspension on redispersion from the carrier particles and are delivered deep into the respiratory tract. Where the active particles are not spherical, the diameter of the particles may be calculated by laser diffraction or another method by which the aerodynamic diameter of the particles can be determined. \n\nThe active material referred to throughout the specification will be material of one or a mixture of pharmaceutical product(s). It will be understood that the term active material includes material which is biologically active, in the sense that it is able to increase or decrease the rate of a process in a biological environment. The pharmaceutical products include those products which are usually administered orally by inhalation for the treatment of disease such as respiratory disease eg. ?-agonists, salbutamol and its salts, salmeterol and its salts. Other pharmaceutical products which could be administered using a dry powder inhaler include peptides and polypeptides, such as DNase, leucotrienes and insulin. \n\nThe active particles may include a ? 2-agonist which may be terbutaline, a salt of terbutaline, for example terbutaline sulphate, or a combination thereof or may be salbutamol, a salt of salbutamol or a combination thereof. Salbutamol and its salts are widely used in the treatment of respiratory disease. The active particles may be particles of salbutamol sulphate. The active particles may be particles of ipatropium bromide.\n\nThe active particles may include a steroid, which may be beclomethasone dipropionate or may be Fluticasone. The active principle may include a cromone which may be sodium cromoglycate or nedocromil. The active principle may include a leukotriene receptor antagonist. \n\nThe active particles may include a carbohydrate, for example heparin. \n\nAccording to the invention, there are provided particles for use in a powder as described above, the particles including carrier particles of a first composition and of a size suitable for use in a dry powder inhaler and additive material of a second composition, the additive material being attached to the surfaces of the carrier particles. \n\nIn a general aspect, the invention also provides a powder for use in a dry powder inhaler, the powder including active particles and carrier particles for carrying the active particles wherein the powder further includes additive material which is attached to the surfaces of the carrier particles to promote the release of the active particles from the carrier particles. \n\nAccording to the invention, there is also provided a method of producing particles suitable for use as particles in dry powder inhalers, the method including the step of mixing carrier particles of a size suitable for use in dry powder inhalers with additive material which becomes attached to the surfaces of the carrier particles. \n\nAdditive material, which may be in liquid form or may comprise additive particles, or agglomerates of additive particles, may be introduced to a sample of carrier particles, which may have been treated as described below, and the mixture blended to allow the additive material to become attached to the surfaces of the carrier particles. \n\nAs indicated above, the exact ratio in which the carrier particles and the additive particles are mixed will, of course, depend on the type of device and the type of active particles used. Also as indicated above, the proportion of the additive material in the powder is of particular importance. \n\nThe size of the carrier particles is an important factor in the efficiency of the inhaler, and an optimum, or near optimum, range of size of particles is preferably selected. Therefore, the method advantageously further includes the step of selecting from a sample of carrier particles an advantageous range of size of carrier particles prior to the mixing step and, in the case where the additive material is in the form of particles when it is mixed with the carrier particles, preferably also includes the step of selecting from a sample of additive particles an advantageous range of size of additive particles prior to the mixing step. The step of selecting an advantageous range of size may be a sieving step. \n\nAdvantageously the additive material and the carrier particles are mixed for between 0.1 hours and 0.5 hours. The particles may be mixed using a tumbling blender (for example a Turbula Mixer). \n\nAdvantageously, the method further includes the step of treating the carrier particles to dislodge small grains from the surfaces of the carrier particles, without substantially changing the size of the carrier particles during the treatment. \n\nAs indicated above, the surface of a carrier particle is not usually smooth but has asperities and clefts in the surface. As a result, the surfaces have areas of high surface energy to which active particles are preferentially attached. An active particle at a high energy site is less likely to be able to leave the surface and be dispersed in the respiratory tract than an active particle at a site of lower surface energy. During the treatment referred to immediately above, asperities are removed as small grains, thus removing active sites associated with the asperities. \n\nAdvantageously, the mixing step is prior to the treatment step. The additive material may therefore be added in the form of large particles which are broken into smaller particles during the treatment. Alternatively the treatment may be carried out before the addition of the additive material or, alternatively, after the addition of the additive material and of the active particles. \n\nAdvantageously, the small... | Vectura Limited,Chippenham, Wiltshire,GB | Staniforth John Nicholas,Bath,GB | Vectura Limited | Staniforth John Nicholas | VECTURA GROUP PLC | VECTURA GROUP PLC | Staniforth, John Nicholas | 1 | Merchant & Gould P.C. | NaN | Haghighatian, Mina | US | Dead | 12 | 2014 | US | 3 | 2010 | 1995-01-31 | 1995 | A61 | A61 | 424046 | 424489 | 424490 | 424493 | 424499 | 514951 | US6521260B1 | US7744855B2 | WO1995000127A1 | ZA199400155A | EP239798A1 | WO1995011666A1 | GB1242211A | US7718163B2 | US20030185764A1 | US2533065A | US5478578A | WO1994013271A1 | WO1987005213A1 | EP20072979A1 | EP124493A2 | US6153224A | GB2269992A | WO1991014422A1 | GB905723A | GB1310527A | GB786499A | US6884794B2 | US5376386A | WO1994004133A1 | GB1230087A | GB2240337A | GB95219374X | WO1993011746A1 | WO1991011173A1 | EP2213279A2 | US7223748B2 | US7541022B2 | US5642728A | WO1995000128A1 | WO1996023485A1 | SE9203743A | GB1242212A | US3957965A | GB1381872A | EP187433A1 | GB1132583A | EP1283160A1 | US7011818B2 | US5506203A | US20030133880A1 | US5972388A | ZA199400155B | WO1992008447A1 | EP606486A1 | EP100751197A1 | US20030175214A1 | GB95219374A | ZA94155B | SE92037431B | 54 | Ahmed Particle Interactions in Multicomponent Systems. (Ph.D. Thesis, University of bath, 1989), pp. 1-376. | Ganderton. The Generation of Respirable clouds form coarse powder aggregates. Journal of Biopharmaceutical Sciences. vol. 3 (1/2), 1992, pp. 101-105. | Kassem. Generation of Deeply Inspirable clouds from dry powder mixtures. Ph. D. Thesis. Department of Pharmacy. Kings College, University of London, 1990. pp. 1-275. | Glaxo Opposition Against European Patent 1232745 in the Name of Vectura Limited, Aug. 24, 2009. | Norton Opposition Against European Patent No. 1 232 745, Norton Healthcare Ltd. Aug. 2009. | European Search ReportCorresponding application No. EP 06 08 4066. Mailed Mar. 26, 2009. | AstraZeneca AB Notice of Opposition against European Patent No. 1 666 023 in the name of Vectura Limited, filed Jul. 4, 2012. | Staniforth, J. et al. Interparticle forces in binary and ternary ordered powder mixes, J. Pharm. Pharmacol., vol. 34, 1982, pp. 141-145. 15 | Brindley et al., Design, Manufacture and Dose Consistenty of the Serevent Diskus Inhaler, Pharmaceutical Technology Europe, Jan. 1995, seven pages. | Rowe et al., Handbook of Pharmaceutical Excipients, Royal Pharmaceutical Society of Great Britain, Fifth Edition, Pharmaceutical Press, 2007 pp. 389-395. | Extended European Search Report for corresponding European Patent Application No. 10075119.7 mailed Aug. 25, 2010. | Reply to Grounds of Appeal for corresponding European Patent No. 1232745, Oct. 8, 2010. | Zeng, X. et al. Particulate Interactions in Dry Powder Formulations for Inhalation, Taylor & Francis, London & New York, 2001, pp. 220-224. | 13 | US10561613B2 | US20160243039A1 | WO2022047047A1 | 3 | 2019-02-26 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - 2018-12-30 | 2019-02-04 STCH INFORMATION ON STATUS: PATENT DISCONTINUATION - PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362 | 2019-02-04 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | 2018-08-13 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | US8920781B2 | AT256450T | AT355822T | AT526946T | AU199645456A | AU699131B | BG101858A | BR199607490A | BRPI9607490B8 | BRPI9612950B1 | BRPI9612950B8 | CA2211874A1 | CA2211874C | CN1179097A | CN1303974C | CZ199702443A3 | CZ294259B6 | DE69631119D1 | DE69631119T2 | DE69636961D1 | DE69636961T2 | DK1232745T3 | DK1666023T3 | DK806938T3 | EA20199700153A1 | EA352B1 | EE199700176A | EP1159955A1 | EP1232745A1 | EP1232745B1 | EP1666023A2 | EP1666023A3 | EP1666023B1 | EP2213279A2 | EP2213279A3 | EP2258342A2 | EP2258342A3 | EP806938A1 | EP806938B1 | ES2213172T3 | ES2278828T3 | ES2375007T3 | FI119676B | FI199703151A0 | FI199703151A | FI973151A0 | GB199501841D0 | GB199521937D0 | GEP199901687B | HK1084897A1 | HU199802209A2 | HU199802209A3 | HU229965B1 | IS4531A | JP04042867B2 | JP10513174A | KR1998701844A | KR500694B1 | MX199705847A | NO199703502A | NO199703502D0 | NO324037B1 | NZ300654A | PL186757B1 | PL321572A1 | PT1232745E | PT1666023E | PT806938E | SI1232745T1 | SI1666023T1 | SK199701036A3 | SK282630B6 | TR199700722T1 | UA61051C2 | US20030170183A1 | US20060029552A1 | US20100330188A1 | US6153224A | US6521260B1 | US7011818B2 | US7718163B2 | WO1996023485A1 | ZA199600721B | 19950322GB199501841D0 |
| 3 | US8921104B2 | Method for producing dendritic cells | GB199824306A | WO1999GB3653A | US2001849499A | US2007789669A | US2008326831A | US2010841064A | 1998-11-05 | 1999-11-05 | 2001-05-04 | 2007-04-24 | 2008-12-02 | 2010-07-21 | US13538995A | 2012-06-29 | B2 | 2014-12-30 | Waldmann Herman|Oxford, GB | Fairchild Paul J.|Oxford, GB | Gardner Richard|Oxford, GB | Brook Frances|Oxford, GB | ISIS Innovation Limited,Oxford,GB | Waldmann Herman,Oxford,GB | Fairchild Paul J.,Oxford,GB | Gardner Richard,Oxford,GB | Brook Frances,Oxford,GB | OXFORD UNIVERSITY INNOVATION LIMITED | B04 C | D16 C | S03 E | B04-B04C | B04-E01 | B04-F02 | B04-H02C | B04-H04C | B14-G02C | B14-G02D | B14-H01 | B14-S11 | D05-H08 | D05-H09 | D05-H14B2 | D05-H17 | S03-E14A1 | S03-E14H | C12N000500 | C12N0005073 | C12N00050784 | C12N00050639 | A61P003700 | C12N00050603 | C12N0005064 | A61K20395154 | A61K20395156 | C12N2501052 | C12N250122 | C12N250123 | C12N250302 | C12N250602 | C12N251000 | 435325 | 435375 | NaN | Disclosed are embryonic stem cell-derived dendritic cells, genetically modified immature dendritic cells capable of maturation, as well as methods for the production of such cells. In one embodiment, the cells made be produced by a method comprising the steps of providing a population of embryonic stem cells; culturing the embryonic stem cells in the presence of a cytokine or combination of cytokines which brings about differentiation of the embryonic stem cells into dendritic cells; and recovering the dendritic cells from the culture. In a further embodiment, the cells may be genetically modified. | Method for producing dendritic cells | The invention claimed is: \n1. A method of assessing the effect of a gene on a cultured dendritic cell, the method comprising: \nproviding a genetically modified cultured es dendritic cell (esDC) expressing a heterologous gene, wherein the genetically modified cultured esDC is a dendritic cell that is obtained by culturing an embryonic stem cell in vitro; \nproviding a cultured es dendritic cell (esDC), wherein the cultured esDC is a dendritic cell that is obtained by culturing an embryonic stem cell in vitro, wherein the cultured esDC is not genetically modified to express the heterologous gene; and \nassessing an effect of the heterologous gene on the genetically modified cultured esDC by comparing the genetically modified cultured esDC to the cultured esDC. \n2. The method of claim 1, wherein the genetically modified cultured esDC and the cultured esDC are human esDC.\n3. The method of claim 1, wherein genetically modified cultured esDC and the cultured esDC are mouse esDC.\n4. The method of claim 1, wherein the heterologous gene encodes a protein which has an immunomodulatory effect.\n5. The method of claim 1, wherein the heterologous gene encodes a cell surface receptor.\n6. The method of claim 1, wherein the heterologous gene encodes Fas-ligand.\n7. The method of claim 1, wherein the heterologous gene encodes a dominant negative form of an endogenous protein.\n8. The method of claim 1, wherein the heterologous gene encodes an antigen target of the immune system.\n9. The method of claim 8, wherein the antigen target of the immune system is an autoantigen.\n10. The method of claim 8, wherein the antigen target of the immune system is a tumor antigen.\n11. The method of claim 8, wherein the antigen target of the immune system is an antigen from an infectious agent.\n12. The method of claim 8, wherein the antigen target of the immune system is a microbial antigen.\n13. The method of claim 8, wherein the antigen target of the immune system is a viral antigen.\n14. The method of claim 1, wherein the heterologous gene encodes an anti-apoptotic gene.\n15. The method of claim 14, wherein the anti-apoptotic gene is FLIP or bcl-2.\n16. The method of claim 1, wherein the heterologous gene encodes a fluorescent protein.\n17. The method of claim 1, wherein the genetically modified cultured esDC co-expresses two or more heterologous genes.\n18. The method of claim 1, wherein the genetically modified cultured esDC comprises one or more endogenous genes that have been inactivated.\n19. The method of claim 18, wherein the endogenous gene that has been inactivated is selected from the group consisting of B7-1, IL-12, p35 subunit of IL-12, and the p40 subunit of IL-12. | 19 | 1. A method of assessing the effect of a gene on a cultured dendritic cell, the method comprising: \nproviding a genetically modified cultured es dendritic cell (esDC) expressing a heterologous gene, wherein the genetically modified cultured esDC is a dendritic cell that is obtained by culturing an embryonic stem cell in vitro; \nproviding a cultured es dendritic cell (esDC), wherein the cultured esDC is a dendritic cell that is obtained by culturing an embryonic stem cell in vitro, wherein the cultured esDC is not genetically modified to express the heterologous gene; and \nassessing an effect of the heterologous gene on the genetically modified cultured esDC by comparing the genetically modified cultured esDC to the cultured esDC. | 1. A method of assessing the effect of a gene on a cultured dendritic cell, the method comprising: providing a genetically modified cultured es dendritic cell (esDC) expressing a heterologous gene, wherein the genetically modified cultured esDC is a dendritic cell that is obtained by culturing an embryonic stem cell in vitro; providing a cultured es dendritic cell (esDC), wherein the cultured esDC is a dendritic cell that is obtained by culturing an embryonic stem cell in vitro, wherein the cultured esDC is not genetically modified to express the heterologous gene; and assessing an effect of the heterologous gene on the genetically modified cultured esDC by comparing the genetically modified cultured esDC to the cultured esDC. | CROSS REFERENCE TO RELATED APPLICATIONS \n\nThis application is a continuation of U.S. application Ser. No. 12/841,064, filed Jul. 21, 2010, which is a continuation of U.S. application Ser. No. 12/326,831, filed Dec. 2, 2008, now U.S. Pat. No. 7,781,213, which is a divisional of U.S. application Ser. No. 11/789,669, filed Apr. 24, 2007, now U.S. Pat. No. 7,473,556, which is a continuation of U.S. application Ser. No. 09/849,499, filed May 4, 2001, now U.S. Pat. No. 7,247,480, which is a continuation of International Patent Application No. PCT/GB99/03653, filed Nov. 5, 1999, which application claims priority from GB Patent Application Number 9824306.6, filed Nov. 5, 1998. The entire content of the prior applications is incorporated herein by reference. \n\nThe invention relates to a method for the production of dendritic cells from embryonic stem cells and to the dendritic cells so produced. The invention also relates to genetically modified embryonic stem cells and their use in the production of genetically modified dendritic cells; to methods for investigating dendritic cells; and to methods for investigating the function of mammalian genes. \n\nBRIEF DESCRIPTION OF THE FIGURES \n\nFIG. 1 : Phase-contrast micrographs of ES cell-derived dendritic cells. (a) Low power view of an embryoid body 24 hr after plating onto tissue culture plastic, showing the emigration of stomal cells in a radial fashion. (b-c) esDC developing around the periphery of a colony. Note the sharpe demarcation between stromal cells supporting their development and those that fail to do so. (d) Appearance of clusters of esDC (arrows) similar to those apparent in cultures of mouse bone marrow. (e) esDC that have seeded areas of the dish uncolonized by stromal cells. (f) Cultures of putative lymphoid esDC maintained in IL-3 alone.\n\nFIG. 2 : shows electron micrographs of esDC cultured in GM-CSF and IL-3; Electron micrographs of esDC cultured in GM-CSF and IL-3 showing typical DC morphology (a) and a propensity to phagocytose apoptotic cells (b), consistent with their immature phenotype. The bar represents 5 ?m.\n\nFIG. 3 : shows surface phenotype of esDC grown is GM-CSF and IL-3 assessed by flow cytometry; Surface phenotype of esDC grown is GM-CSF and IL-3 assessed by flow cytometry. Filled histograms indicate levels of expression of CD44 (a), B7-1 (b), ICAM-1 (c) B7-2 (d), CD40 (e), CD11c (f) and class II MHC (g). Open histograms represent levels of background staining determined using irrelevant species- and isotype-matched control antibodies.\n\nFIG. 4 : shows immunostimulatory activity of esDC in the allogeneic mixed leukocyte reaction; Immunostimulatory activity of esDC in the allogeneic MLR. esDC from the CBA/Ca ES cell line ESF116 were co-cultured with purified T cells form C57B1/10 mice and the extent of proliferation was measured as a function of 3H-TdR uptake 5 days later.\n\nFIG. 5 : shows IL-2 secretion by the T cells in response to antigen presentation by esDC, and inhibition of IL-2 by a mAbto MHC class II; (a) IL-2 secretion by the T cell hybridoma, 2G7.1, in response to HEL presented by live esDC (closed symbols) but not DC that had been fixed first in paraformaldehyde to prevent antigen uptake (open symbols). (b) Stimulation of the 2G7.1 hybridoma is inhibited by the addition of a mAb specific for class II MHC (closed symbols) but not by the addition of an irrelevant species and isotype-matched control antibody (open symbols).\n\nFIG. 6 : shows flow cytometric analysis of esDC following maturation induced by the addition of LPS to cultures; Flow cytometric analysis of esDC following maturation induced by the addition of LPS to cultures. Filled histograms indicated the levels of expression of class II MHC (a), CD11c (b), B7-1 (c), B7-2 (d), CD40 (e) and ICAM-1 (f). Open histograms indicate the levels of background staining obtained using irrelevant species and isotype-matched control antibodies.\n\nFIG. 7 : shows immunostimulatory activity of LPS-treated esDC. Immunostimulatory activity of LPS-treated esDC. Mature esDC stimulate the strong proliferation of naive, allogeneic T cells (closed circles) but only weak proliferation of syngeneic cells (open triangles). At the same time point, equivalent numbers of immature esDC fail to stimulate either allogeneic or syngeneic cells (open circles and closed triangles respectively).\n\nFIG. 8 : shows Immunostimulatory activity by myeloid and lymphoid esDC; A comparison of the immunostimulatory activity of myeloid (closed circles) and lymphoid esDC (open circles).\n\nFIG. 9 : shows antigen-processing activity of myeloid and lymphoid esDC. A comparison of the antigen-processing activity of myeloid and lymphoid esDC. At the top dose of DC, the lymphoid population (hatched bar) are considerably less able to present antigen to the hybridoma than myeloid DC (filled bar), although both induce widespread cell death.\n\nFIG. 10 : shows the generation of esDC stably transfected with GFP following introduction of the transgene Into the parent ES cell line. Generation of esDC stably transfected with GFP following introduction of the transgene Into the parent ES cell line. (a) Colony of ESF116 viewed under fluorescent confocal microscopy showing expression of GFP far in excess of the level of autofluorescence associated with the monolayer of embryonic fibroblasts (b). (c)-(d) Embryoid bodies derived from the ESF116.EGFP clone showing retention of the transgene during differentiation. (e)-(f) Representative esDC developing from transfected embryoid bodies viewed under phase contrast (e) and fluorescence microscopy (f) confirming expression of GFP by terminally-differentiated cells.\n\nBACKGROUND OF THE INVENTION \n\nThe Role of Dendritic Cells in the Immune Response \n\nDendritic cells (DC) constitute a trace population of leukocytes, originating from the bone marrow but distributed widely throughout most organs of the body, with the possible exception of the brain [Steinman 1991; Banchereau & Steinman, 1998]. The function of DC is largely dependent on their state of maturation, which varies according to their local microenvironment. DC resident within interstitial tissues, such as the Langerhans cells of the skin, are predominately immature, forming a network of cells adapted to the acquisition of foreign antigens following a local microbial challenge. \n\nTo perform such a sentinel function, immature DC are competent phagocytes, taking up whole microorganisms and apoptotic cells for processing [Albert et al., 1998a], as well as soluble protein antigens by the endocytic route. Such activity betrays the close lineage relationship between DC and macrophages; indeed the classical DC first described by Steinman and colleagues [1973] are now known to be derived from myeloid progenitors, in common with members of the reticuloendothelial system. What distinguishes DC from macrophages, however, is the nature of their response to an encounter with antigen at a primary site of infection. Inflammatory stimuli, such as the local release of interferon-? or lipopolysaccharide, induce the maturation of DC precursors [De Smedt et al., 1996; Cella et al., 1997], causing them to lose the ability to acquire further antigens but inducing their migration via the draining lymphatics, to the secondary lymphoid organs [Austyn & Larsen, 1990]. Here they adopt a stimulatory role, presenting the cargo of antigens they acquired in situ, to the repertoire of naive T cells. Their ability to activate T cells that have never before encountered antigen, is a property unique to DC and is a function of the co-stimulatory molecules they express upon maturation, of which CD40, ICAM-1 (CD54), B7-1 (CD80) and B7-2 (CD86) are the best characterized. Furthermore, their propensity to induce a Th1 phenotype among the T cells which respond is due largely to the secretion of cytokines such as IL-12 and IL-18 [Cella et al., 1996; Koch et al., 1996]. \n\nBecause of their unrivalled ability to stimulate naive T cells in vivo, all immune responses, whether protective or pathogenic, are initiated upon the recognition of antigen presented by DC. Consequently, the potential for modulating the outcome of an immune response by harnessing the function of DC has aroused widespread interest. Indeed, their potential has been successfully exploited in a number of laboratories for enhancing an otherwise inadequate immune response to tumour-specific antigens, resulting in efficient tumour regression [Mayordomo et al., 1995; Celluzzi et al., 1996]. Furthermore, by providing immature DC with a source of chlamydial antigens, Su and colleagues have been able to successfully immunize mice against subsequent infection with Chlamydia [Su et al., 1998], illustrating their likely usefulness in programs of vaccination against infectious agents that have proven difficult to eradicate using conventional strategies. \n\nOver the past few years, the study of immunology has been revolutionized by the discovery that DC may present antigen not only for the purpose of enhancing cell-mediated immunity, but also for the induction of self-tolerance [Finkelmann et al., 1996; Thomson et al., 1996]. This contention has been supported by the characterization of a second lineage of DC derived from a lymphoid progenitor in common with T cells [Wu et al., 1997; Shortman & Caux, 1997]. These cells share with myeloid DC the capacity to acquire, process and present antigen to T cells but appear to induce unresponsiveness among the cells with which they interact, either by preventing their expansion through limiting IL-2 release [Kronin et al., 1996], or provoking their premature death by apoptosis [Suss & Shortman, 1996]. In this respect, lymphoid DC have been reported to constitutively express Fas-ligand which induces cell death among cells expressing its counter-receptor, Fas. These findings have raised the additional prospect of further harnessing the properties of DC to down-modulate detrimental immune responses, such as those involved in autoimmune disease and the rejection of allografted tissues. \n\nIn spite of the promise DC hold for exploitation in a therapeutic setting, a number of less-desirable properties of DC have consistently limited progress. Firstly, although it is the immunogenic and tolerogenic function of mature DC which is most amenable to immune intervention, DC exhibit a short life span once terminally differentiated. This has made the prospect of genetic modification of DC less attractive since any benefits gained are necessarily short-lived. Furthermore, primary DC are peculiarly resistant to transfection, confounding most attempts to stably express heterologous genes; indeed the best protocol currently available involves the use of mRNA instead of cDNA for transfection purposes, creating, at best, a transient expression system [Boczkowski et al., 1996]. Although many groups have attempted to circumvent some of these difficulties by generating stable DC lines, the results have been universally disappointing, most putative lines being either retrovirally transformed [Paglia et al., 1993; Girolomoni et al., 1995; Volkmann et al., 1996] or incapable of progressing beyond an immature state [Xu et al., 1995]. Thus none of these provides a useful, renewable source of DC or one that can be genetically manipulated. \n\nEmbryonic Stem Cells and their Differentiation \n\nEmbryonic stem (ES) cells are derived from the epiblast of advanced blastocysts. The epiblast cells contribute to all cell types of the developing embryo, rather than the extra-embryonic tissues. Individual ES cells share this totipotency but may be maintained and propagated in an undifferentiated state by culturing them in recombinant leukaemia inhibitory factor (rLIF) [Smith et al., 1988], or on a monolayer of embryonic fibroblasts which may act as a potent source of this or related cytokines. Although ES cells may be propagated for a few passages in LIF, for long term culture, fibroblast feeder cells are preferred since ES cells maintained indefinitely in rLIF may lose their differentiation potential. \n\nUnlike primary cultures of DC, ES cells are particularly amenable to genetic modification since they survive even the most harsh conditions for the introduction of foreign DNA, including electroporation. Consequently, ES cells have been used extensively over recent years for the production of transgenic mice and for gene targeting by homologous recombination. Indeed, by introducing a null mutation into selected genes, it has proven possible to generate knockout mice, congenitally deficient in expression of specific molecules [Fung-Leung & Mak, 1992; Koller & Smithies, 1992]. \n\nThe ability of ES cells to contribute to all lineages of the developing mouse, once reintroduced into recipient blastocysts, is a property which has also proven useful in vitro for the study of lineage relationships [Snodgrass et al., 1992; Keller 1995]. Indeed, a variety of protocols has been devised to encourage differentiation of ES cells along specific pathways. To date, there have been reports of the emergence of cell types as diverse as cardiac muscle, endothelial cells, tooth and neurons [Fraichard et al., 1995; Li et al., 1998]. In addition, differentiating ES cells have been shown to engage in the development of haematopoietic stern cells [Palacios et al., 1995] with the potential to differentiate into erythrocytes, macrophages, mast cells [Wiles & Keller, 1991; Wiles, 1993] and lymphocyte precursors of both the T and B cell lineages [Gutierrez-Ramos & Palacios, 1992; Nisitani et al., 1994; Potocnik et al., 1997]. \n\nThe Invention \n\nIt has now been discovered that DC can be generated by culturing ES cells under certain conditions, more specifically in the presence of IL-3 and optionally GM-CSF. Despite the many studies of haematopoiesis following ES cell differentiation in vitro, the appearance of primary DC (i.e. DC not passaged in culture in their own right) has not previously been reported. Surprisingly, while IL-3 has been used in a number of studies, either alone or in combination with GM-CSF, to induce haematopoiesis within developing embryoid bodies [Wiles & Keller, 1991; Keller, 1995] no DC development has been reported, although a clear effect on erythropoiesis and the development of macrophages and mast cells was routinely observed. \n\nThe new findings provide a novel approach to genetic modification of DC which makes use of ES cell differentiation in vitro. In particular, stable lines of genetically modified ES cells can be used to generate mutant DC on demand. \n\nThus, according to a first aspect of the invention there is provided an es dentritic cell (esDC). \n\nAs used herein, the term es as applied to dentritic cells (DC) is intended to define dentritic cells which are derived from embryonic stem (ES) cells. Thus, esDC cells may be generated directly from ES cells by culture in vitro (for example, as described herein). \n\nIn another aspect, the invention provides a genetically modified immature dentritic cell capable of maturation. \n\nThe cells of the invention are preferably human cells. Recent reports of the derivation of human ES cells [Thomson et al., 1998], have stimulated much interest in their exploitation for the generation of terminally-differentiated cell types for use in cell replacement therapy [Gearhart 1998; Keller and Snodgrass, 1999]. For many cell types, however, such as neurons, muscle fibres and oligodendrocytes, their effectiveness in vivo depends on the efficiency with which they can be targeted to the correct anatomical location and site of the original lesion, as well as their propensity to integrate into the host tissue and maintain their physiological competence. For this reason the ES technology now available is far more likely to find an application among populations of cells such as DC that, once reintroduced in vivo, have been shown to migrate under the influence of chemokines, along compex migratory pathways to secondary lymphoid tissues. Importantly, the skilled worker will readily be able to adapt the protocols described herein for the generation of DC from human ES cells, for the reasons explained below. \n\nFirstly, Thomson and colleagues [1998] made use of embryonic fibroblasts from the mouse as a source of feeder cells and found compatibility between the two species, allowing human ES cells to be maintained long-term in an undifferentiated state. Secondly, much is now known about the growth factors required for the differentiation of mature DC in vitro from human haematopoietic stem cells (HSC) [reviewed in Shortman and Caux, 1997]. Significantly, of all the combinations of cytokines tested, only GM-CSF and IL-3 have been found to have the capacity to support DC development from CD34+ HSC, although the efficacy of this protocol is greatly enhanced by the addition of TNF-a to the culture medium, suggesting that this cytokine may also facilitate esDC development from embryoid bodies. Importantly, recombinant human cytokines including GM-CSF, IL-3 and TNF-a are currently available from a number of commercial sources, making the technology readily accessible. \n\nAnother approach contemplated by the invention achieves germline competence by harnessing nuclear transfer technology [Wilmut et al., 1997; Wakayama et al., 1998] to permit the transfer of nuclei from human cells to enucleated ES cells of another species (such as ESF116) in order to confer on the nucleus the propensity for germline transmission. Moreover, nuclear transfer in this way may represent a possible solution to the complex ethical concerns surrounding derivation of novel human ES cell lines, making them more widely-available for purposes such as the generation of DC for therapeutic applications. \n\nThe invention also provides various medical uses of the cells of the invention, including therapy and prophylaxis. Particularly preferred are immunotherapeutic uses. \n\nThe invention therefore provides in another aspect a method for producing dendritic cells which method comprises: \n * i) providing a population of embryonic stem cells;\n * ii) culturing the embryonic stem cells in the presence of a cytokine or combination of cytokines which bring about differentiation of the embryonic stem cells into dendritic cells; and\n * iii) recovering the dendritic cells from the culture.\n\nA cytokine which has been found to be of critical importance in the generation of DC from ES cells in vitro is IL-3. In the presence of IL-3 alone DC develop which exhibit the characteristics of lymphoid rather than myeloid DC. \n\nOn the other hand, in the presence of a combination of IL-3 and GM-CSF, larger populations of DC appear which represent DC of myeloid origin. \n\nThus, the invention is concerned with the production of lymphoid-type and myeloid-type DC under different conditions. \n\nThe invention is also concerned with ES cells which are genetically modified and which can pass on the genetic modification or modifications to the resulting DC. Thus, the method according to the invention may employ genetically modified ES cells. \n\nThe invention also provides dendritic cells produced by the methods described herein, and genetically modified ES cells useful in the methods described herein including ES cells in which a gene normally expressed in dendritic cells is inactivated, and ES cells transfected with a construct comprising a promoter which is preferentially active in dendritic cells. \n\nIn another aspect, the invention provides a method for investigating a mammalian gene, which method comprises generating a test population of dendritic cells from a population of embryonic stem cells and comparing the test dendritic cells in respect of the gene. \n\nThe source of IL-3 and GM-CSF for use in the invention is not critical; either or both may be provided for example in pure recombinant form, or secreted from a cell line transfected with the gene and expressing the recombinant protein. In the latter case, tissue culture supernatant from the cell line may be used. \n\nS 0 far as concentration is concerned, in the presence of murine IL-3 alone murine DC will develop in concentrations as low as 40 U/ml, although 5,000 U/ml is optimal. In practice a concentration of about 1,000 U/ml may be preferable since it is economically more viable and there is still good colony growth of DC at that concentration.\n\nFor ES cells in the presence of IL-3 together with GM-CSF, some synergy between the two cytokines may occur. The cell surface receptors for IL-3 and GM-CSF have a common ?-chain and therefore quite possibly share some of the same cell signalling mechanisms. \n\nAn optimum level of murine GM-CSF for development of murine DC is about 30±5 ng/ml. At that level there is receptor saturation. However, GM-CSF at a concentration as low as 0.1 ng/ml stimulates the production of trace numbers of DC in the presence of 1,000 U/ml IL-3. \n\nImportant for the development of DC from ES cells is the formation of embryoid bodies, which are preferably in liquid suspension culture rather than in any semi-solid matrix. It is preferable that embryoid bodies are free-floating for differentiation to proceed optimally. \n\nEmbryoid bodies are formed from ES cells which have been removed from the inhibitory effects of LIF. The cells proliferate to form clusters of viable cells, each of which represents an embryoid body and can comprise differentiated or partially differentiated cells of a variety of cell types. \n\nIn a particular embodiment of the method according to the invention, embryoid bodies are plated onto tissue culture dishes and exposed to the appropriate cytokine or combination of cytokines to promote development of DC. The embryoid bodies adhere to the surface and give rise to colonies of stromal cells which migrate outwards. After a few days DC develop around the periphery, presumably from early haematopoietic stem cells present in the embryoid bodies. DC which develop in this way can be harvested in substantially pure form, normally with less than 10% contaminating cell types e.g. about 5 to 10% contaminating cell types. \n\nPrior to the formation of embryoid bodies, the ES cells are routinely maintained in an undifferentiated state in the presence of LIF. The LIF is generally provided at this stage in pure recombinant form. However, for maintenance of ES cells in long term culture prior to the formation of embryoid bodies, LIF is preferably provided by culturing the ES cells in the presence of fibroblast feeder cells which secrete LIF and other cytokines. \n\nES cells for production of DC in the method according to the invention may conceivably be derived from any appropriate mammalian source. Illustrated herein are murine ES cells and DC, but it will be clear that the invention is not necessarily limited to murine cells. ES cells from certain mouse strains are found to be permissive for DC development, while ES cells from other strains are not. However, it will also be clear that the invention is not limited to those permissive strains disclosed herein since it is a straightforward matter to prepare ES cells from other strains and test them for their competence in differentiating into DC. \n\nThe apparent inconsistency between the results presented herein and previous studies using ES cells in which no DC were produced or recovered, may reflect a variety of possible factors. These include differences in the protocols employed, an inability in previous studies to identify any resulting DC, and strain differences in the propensity of ES cells to support DC development. In support of the latter possibility, initial studies on the CBA/Ca cell line ESF116 were repeated using a second CBA/Ca line generated in-house (ESF99) and one from 129/Sv mice which is widely used for gene knockout technology and which is commercially available (D3). Interestingly, while ESF99 supported the development of esDC, albeit to a lesser extent than ESF116, D3 failed entirely to do so under the same culture conditions. ES cells generated from other strains can easily be tested for their ability to support development of DC by using the protocols described herein. An additional example of a mouse strain from which ES cells have been shown to support development of DC is C57B1/6 (ESF75). \n\nCertain applications of the invention are discussed in more detail below and in the Examples which follow. It will be clear that the invention is not limited to the specific embodiments described herein. In particular, the genetic manipulation of the ES cells may be in any manner which results in any useful DC phenotype. \n\nUses of the present invention extend to the fields of tumour immunotherapy and vaccination against infectious agents. Examples include transfection of the parent ES cells with genes encoding tumour-specific antigens or candidate microbial antigens against which a protective immune response is desirable. The endogenous expression of whole protein antigens in this way may harness the potent antigen processing capacity of DC to select the most appropriate epitopes for presentation on both class I and class II MHC, effectively by-passing the need for laborious identification of the epitopes involved. Furthermore, co-transfection of such cells with genes encoding FLIP (accession number: U97076) or bcl-2 (accession number: M16506) may prolong the life-span of esDC administered in vivo. Both molecules have been shown to exert a protective effect, actively interfering with the apoptotic pathways which normally limit DC survival, but in a manner that does not induce their transformation [Hockenbery et al. 1990]. By having their lifespan prolonged in this way, esDC presenting foreign or tumour-specific antigens may provide a chronic stimulus to the immune system. As an additional advantage, the need for adjuvants for the mounting of a powerful protective immune response may be reduced or removed. \n\nThe potential for generating lymphoid DC, thought to be important in the maintenance of peripheral self-tolerance, may be exploited in the treatment of autoimmune disease which is characterized by loss of the tolerant state. Certain animal models for autoimmune disease will be useful in investigating the possibilities for treatment. Recently, Goulet and co-workers [1997] reported the isolation of ES cells from the MRL mouse strain susceptible to autoimmunity and demonstrated their germline competence. Such cells may prove useful for the production of esDC of the correct genetic background to permit the development of strategies for immune intervention. Alternatively or additionally, ES cells established from the diabetes-prone NOD mouse could provide useful DC for assessing the potential for immune intervention. A successfully produced ES cell line could be transfected with GAD-65 (accession number: L16980), an autoantigen known to be involved in the aetiology of insulin-dependent diabetes mellitus (IDDM), and induced to differentiate along the lymphoid route. Upon administration in vivo, such cells may actively seek out and tolerize T cells specific for the autoantigen, thereby limiting the extent and progression of tissue damage. Furthermore, by introducing the whole gene encoding GAD-65, all potential epitopes will be presented to the T-cell repertoire, overcoming problems associated with intramolecular determinant spreading [Lehmann et al. 1993]. A similar procedure could be carried out for tolerizing to other autoantigens. \n\nRecently, protocols have been published for the generation of ES cells in which both alleles of a gene have been targeted by homologous recombination, resulting in cells deficient in a given protein [Hakem et al., 1998]. This provides an approach for altering DC function by knocking out candidate genes such as the p40 subunit of IL-12 (accession number: M86671) or the p35 subunit of IL-12 (IL-12 is a hederodimer and at least two genes are involved in its expression). Since this cytokine is fundamental to the establishment of a Th1 response, responding T cells may default to a Th2 phenotype in its absence. Given that Th1 and Th2 cells are mutually antagonistic and that the latter are frequently protective in inflammatory autoimmune conditions [Liblau et al. 1995], IL-12 + esDC may prove effective in inducing immune deviation and modulating the outcome of an ongoing autoimmune response. Should the selection criteria for production of knockout ES cells according to the published protocols prove to be too stringent, alternative approaches to prevent expression or activity of target molecules can be employed. Such approaches include for example antisense constructs, ribozymes or the expression of dominant negative forms of molecules, where available. A dominant negative form of a molecule is an altered e.g. mutated form which blocks the function of the endogenous form of the molecule, for example by binding in its place. Examples of all of these approaches are present in the literature.\n\nIdentification of Novel Targets for Immune Intervention \n\nThe approaches to immune intervention, outlined above, require prior knowledge of specific genes involved in the immune response and the function they perform. Nevertheless, only a small proportion of the genes that control DC function have been elucidated. The protocols for the development of DC from ES cells in vitro as described herein may, therefore, be exploited for the identification of novel targets for immune modulation which may ultimately prove useful in a clinical setting. \n\nSeveral approaches to identifying new genes have recently been described, of which the serial analysis of gene expression (SAGE) is perhaps the most powerful [Valculescu et al., 1995]. This methodology permits those genes that are actively expressed by two populations of cells to be compared in a differential manner. It may, therefore, be possible to compare gene expression in embryoid bodies from ESF116, known to support DC development, and those from D3 which fails to do so. Such an approach may define genes involved in the early stages of haematopoiesis which control development of the DC lineage. Alternatively, purified populations of myeloid and lymphoid DC may be compared to elucidate the genes responsible for converting an immunostimulatory DC to one capable of inducing self-tolerance. \n\nWhile such an approach may highlight important new genes involved in the ontogeny and function of DC, there remains a significant gene-function gap, it being considerably easier to identify genes that contribute to a particular phenotype than to elucidate the function of the proteins they encode. As a way of addressing this deficiency, a number of laboratories have pioneered gene-trapping technology [Evans et al., 1997] which seeks to trap genes in an unbiased way and provide the potential for identifying their function. To this end, Zambrowicz et al. [1998] have generated an Omnibank of ES cells in which genes have been randomly targeted for inactivation. Using these cells, knockout mice may be generated which may be screened for specific defects which might betray the function of the targeted gene. Although the production of knockout mice is now well-established, the screening of is large numbers of genes in this way remains an immense undertaking which is likely to be limited by the many logistical constraints. By combining gene trapping technology with our own approach and established readouts for antigen processing and immunostimulation, we may be able to screen rapidly many new genes to identify those th... | ISIS Innovation Limited,Oxford,GB | Waldmann Herman,Oxford,GB | Fairchild Paul J.,Oxford,GB | Gardner Richard,Oxford,GB | Brook Frances,Oxford,GB | ISIS Innovation Limited | Waldmann Herman | Fairchild Paul J. | Gardner Richard | Brook Frances | ISIS INNOVATION LTD | UNIVERSITY OF OXFORD | Waldmann, Herman | Fairchild, Paul J. | Gardner, Richard | Brook, Frances | 4 | Chandra, Shweta | Bozicevic, Field & Francis LLP | NaN | Wilson, Michael C. | US | Dead | 12 | 2014 | US | 6 | 2012 | 1998-11-05 | 1998 | C12 | C12, A61 | 435325 | 435375 | WO1997021802A1 | US7781213B2 | US7473556B2 | US7247480B2 | US20020131962A1 | US8232100B2 | 6 | Brossart et al. Virus-mediated delivery of antigenic epitopes into dendritic cells as a means to induce CTL. The Journal of Immunology 158: 3270-3276. | Abbas & Lichtman. Cellular and Molecular Immunology, Philadelphia, P.A., Elsevier Saunders, 1991, p. 249. | Brocker, et al., Targeted Expression of Major Histocompatibility Complex (MHC) Class II Molecules Demonstrates that Dendritic CellsCan Induce Negative but Not Positive Selection of Thymocytes In Vivo, J. of Exp. Med. 185 (33): 541-550, Feb. 3, 1997. DOI:10.1084/jem.185.3.541 7 | Clontech Catalog information for vector pEGFP-N1, Protocol # PT3027-5, Version # PR29972, pp. 1-3, 2002. | Ellis et al. (1991) Antigen presentation by dendritic cells provides optimal stimulation for the production of interleukin (IL) 2, IL 4 and interferon-gamma by allogeneic T cells. European Journal of Immunology 21(11): 2803-2809. DOI:10.1002/eji.1830211123 3 | Genbank Accession No. U55762, submitted Apr. 17, 1996, accessed online, Feb. 15, 2008. | Keller et al., Hematopoietic commitment during embryonic stem cell differentiation in cultureMol. Cell Bio., 13(10): 473-486 (Jan. 1993). 38 | Klug et al., Genetically Selected Cardiomyocytes from Differentiating Embryonic Stem Cells Form Stable Intracardiac Grafts, J. Clin. Invest., 98:216-224 (1996). DOI:10.1172/JCI118769 80 | Reeves, M. E., et al. Retroviral transduction of human dendritic cells with a tumor-associated antigen gene. Cancer Research. 1996, vol. 56, pp. 5672-5677. 29 | Senju et al. Generation and genetic modification of dendritic cells derived from mouse embryonic stem cells. Immunogiology, Blood, 2003, vol. 101, No. 9, pp. 3501-3508. DOI:10.1182/blood-2002-07-2254 17 | Slukvin, et al. Directed differentiation of human embryonic stem cells into functional dendritic cells through the myeloid pathway. The Journal of Immunology, 2006, 176: 2924-2932. 15 | Steinman, R. M., et al. Identification of a novel cell type in peripheral lymphoid organs of mice. I. Morphology quantitation, tissue distribution. Journal of Experimental Medicine. 1973, vol. 137, pp. 1142-1162. DOI:10.1084/jem.137.5.1142 21 | Brook & Gardner, The origin and efficient derivation of embryonic stem cells in the mouse, Proc. Natl. Acad. Sci. USA, 97: 5709-5712 (1997). DOI:10.1073/pnas.94.11.5709 24 | Brustle et al., In vitro-generated neural precursors participate in mammalian brain development, Proc. Natl. Acad. Sci. USA, 94:14809-14814 (1997). DOI:10.1073/pnas.94.26.14809 | Inaba et al. (1993) Granulocytes, macrophages, and dendritic cells arise from a common major histocompatibility complex class II-negative progenitor in mouse bone marrow Proc Natl Acad Soc. USA 90:3038-3042. DOI:10.1073/pnas.90.7.3038 16 | Melcher et al. (1999) Adoptive transfer of immature dendritic cells with autologous or allogeneic tumor cells generates systemic antitumor immunity Cancer Res 59:2802-2805. 4 | Ridgway (2003) The first 1000 dendritic cell vaccinees Cancer Invest 21(6):873-886. DOI:10.1081/CNV-120025091 27 | Sallusto & Lanzavecchia Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha (1994) J Exp Med 179:1109-1118. DOI:10.1084/jem.179.4.1109 177 | Saudrais et al. (1998) Intracellular pathway for the generation of functional MHC class II peptide complexes in immature human dendritic cells J Immunol 160(6):2597-2607. 1 | Smith, Culture and differentiation of embryonic stem cells, J. of Tiss. Cult. Method, 13:89-94, 1991. | Talmor et al. (1998) Generation or large numbers of immature and mature dendritic cells from rat bone marrow cultures Eur J Immunol 28:811-817. DOI:10.1002/(SICI)1521-4141(199803)28:03<811::AID-IMMU811>3.0.CO;2-S 2 | Whiteside & Odoux (2004) Dendritic cell biology and cancer therapy Cancer Immunol Immunother 53:240-248. DOI:10.1007/s00262-003-0468-6 | 22 | US11020465B2 | 1 | 2023-02-28 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - 2022-12-30 | 2023-02-06 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | 2022-08-22 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | 2018-06-22 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) FEE PAYMENT YEAR 4 | 2016-08-02 AS ASSIGNMENT OXFORD UNIVERSITY INNOVATION LIMITED, GREAT BRITAI CHANGE OF NAME;ASSIGNOR:ISIS INNOVATION LIMITED;REEL/FRAME:039550/0045 2016-06-16 | 2016-08-02 AS ASSIGNMENT OXFORD UNIVERSITY INNOVATION LIMITED, GREAT BRITAIN CHANGE OF NAME;ASSIGNOR:ISIS INNOVATION LIMITED;REEL/FRAME:039550/0045 2016-06-16 | 2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE | 2012-10-23 AS ASSIGNMENT ISIS INNOVATION LIMITED, UNITED KINGDOM ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:WALDMANN, HERMAN;FAIRCHILD, PAUL;GARDNER, RICHARD;AND OTHERS;SIGNING DATES FROM 19981130 TO 19981204;REEL/FRAME:029175/0237 | US8921104B2 | AU200010584A | AU768267B2 | CA2350210A1 | CA2350210C | EP1127108A2 | GB199824306D0 | US20020019047A1 | US20020131962A1 | US20070269885A1 | US20090155898A1 | US20110014696A1 | US20130171627A1 | US7247480B2 | US7473556B2 | US7781213B2 | US8232100B2 | WO2000028000A2 | WO2000028000A3 | 19981230GB199824306D0 |
| 4 | US8923511B2 | Enciphering apparatus and method, deciphering apparatus and method as well as information processing apparatus and method | JP1997106136A | US199859776A | US2001872509A | US2006359928A | US2007824803A | US2010817320A | US13442923A | 1997-04-23 | 1998-04-14 | 2001-06-01 | 2006-02-22 | 2007-07-03 | 2010-06-17 | 2012-04-10 | US13899054A | 2013-05-21 | B2 | 2014-12-30 | Ishiguro Ryuji|Tokyo, JP | Osawa Yoshitomo|Kanagawa, JP | Osakabe Yoshio|Kanagawa, JP | Sato Makoto|Tokyo, JP | Shima Hisato|Tokyo, JP | Asano Tomoyuki|Kanagawa, JP | Sony Corporation,Tokyo,JP | REDWOOD TECHNOLOGIES LLC | T01 E | T03 E | T01-C01 | T01-H | T01-X | T03-P | H04L000900 | H04L000908 | G06F000100 | G06F002100 | G06F002110 | G06F002144 | G06F002162 | G06F002172 | G06F002173 | G06F002185 | G09C000100 | G11B002000 | H04L000932 | H04L00090891 | G06F001700 | G06F002110 | G06F0021445 | G06F00216209 | G06F0021725 | G06F002173 | G06F002185 | G11B002000086 | G11B00200021 | G11B002000246 | G11B002000492 | G11B002000521 | H04L0009008 | H04L00090861 | H04L00090869 | G06F2211007 | G06F22212107 | G11B22202525 | G11B22202562 | H04L2209603 | H04L2209605 | 380044 | 713189 | NaN | The invention provides an enciphering apparatus and method, a deciphering apparatus and method and an information processing apparatus and method by which illegal copying can be prevented with certainty. Data enciphered by a 1394 interface of a DVD player is transmitted to a personal computer and a magneto-optical disk apparatus through a 1394 bus. In the magneto-optical disk apparatus with which a change to a function is open to a user, the received data is deciphered by a 1394 interface. In contrast, in the personal computer with which a change to a function is open to a user, the enciphered data is deciphered using a time variable key by a 1394 interface, and a result of the decipherment is further deciphered using a session key by an application section. | Enciphering apparatus and method, deciphering apparatus and method as well as information processing apparatus and method | What is claimed is: \n1. Apparatus for generating a cryptographic key, comprising: \na memory storing computer executable instructions which, when executed by a processor, cause the processor to: \nprovide a first key which is derived through an authentication procedure, the first key being based on information generated in another apparatus; \nprovide a second key which is changed during a term that the first key is used; \ngenerate the cryptographic key based on the first and second keys, the cryptographic key being changed in accordance with the change of the second key; and \na processor programmed to execute the stored instructions to output the cryptographic key. \n2. The apparatus of claim 1, wherein said first key and said second key are secret.\n3. The apparatus of claim 2, wherein the second key is based on information assigned to each apparatus.\n4. The apparatus of claim 1, wherein the first key includes secret information shared with a deciphering apparatus, the second key is derived from a source, and the secret information is a disturbance key to disturb the source of the second key.\n5. The apparatus of claim 1, wherein a source of the second key is changed in accordance with a packet.\n6. The apparatus of claim 1, wherein the computer-executable instructions further cause the processor to encipher data with the cryptographic key.\n7. The apparatus of claim 6, wherein the computer-executable instructions cause the processor to execute an exclusive-or operation of the data with the crytographic key.\n8. The apparatus of claim 1, further comprising a sharing unit configured to share the first key using a public key system.\n9. The apparatus of claim 8, wherein said sharing unit is configured to share said first key using a Diffie-Hellman key agreement procedure.\n10. The apparatus of claim 9, further comprising a first-in-first-out unit used in cryptographic processing.\n11. The apparatus of claim 10, further comprising a pseudo-random number generator.\n12. The apparatus of claim 11, wherein the pseudo-random number generator includes a linear feedback shift register.\n13. Apparatus for generating a cryptographic key, comprising: \ncircuitry configured to generate a cryptographic key based on first and second keys; and \na memory storing computer executable instructions which, when executed by a processor, cause the processor to: \nprovide the first key which is derived through an authentication procedure, the first key being based on information generated in another apparatus; and \nprovide the second key which is changed during a term that the first key is used. \n14. The apparatus of claim 13, wherein said first key and said second key are secret.\n15. The apparatus of claim 14, wherein the second key is based on information assigned to each apparatus.\n16. The apparatus of claim 13, wherein the first key includes secret information shared with a deciphering apparatus, the second key is derived from a source, and the secret information is a disturbance key to disturb the source of the second key.\n17. The apparatus of claim 13, wherein a source of the second key is changed in accordance with a packet.\n18. The apparatus of claim 13, wherein the computer-executable instructions further cause the processor to encipher data with the cryptographic key.\n19. The apparatus of claim 18, wherein the computer-executable instructions cause the processor to execute an exclusive-or operation of the data with the crytographic key.\n20. The apparatus of claim 13, further comprising a sharing unit configured to share the first key using a public key system.\n21. The apparatus of claim 20, wherein said sharing unit is configured to share said first key using a Diffic-Hellman key agreement procedure.\n22. The apparatus of claim 21, further comprising a first-in-first-out unit used in cryptographic processing.\n23. The apparatus of claim 22, further comprising a pseudo-random number generator.\n24. The apparatus of claim 23, wherein the pseudo-random number generator includes a linear feedback shift register.\n25. An information processing system comprising: \na memory storing computer executable instructions which, when executed by an information processing apparatus, cause the information processing apparatus to: \nprovide a first key which is derived through an authentication procedure, the first key being based on information generated in another apparatus; \nprovide a second key which is changed during a term that the first key is used; and \ngenerate the cryptographic key based on the first and second keys, the cryptographic key being changed in accordance with the change of the second key. | 25 | 1. Apparatus for generating a cryptographic key, comprising: \na memory storing computer executable instructions which, when executed by a processor, cause the processor to: \nprovide a first key which is derived through an authentication procedure, the first key being based on information generated in another apparatus; \nprovide a second key which is changed during a term that the first key is used; \ngenerate the cryptographic key based on the first and second keys, the cryptographic key being changed in accordance with the change of the second key; and \na processor programmed to execute the stored instructions to output the cryptographic key. | 1. Apparatus for generating a cryptographic key, comprising: a memory storing computer executable instructions which, when executed by a processor, cause the processor to: provide a first key which is derived through an authentication procedure, the first key being based on information generated in another apparatus; provide a second key which is changed during a term that the first key is used; generate the cryptographic key based on the first and second keys, the cryptographic key being changed in accordance with the change of the second key; and a processor programmed to execute the stored instructions to output the cryptographic key. | 13. Apparatus for generating a cryptographic key, comprising: circuitry configured to generate a cryptographic key based on first and second keys; and a memory storing computer executable instructions which, when executed by a processor, cause the processor to: provide the first key which is derived through an authentication procedure, the first key being based on information generated in another apparatus; and provide the second key which is changed during a term that the first key is used. | 25. An information processing system comprising: a memory storing computer executable instructions which, when executed by an information processing apparatus, cause the information processing apparatus to: provide a first key which is derived through an authentication procedure, the first key being based on information generated in another apparatus; provide a second key which is changed during a term that the first key is used; and generate the cryptographic key based on the first and second keys, the cryptographic key being changed in accordance with the change of the second key. | This is a continuation of application Ser. No. 13/442,923, filed Apr. 10, 2012, which is a continuation of application Ser. No. 12/817,320, filed Jun. 17, 2010, now U.S. Pat. No. 8,170,206, which is a continuation of application Ser. No. 11/824,803, filed Jul. 3, 2007, now U.S. Pat. No. 7,860,248, which is a continuation of application Ser. No. 11/359,928, filed Feb. 22, 2006, now U.S. Pat. No. 7,242,769, which is a continuation of application Ser. No. 09/872,509, filed Jun. 1, 2001, now U.S. Pat. No. 7,298,842, which is a continuation of application Ser. No. 09/059,776, filed Apr. 14, 1998, now U.S. Pat. No. 6,256,391, and which is entitled to the priority filing date of Japanese application P09-106136, filed Apr. 23, 1997, the entirety of which is incorporated herein by reference. \n\nBRIEF DESCRIPTION OF THE DRAWINGS \n\nFIG. 1 is a block diagram showing an example of a construction of an information, processing system to which the present invention is applied;\n\nFIG. 2 is a block diagram showing an example of internal constructions of a DVD player, a personal computer and a magneto-optical disk apparatus shown in FIG. 1;\n\nFIG. 3 is a block diagram illustrating an authentication procedure performed in the information processing system of FIG. 1;\n\nFIG. 4 is a timing chart illustrating the authentication procedure illustrated in FIG. 3;\n\nFIG. 5 is a diagrammatic view illustrating a format of a node_unique_ID;\n\nFIG. 6 is a timing chart illustrating another authentication procedure;\n\nFIG. 7 is a similar view but illustrating a further authentication procedure;\n\nFIG. 8 is a similar view, but illustrating a still further authentication procedure;\n\nFIG. 9 is a similar view but illustrating a yet further authentication procedure;\n\nFIG. 10 is a block diagram illustrating an enciphering procedure;\n\nFIG. 11 is a block diagram showing an example of a construction of a 1394 interface used in the enciphering procedure of FIG. 10;\n\nFIG. 12 is a block diagram showing an example of a more detailed construction of the 1394 interface of FIG. 11;\n\nFIG. 13 is a block diagram showing an example of a more detailed construction of a linear feedback shift register shown in FIG. 12;\n\nFIG. 14 is a block diagram showing an example of a more detailed construction of the linear feedback shift register of FIG. 13;\n\nFIG. 15 is a block diagram showing an example of a construction of a 1394 interface used in the enciphering procedure of FIG. 10.\n\nFIG. 16 is a block diagram showing an example of a more detailed construction of the 1394 interface of FIG. 15;\n\nFIG. 17 is a block diagram showing an example of a construction of a 1394 interface used in the enciphering procedure of FIG. 10;\n\nFIG. 18 is a block diagram showing an example of a more detailed construction of the 1394 interface of FIG. 17;\n\nFIG. 19 is a block diagram showing an example of a construction of an application section used in the enciphering procedure of FIG. 10;\n\nFIG. 20 is a block diagram showing an example of a more detailed construction of the application section of FIG. 19;\n\nFIG. 21 is a block diagram showing another example of the construction of the 1394 interface used in the enciphering procedure of FIG. 10:\n\nFIG. 22 is a block diagram showing another example of the construction of the 1394 interface used in the enciphering procedure of FIG. 10;\n\nFIG. 23 is a block diagram showing another example of the construction of the 1394 interface used in the enciphering procedure of FIG. 10; and\n\nFIG. 24 is a block diagram showing another example of the construction of the application section used in the enciphering procedure of FIG. 10.\n\nBACKGROUND OF THE INVENTION \n\n1. Field of the Invention \n\nThis invention relates to an enciphering apparatus and method, a deciphering apparatus and method and an information processing apparatus and method, and more particularly to an enciphering apparatus and method, a deciphering apparatus and method and an information processing apparatus and method by which high security is assured. \n\n2. Description of the Related Art \n\nRecently, a network is available which is composed of a plurality of electronic apparatus represented by AV apparatus, computers and so forth which are connected to each other by a bus so that various data may be communicated between them. \n\nWhere a network of the type mentioned is employed, for example, data of a movie reproduced from a DVD (Digital Video Disk or Digital Versatile Disk) by a DVD player connected to the network can be transferred through the bus to and displayed by a display unit such as a television receiver or a monitor. Usually, it is licensed from the proprietor of copyright at a point of time when a DVD is purchased to display and enjoy a movie reproduced from the DVD on a display unit. \n\nHowever, it is not usually licensed from the proprietor of copyright to copy data reproduced from the DVD onto another recording medium and utilize the same. Thus, in order to prevent data sent out through the bus (network) from being copied illegally, it is a possible idea to encipher the data on the sending side and decipher the data on the receiving side. \n\nHowever, consumer electronics apparatus (CE apparatus) such as DVD players and television receivers are normally designed and produced for predetermined objects and are each produced such that it is impossible for a user to modify it or incorporate a different part into it to acquire or alter internal data (change of functions) of the apparatus. On the other hand, for example, in regard to personal computers, the architecture or circuitry is open to the public, and it is possible to add a board, or install various application software to add or alter various functions. \n\nAccordingly, in regard to a personal computer, it can be performed comparatively readily to directly access or alter data on an internal bus of the personal computer by adding predetermined hardware or applying a software program. This signifies that, by producing and applying application software, it can be performed readily, for example, to receive data transmitted as ciphered data from a DVD player to a television receiver and decipher or copy the received data by a personal computer. \n\nIn other words, a personal computer has a weak connection between a link portion which effects communication via a bus and an application portion which prepares data to be transmitted and utilizes received data, and includes many portions which can be modified physically and logically by a user. In contrast, a CE apparatus has a strong connection between them and includes little portion which allows intervention of a user. \n\nSUMMARY OF THE INVENTION \n\nIt is an object of the present invention to provide an enciphering, apparatus and method, a deciphering apparatus and method and an information processing apparatus and method by which illegal copying of data can be prevented with a higher degree of certainty. \n\nIn order to attain the object described above, according to an aspect of the present invention to provide an enciphering apparatus, comprising enciphering means for enciphering data using a cryptographic key, first generating means for generating a first key, second generating means for generating a second key which is changed at a predetermined timing while the data is enciphered, and producing means for producing the cryptographic key using the first key and the second key. \n\nAccording to another aspect of the present invention, there is provided an enciphering method, comprising the steps of enciphering data using a cryptographic key, generating a first key, generating a second key which is changed at a predetermined timing while the data are enciphered, and producing the cryptographic key using the first key and the second key. \n\nWith the enciphering apparatus and the enciphering method, since a cryptographic key is produced using a first key and a second key which is changed at a predetermined timing while data is enciphered, encipherment can be performed with a high degree of security. \n\nAccording to a further aspect of the present invention, there is provided a deciphering apparatus, comprising receiving means for receiving enciphered data, deciphering means for deciphering the received data using a cryptographic key, first generating means for generating a first key, second generating means for generating a second key which is changed at a predetermined timing while the data is deciphered, and producing means for producing the cryptographic key using the first key and the second key. \n\nAccording to a still further aspect of the present invention, there is provided a deciphering method, comprising the steps of receiving enciphered data, deciphering the received data using a cryptographic key, generating a first key, generating a second key which is changed at a predetermined timing while the data is deciphered, and producing the cryptographic key using the first key and the second key. \n\nWith the deciphering apparatus and the deciphering method, since a cryptographic key is produced using a first key and a second key which is changed at a predetermined timing while data is deciphered, enciphered data can be deciphered with a higher degree of security. \n\nAccording to a yet further aspect of the present invention, there is provided an information processing system, comprising a plurality information processing apparatus connected to each other by a bus, the information processing apparatus including first information processing apparatus each having a function whose change is not open to a user, and second information processing apparatus each having a function whose change is open to a user, each of the first information processing apparatus including first receiving means for receiving, enciphered data, first deciphering means for deciphering the data received by the first receiving means using a cryptographic key, first generating means for generating a first key, second generating means for generating a second key which is changed at a predetermined timing while the data is deciphered, and first producing means for producing the cryptographic key using the first key generated by the first generating means and the second key generated by the second generating means, each of the second information processing apparatus including second receiving means for receiving enciphered data, third generating means for generating the first key, fourth generating means for generating the second key which is changed at a predetermined timing while the data is deciphered, second producing means for producing a first cryptographic key using one of the first key generated by the third generating means and the second key generated by the fourth generating means, third producing means for producing a second cryptographic key using the other of the first key generated by the third generating means and the second key generated by the fourth means, second deciphering means for deciphering the enciphered data received by the receiving means using the first cryptographic key, and third deciphering means for further deciphering the data deciphered by the second deciphering means using the second cryptographic key. \n\nAccording to a yet further aspect of the present invention, there is provided an information processing method for an information processing system composed of a plurality information processing apparatus connected to each other by a bus, the information processing apparatus including first information processing apparatus each having a function whose change is not open to a user, and second information processing apparatus each having a function whose change is open to a user, comprising the steps performed by each of the first information processing apparatus of receiving enciphered data, deciphering the data received in the receiving step using a cryptographic key, generating a first key, generating a second key which is changed at a predetermined timing while the data is deciphered, and producing the cryptographic key using the first key generated in the first generating step and the second key generated in the second generating step, and the steps performed by each of the second information processing apparatus of receiving enciphered data, generating the first key, generating the second key which is changed at a predetermined timing while, the data is deciphered, producing a first cryptographic key using one of the first key and the second key, producing a second cryptographic key using the other of the first key and the second key, deciphering the enciphered data received in the receiving step using the first cryptographic key, and deciphering the deciphered data further using the second cryptographic key. \n\nWith the information processing system and the information processing method, since, in the first information processing apparatus which have functions whose change is not open to a user, a cryptographic key is produced using a first key and a second key which is changed at a predetermined timing while data is deciphered, but in the second information processing apparatus which have functions whose change is open to a user, a first cryptographic key is produced using one of a first key and a second key which is changed at a predetermined timing while data is deciphered, and then a second cryptographic key is produced using the other, whereafter the enciphered data is deciphered using the first cryptographic key, and the deciphered data is further deciphered using the second cryptographic key, the information processing apparatus and method has a higher degree of reliability than ever. \n\nAccording to a yet further aspect of the present invention, there is provided an information processing apparatus, comprising receiving means for receiving data transmitted thereto through a bus, producing means composed of a software program for producing a first cryptographic key and a second cryptographic key which is changed at a predetermined timing while the data is deciphered from the data received by the receiving means, first deciphering means for deciphering the enciphered data received by the receiving means using one of the first cryptographic key and the second cryptographic key produced by the producing means, and second deciphering means for deciphering and processing the data deciphered by the first deciphering means further using the other of the first cryptographic key and the second cryptographic key produced by the producing means. \n\nAccording to a yet further aspect of the present invention, there is provided an information processing method, comprising the steps of receiving data transmitted thereto through a bus, producing, from the received data, a first cryptographic key and a second cryptographic key which is changed at a predetermined timing while the data is deciphered, deciphering the received enciphered data using one of the first cryptographic key and the second cryptographic key, and deciphering the deciphered data further using the other of the first cryptographic key and the second cryptographic key. \n\nWith the information processing apparatus and the information processing method, since a first cryptographic key and a second cryptographic key which is changed at a predetermined timing while data is deciphered are produced based on a software program, decipherment can be performed for each application program, and illegal copying can be prevented with a higher degree of accuracy. \n\nThe above and other objects, features and advantages of the present invention will become apparent from the following description and the appended claims, taken in conjunction with the accompanying drawings in which like parts or elements are denoted by like reference characters. \n\nDESCRIPTION OF THE PREFERRED EMBODIMENTS \n\nReferring first to FIG. 1, there is shown an exemplary information processing system to which the present invention is applied. The information processing system shown includes a DVD player 1, a personal computer 2, an magneto-optical disk apparatus 3, a data broadcasting receiver 4, a monitor 5 and a television receiver 6 all connected to each other by an IEEE 1394 serial bus 11.\n\nReferring now FIG. 2, there are shown more detailed internal constructions of the DVD player 1, personal computer 2 and magneto-optical disk apparatus 3 of the information processing system shown in FIG. 1. The DVD player 1 is connected to the 1394 bus 11 by a 1394 interface 26. The DVD player 1 includes a CPU 21 which executes various processes in accordance with programs stored in a ROM 22. A RAM 23 is used to suitably stores data, programs and so forth necessary for the CPU 21 to execute various processes. An operation section 24 is formed from buttons, switches, a remote controller and so forth, and when it is operated by a user, it outputs a signal corresponding to the operation. A drive 25 drives a DVD not shown to reproduce data recorded on the DVD. An EEPROM (Electrically Erasable Programmable Read Only Memory) 27 stores information such as key information which must remain stored also after the power supply to the apparatus is turned off. An internal bus 28 connects the components to each other.\n\nThe magneto-optical disk apparatus 3 includes a CPU 31, a ROM 32, a RAM 33, an operation section 34, a drive 35, a 1394 interface 36, an EEPROM 37 and an internal bus 38 which have similar functions to those of the DVD player 1 described above. Here, description of the similar components is omitted to avoid redundancy. It is to be noted, however, that the drive 35 drives not a DVD but a magneto-optical disk not shown to record or reproduce data onto or from the magneto-optical disk.\n\nThe personal computer 2 is connected to the 1394 bus 11 via a 1394 interface 49. The personal computer 2 includes a CPU 41 which executes various processes in accordance with programs stored in a ROM 42, and a RAM 43 into which data, programs and so forth necessary for the CPU 41 to execute various processes are stored suitably. A keyboard 45 and a mouse 46 are connected to an input/output interface 44, and the input/output interface 44 outputs signals inputted thereto from the keyboard 45 and the mouse 46 to the CPU 41. Further, a hard disk drive (HDD) 47 is connected to the input/output interface 44 so that data, programs and so forth can be recorded onto and reproduced from a hard disk not shown by the hard disk driver 47. Further, an extended board 48 can be suitably mounted onto the input/output interface 44 so that a necessary function can be additionally provided to the personal computer 2. An EEPROM 50 is used to store information which must remain stored also after the power supply to the personal computer 2 is turned off such as information of various keys. An internal bus 51 is formed from, for example, a PCI (Peripheral Component Interconnect) bus, a local bus or the like and connects the components mentioned above to each other.\n\nIt is to be noted that the internal bus 51 is open to the user so that the user can suitably receive data transmitted by the internal bus 51 by suitably connecting a predetermined board to the extended board 48 or by producing and installing a predetermined software program.\n\nIn contrast, in any of consumer electronics (CE) apparatus such as the DVD player 1 and the magneto-optical disk apparatus 3, the internal bus 28 or the internal bus 38 is not open to a user and the user cannot acquire data transmitted in it unless special alteration is performed for it.\n\nSubsequently, a procedure of authentication performed between a source and a sink is described. Here, the authentication procedure is performed, for example, as seen in FIG. 3, between firmware 20 as one of software programs stored in advance in the ROM 22 of the DVD player 1 serving as a source and a license manager 62 as one of software programs stored in the ROM 42 of the personal computer 2 serving as a sink and processed by the CPU 41.\n\nFIG. 4 illustrates a procedure of authentication performed between the source (DVD player 1) and the sink (personal computer 2). A service key (service_key) and a function (hash) are stored in advance, in the EEPROM 27 of the DVD player 1. They are both provided to the user of the DVD player 1 from the proprietor of copyright, and the user stores them in the EEPROM 27 secretly.\n\nThe service key is provided for each information provided by the proprietor of copyright and is common to systems which are constructed using the 1394 bus 11. It is to be noted that the system in the present specification signifies a general apparatus formed from a plurality of apparatus.\n\nThe hash function is a function for outputting data of a fixed length such as 64 bits or 128 bits in response to an input of an arbitrary length, and is a function with which, when y (=hash(x)) is given, it is difficult to determine x, and also it is difficult to determine a set of x1 and x2 with which hash(x1)=hash(x2) is satisfied. As representative ones of one-directional hash functions, MD5, SHA and so forth are known. The one-directional hash function is explained in detail in Bruce Schneier, Applied Cryptography (Second Edition), Wiley. \n\nMeanwhile, for example, the personal computer 2 as a sink stores an identification number (ID) and a license key (license_key) given from the proprietor of copyright and peculiar to the personal computer 2 itself secretly in the EEPROM 50. The license key is a value obtained by applying the hash function to data (ID?service_key) of n+m bits obtained by connecting the ID of n bits and the service key of m bits. In particular, the license key is represented by the following expression: \nlicense_key= has(ID?service_key)\n\nFor the ID, for example, a node_unique_ID prescribed in the standards for a 1394 bus can be used. The node_unique_ID is composed of, as seen from FIG. 5, 8 bytes (64 bits), wherein the first 3 bytes are managed by the IEEE and given from the IEEE to the individual maker of electronic apparatus. Meanwhile, the lower 5 bytes can be given by each maker to each apparatus provided to any user by the maker itself. Each maker applies, for example, numbers of the lower 5 bytes serially to individual apparatus with a single number applied to one apparatus, and if all available numbers for the 5 bytes are used up, then another node_unique_ID whose upper 3 bytes are different is given to the maker whereas a single number is applied to one apparatus with the lower 5 bytes. Accordingly, the node_unique_ID is different among different units irrespective of its maker and is unique to each unit.\n\nIn step S 1, the firmware 20 of the DVD player 1 controls the 1394 interface 26 to request the personal computer 2 for an ID through the 1394 bus 11. The license manager 62 of the personal computer 2 receives the request for an ID in step S2. In particular, the 1394 interface 49 outputs, when it receives the signal of the request for an ID transmitted thereto from the DVD player 1 through the 1394 bus 11, the signal to the CPU 41. The license manager 62 of the CPU 41 reads out, when the request for an ID is received, the ID stored in the EEPROM 50 and transmits the ID from the 1394 bus 11 to the DVD player 1 through the 1394 interface 49 in step S3.\n\nIn the DVD player 1, the ID is received by the 1394 interface 26 in step S4 and supplied to the firmware 20 which is being operated by the CPU 21.\n\nThe firmware 20 couples, in step S5, the ID transmitted thereto from the personal computer 2 and the service key stored in the EEPROM 27 to produce data (ID?service_key) and applies a hash function as given by the following expression to the data to produce a key lk: \nlk=hash (ID?Service_key)\n\nThen, in step S 6, the firmware 20 produces a cryptographic key sk which is hereinafter described in detail. The cryptographic key sk is utilized as a session key in the DVD player 1 and the personal computer 2.\n\nThen, in step S 7, the firmware 20 enciphers the cryptographic key sk produced in step S6 using the key lk produced in step S5 as a key to obtain enciphered data (enciphered key) e. In other words, the firmware 20 calculates the following expression: \ne=Enc (lk,sk)\n where Enc(A, B) represents to encipher data B using a key A in a common key cryptography. \n\nThen, in step S 8, the firmware 20 transmits the enciphered data e produced in step S7 to the personal computer 2. In particular, the enciphered data e is transmitted from the 1394 interface 26 of the DVD player 1 to the personal computer 2 through the 1394 bus 11. In the personal computer 2, the enciphered data e is received by the 1394 interface 49 in step S9. The license manager 62 deciphers the enciphered data e received in this manner using the license key stored in the EEPROM 50 in accordance with the following expression to produce a deciphering key sk?: \nsk?=Dec (license_key,e).\n where Dec(A, B) represents to decipher data B using a key A in a common key cryptography. \n\nIt is to be noted that, as an algorithm for encipherment in the common key cryptography, the DES is known. Also the common key cryptography is explained in detail in Applied Cryptography (Second Edition) mentioned hereinabove. \n\nThe key lk produced in step S 5 by the DVD player 1 has a value equal to that (license_key) stored in the EEPROM 50 of the personal computer 2. In other words, the following expression is satisfied: \nlk =license_key\n\nAccordingly, the key sk? obtained by the decipherment in step S 10 by the personal computer 2 has a value equal to that of the cryptographic key sk produced in step S6 by the DVD player 1. In other words, the following expression is satisfied: \nsk?=sk \n\nIn this manner, the keys sk and sk? which are equal to each other can be possessed commonly by both of the DVD player 1 (source) and the personal computer 2 (sink). Thus, either the key sk can be used as it is as a cryptographic key, or a pseudo-random number may be produced based on the key sk and used as a cryptographic key by both of the source and the sink.\n\nSince the license key is produced based on the ID peculiar to the apparatus and the service key corresponding to information to be provided as described above, another apparatus cannot produce the key sk or sk?. Further, any apparatus which is not authorized by the proprietor of copyright cannot produce the sk or sk? since it does not have a license key. Accordingly, when the DVD player 1 thereafter enciphers reproduction data using the cryptographic key sk and transmits resulting data to the personal computer 2, where the personal computer 2 has the license key obtained legally, since it has the cryptographic key sk?, it can decipher the enciphered reproduction data transmitted thereto from the DVD player 1. However, where the personal computer 2 is not legal, since it does not have the cryptographic key sk?, it cannot decipher the enciphered reproduction data transmitted thereto. In other words, since only a legal apparatus can produce the common cryptographic keys sk and sk?, authentication is performed as a result.\n\nEven if the license key of the single personal computer 2 is stolen, since the ID is different among different units, it is impossible for another apparatus to decipher enciphered data transmitted thereto from the DVD player 1 using the license key. Accordingly, the security is augmented.\n\nFIG. 6 illustrates an exemplary procedure when not only the personal computer 2 but also the magneto-optical disk apparatus 3 function as a sink with respect to a source (DVD player 1).\n\nIn this instance, an ID 1 is stored as an ID and a license_key1 is stored as a license key in the EEPROM 50 of the personal computer 2 which serves as a sink1, but in the magneto-optical disk apparatus 3 which serves as a sink2, an ID2 is stored as an ID and a license_key2 is stored as a license key in the EEPROM 37.\n\nProcesses in steps S 11 to S20 performed between the DVD player 1 (source) and the personal computer 2 (sink1) are substantially similar to the processes in steps S1 to S10 illustrated in FIG. 4. Therefore, description of the processes in steps S11 to S20 is omitted to avoid redundancy.\n\nAfter the DVD player 1 cooperates with the personal computer 2 to perform an authentication procedure in such a manner as described above, it requests, in step S21, the magneto-optical disk apparatus 3 for an ID. When the ID requesting signal is received via the 1394 interface 36 in step S22 by the magneto-optical disk apparatus 3, firmware 30 (FIG. 10) in the magneto-optical disk apparatus 3 reads out the ID (ID2) stored in the EEPROM 37 in step S23 and transmits the ID from the 1394 interface 36 to the DVD player 1 through the 1394 bus 11. The firmware 20 of the DVD player 1 receives the ID2 via the 1394 interface 26 in step S24 and produces a key lk2 based on the following expression in step S25: \nlk 2=hash(ID2?service_key)\n\nFurther, the firmware 20 calculates the following expression in step S26 to encipher the key sk produced in step S16 using the key lk2 produced in step S25 to produce enciphered data e2: \ne 2=Enc(lk2,sk)\n\nThen, in step S 27, the firmware 20 transmits the enciphered data e2 from the 1394 interface 26 to the magneto-optical disk apparatus 3 through the 1394 bus 11.\n\nThe magneto-optical disk apparatus 3 receives the enciphered data e2 via the 1394 interface 36 in step S28, and calculates the following expression in step S29 to produce a cryptographic key sk2?: \nsk 2?=Dec(license_key2,e2)\n\nThe cryptographic keys sk 1? and sk2? are obtained by the personal computer 2 and the magneto-optical disk apparatus 3, respectively, in such a manner as described above. The values of them are an equal value to the cryptographic key sk of the DVD player 1.\n\nWhile, in the procedure of FIG. 6, the DVD player 1 requests the personal computer 2 and the magneto-optical disk apparatus 3 individually for an ID and processes the received IDs, where a request for an ID can be delivered by broadcast communication, such a procedure as illustrated in FIG. 7 can be performed.\n\nIn particular, in the procedure of FIG. 7, the DVD player 1 as a source requests all sinks, which are, in the present procedure, the personal computer 2 and the magneto-optical disk apparatus 3, for an ID by broadcast communication. After the personal computer 2 and the magneto-optical disk apparatus 3 receive the signal of the request for transfer of an ID in steps S42 and S43, respectively, each of them reads out the ID1 or the ID2 stored in the EEPROM 50 or the EEPROM 37 and transfers it to the DVD player 1 in step S44 or step S45. The DVD player 1 receives the IDs in steps S46 and S47.\n\nThe DVD player 1 produces a cryptographic key lk1 based on the following expression in step S48: \nlk 1=hash(ID1?service_key)\n\nFurther, in step S 49, a cryptographic key lk2 is produced based on the following expression: \nlk 2=has(ID2?service_key)\n\nIn the DVD player 1, a cryptographic key sk is produced further in step S50, and in step S51, the cryptographic key sk is enciphered as given by the following expression using the key lk1 as a key: \ne 1=Enc(lk1,sk)\n\nFurther, in step S 52, the cryptographic key sk is enciphered in accordance with the following expression using the key lk2 as a key: \ne 2=Enc(lk2,sk)\n\nFurthermore, in step S 53, the values ID1, e1, ID2 and e2 thus obtained are coupled as given by the following expression to produce enciphered data e: \ne=ID 1?e1?ID2?e2\n\nThe encip... | Sony Corporation,Tokyo,JP | Sony Corporation | REDWOOD TECHNOLOGIES LLC | REDWOOD TECHNOLOGIES LLC | Ishiguro, Ryuji | Osawa, Yoshitomo | Osakabe, Yoshio | Sato, Makoto | Shima, Hisato | Asano, Tomoyuki | 6 | Frommer Lawrence & Haug LLP | Frommer, William S. | NaN | Song, Hosuk | US | Dead | 12 | 2014 | US | 5 | 2013 | 1997-04-23 | 1997 | H04, G06, G09, G11 | H04, G06, G11 | 380044 | 713189 | US4972475A | US4203166A | US5148485A | US6105012A | EP32107B1 | JP63070634A | JP7175411A | JP8195735A | JP2006340407A | WO1986007221A1 | US5278905A | US4956863A | US5060266A | US7860248B2 | CH648167A5 | DE19705350C2 | JP1279650A | JP7193566A | JP10301492A | US4850017A | US5425103A | JP3080646A | JP4117826A | JP7162692A | JP8335040A | JP2013017225A | WO1997012461A1 | JP8046948A | US5253294A | US5912973A | US7298842B2 | DE19524021C2 | EP93525B1 | EP756276A1 | JP8503569A | JP8204702A | JP8234658A | JP8331076A | JP2010246158A | JP2012070430A | US4531021A | US4791669A | US5870477A | US8170206B2 | JP4117411A | JP4189045A | JP5075598A | JP7107082A | JP2007043738A | JP2007306581A | JP2014078589A | US4689606A | US5029207A | US5838797A | US6539094B1 | US6973189B1 | EP12974B1 | JP4211543A | JP5336136A | JP8279281A | US6868404B1 | US6256391B1 | US8594325B2 | US4887296A | US5341425A | US7242769B2 | EP94423B1 | EP765061A2 | FR2732531A1 | JP59006948A | WO1996033564A1 | AU712649B2 | US4823388A | AU7126491B | DE3432651B3 | EP720326A2 | JP62503066A | JP5175411A | JP8008913A | WO1997047111A1 | 80 | Schneier Bruce: Applied Cryptography Second Edition: Protocols, algoriths, and source code in C, 1996, John Wiley & Sons, USA XP002104180, pp. 180-181; 265-301; 30-31; 429-459 and 351-354. | Encryption for Open VMS, Version 1.3 Digital Software Product Descriptions, Updated: Apr. 30, 1996, Retreived From Internet: May 27, 1999 Via http:/www.digital.com/inro/sp2674, XP002104179, The whole document. | Bloks R.H.J., The IEEE1394 High Speed Serial Bus, Philips Journal of Research, vol. 50, No. 1, Jan. 1, 1996; pp. 209-216. DOI:10.1016/0165-5817(96)81310-6 210 | Kunzman A.J. et al., 1394 High Performance Serial Bus: The Digital Interface for ATV, IEEE Transactions on Consumer Electronics, vol. 41, No. 3, Aug. 1, 1995; pp. 893-900. DOI:10.1109/30.468067 145 | Stream Ciphers, Jul. 26, 2006, pp. 1-6. | Schneier Bruce: Applied Cryptography Second Edition: Protocol, algoriths, and source code in C 1996, John Wiley & Sons, USA, XP002104588. | Tasuaki Okamoto, Hiroshi Yamamoto, Series / Mathematics of information science Modern encryption, Industrial book Co., Ltd., Jun. 30, 2997, pp. 50-52. | Alfred J. Menezes et al., Handbook of Applied Cryptography, 1996 pp. 489-499. | Bruce Schneier, Applied Cryptography: Protocols, Algorithms, and Source Code in C, John Wiley & Sons, Inc. 1996 Second Edition, pp. 205-206. | Whitfield Diffie and Martin E. Hellman, Privacy and Authentication: An Introduction to Cryptography, pp. 397-428, Proceedings of the IEEE, vol. 67, No. 3, Mar. 1979. DOI:10.1109/PROC.1979.11256 161 | Eiji Okamoto, Encoding Technique for Aiming at Attainment of Bright Information Society, ?5 ? Decoding Key Delivery Technique, bit, Japan, Kyoritsu Shuppan Co., Ltd, Nov. 1, 1991, vol. 23, No. 12, pp. 51-59. | Masanori Suzuki et al., Real Time Transfer Mode of IEEE13941995 (Fire Wire) and Multimedia Correspondence Protocol, Interface, Japan, CQ Publishing Co., Ltd., Jan. 1, 1997, vol. 23, No. 1, p. 136-146. | Haruo Ushio et al., Special Edition of DVD Part 1, Try to Find out Function and Ability of New Model DVd, April issue of Video Salon, Japan, Genkosha Co., Apr. 1, 1997, vol. 33, No. 4 (201st Volume of the Set), p. 48-61. | Akira Komura, Special Edition/News Flash of DV from Europe (Second Step), Japanese Edition DV Deck will Develop in this Way, June issue of Video Salon, Japan, Genkosha Co., Jun. 1, 1996, vol. 31, No. 6(194st Volume of the Set), p. 26-35. | Office Action issued in corresponding Japanese application No. 2013-241600 dated Feb. 13, 2014 with the English translation. | Office Action issued in corresponding Japanese application No. 2013-123625 dated Mar. 11, 2014. | Office Action issued in corresponding Japanese application No. 2013-123625 dated Mar. 18, 2014. | Office Action issued in corresponding Japanese application No. 2013-251917 dated Apr. 24, 2014 and the English translation. | 18 | US20150381359A1 | US9467287B2 | 2 | 2021-11-04 AS ASSIGNMENT REDWOOD TECHNOLOGIES, LLC, TEXAS ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:WI-FI ONE, LLC;REEL/FRAME:058026/0232 2021-11-03 | 2021-11-03 AS ASSIGNMENT WI-FI ONE, LLC, TEXAS RELEASE BY SECURED PARTY;ASSIGNOR:CORTLAND CAPITAL MARKET SERVICES LLC;REEL/FRAME:058014/0725 2021-11-03 | 2019-02-26 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - 2018-12-30 | 2019-02-04 STCH INFORMATION ON STATUS: PATENT DISCONTINUATION - PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362 | 2019-02-04 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | 2018-08-13 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | 2018-05-23 AS ASSIGNMENT CORTLAND CAPITAL MARKET SERVICES LLC, AS COLLATERA INTELLECTUAL PROPERTY SECURITY AGREEMENT;ASSIGNOR:WI-FI ONE, LLC;REEL/FRAME:046222/0786 2018-05-21 | 2018-04-06 AS ASSIGNMENT WI-FI ONE, LLC, TEXAS ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:SONY CORPORATION;REEL/FRAME:045853/0047 2018-01-26 | US8923511B2 | CN100418317C | CN1190033C | CN1206272A | CN1632710A | DE69836450D1 | DE69836450T2 | EP1298517A1 | EP1298517B1 | EP1742137A1 | EP1742137B1 | EP1742138A1 | EP2385439A1 | EP2781985A1 | EP2781985B1 | EP2781986A1 | EP2781986B1 | EP2998820A1 | EP2998820B1 | EP875813A2 | EP875813A3 | EP875813B1 | HK1022060A1 | HK1080562A1 | ID20227A | JP10301492A | KR1998081634A | KR466474B1 | MY122244A | RU2239954C2 | TW379308B | US20030191956A1 | US20060140402A1 | US20070140484A1 | US20080013723A1 | US20100290619A1 | US20120257744A1 | US20130236009A1 | US20150381359A1 | US6256391B1 | US7233665B1 | US7242769B2 | US7298842B2 | US7860248B2 | US8170206B2 | US8594325B2 | US9467287B2 | 19981029ID20227A_ |
| 5 | US8922696B2 | Portable terminal with rotatable axial flip unit and dual lens arrangement | JP1999354459A | US2000733984A | US2006409526A | US2009349800A | 1999-12-14 | 2000-12-12 | 2006-04-21 | 2009-01-07 | US13271729A | 2011-10-12 | B2 | 2014-12-30 | Shibata Junichiro|Tokyo, JP | Yamaguchi Shuuji|Tokyo, JP | Lenovo Innovations Limited (Hong Kong),Quarry Bay,HK | Shibata Junichiro,Tokyo,JP | Yamaguchi Shuuji,Tokyo,JP | LENOVO INNOVATIONS LIMITED (HONG KONG) | T04 E | W01 E | W02 E | W04 E | T04-K01B | T04-K03D | W01-C01D3C | W01-C01P6G | W02-F08 | W04-M01D3 | W04-N05 | G06F000116 | G06F001502 | H04N0005225 | H04B000138 | H04B00013822 | H04M000100 | H04M000102 | H04M000121 | H04N000714 | H04W002800 | H04W008802 | H04M0001021 | H04M00010243 | H04M00010245 | H04N002345 | H04N0023531 | H04N0023631 | H04M00010218 | H04M225022 | H04M225052 | H04N2007145 | 34833306 | 348375 | NaN | This portable terminal comprises a main unit having a microphone, a key operation unit, and a radio sending/receiving function of image and sound, a rotation axial unit having a video camera and an operation dial, an image display unit with a touch panel capable of displaying an image taken by the video camera, a received image and a screen for input operation, and a flip unit having the image display unit, a CCD camera, a speaker and an operation button. The rotation axial unit further includes an opening/shutting axis for connecting the main unit and the flip unit in a mutually rotatable way and a rotation axis for connecting the flip unit in a way of rotating the flip unit across the above rotation in the horizontal direction, and when the flip unit is opened and rotated across, it is used as a video camera with a monitor. | Portable terminal with rotatable axial flip unit and dual lens arrangement | What is claimed is: \n1. A portable terminal comprising: \na main unit \na flip unit having a monitor screen connected with said main unit; \na first photographic lens provided at a predetermined position in an axial unit; and \na second photographic lens provided at a predetermined position on the same side with said monitor screen; \nwherein said first photographic lens takes an image of a different direction from a direction from which said second photographic lens takes an image; and \nwherein said images taken by said first and second photographic lenses are displayed on said monitor screen; \nwherein said axial until has a structure of closing both units making inside surface of the main unit into contact with inside surface of the flip unit. \n2. A portable terminal as set forth in claim 1, further comprising: \nand axial unit state sensor for detecting angle or positional relationship of the flip unit and the main unit, according to the angle of a movable portion of the axial unit; and \na means for selecting and executing each function predetermined based on the angle or relationship of the flip unit and the main unit detected by said axial unit state sensor, from various usable functions provided in the portable terminal. \n3. A portable terminal as set forth in claim 2, further comprising: \na microphone on the inside of the main unit; \na speaker on the inside of the flip unit; \na communication unit for sound communication; and \na means for putting a communication function through a wireless communication line into an executable state \nwhen the inside surface of the main unit and the inside surface of the flip unit are opened in the same direction. \n4. A portable terminal as set forth in claim 2, further comprising: \na microphone on one surface of the main unit; \na speaker on the outside of the flip unit; \na communication unit for sound communication; and \na means for putting a communication function through a wireless communication line into an executable state \nwhen the surface having said microphone on the main unit and the outside surface of the flip unit are opened in the same direction. \n5. A portable terminal as set forth in claim 3, further comprising: \na microphone on the inside of the main unit; \nsaid communication unit \nincluding a communication means of an image; and \na means for putting a communication function of a TV telephone through a wireless communication line into an executable state \nwhen the surface having said microphone on the main unit and the inside surface of the flip unit are opened in the same direction. \n6. A portable terminal as set forth in claim 2, further comprising: \nan information processing unit for processing input information and instruction; \nthe monitor screen that is a monitor with a touch panel; and \na means for putting a function of an information terminal for processing the input information and instruction upon receipt of the input from the touch panel, into an executable state \nwhen the outside surface of the flip unit and one surface of the main unit are closed in contact with each other. \n7. A portable terminal as set forth in claim 3, further comprising: \na storing means for storing electronic data; \na means for converting a static image taken by said first photographic lens and said second photographic lens into electronic data; and \na means for putting a photographic function as a digital camera into an executable state \nwhen the main unit and the flip unit are opened so as to direct said first photographic lens and said second photographic lens in an inverse direction. \n8. A portable terminal as set forth in claim 7, further comprising: \na means for converting a moving image take by said first photographic lens and said second photographic lens into electronic data; and \na means for putting a photographic function as a digital video camera into an executable state \nwhen the main unit and the flip unit are opened so as to direct said first photographic lens and said second photographic lens in an inverse direction. \n9. A portable terminal as set forth in claim 3, further comprising: \na means for stopping a predetermined function to be finished, of the functions under activation, after judging that the function is in unused state \nwhen the inside surface of the main unit and the inside surface of the flip unit are closed in contact with each other. | 9 | 1. A portable terminal comprising: \na main unit \na flip unit having a monitor screen connected with said main unit; \na first photographic lens provided at a predetermined position in an axial unit; and \na second photographic lens provided at a predetermined position on the same side with said monitor screen; \nwherein said first photographic lens takes an image of a different direction from a direction from which said second photographic lens takes an image; and \nwherein said images taken by said first and second photographic lenses are displayed on said monitor screen; \nwherein said axial until has a structure of closing both units making inside surface of the main unit into contact with inside surface of the flip unit. | 1. A portable terminal comprising: a main unit a flip unit having a monitor screen connected with said main unit; a first photographic lens provided at a predetermined position in an axial unit; and a second photographic lens provided at a predetermined position on the same side with said monitor screen; wherein said first photographic lens takes an image of a different direction from a direction from which said second photographic lens takes an image; and wherein said images taken by said first and second photographic lenses are displayed on said monitor screen; wherein said axial until has a structure of closing both units making inside surface of the main unit into contact with inside surface of the flip unit. | This application is a Continuation of application Ser. No. 12/349,800 filed Jan. 7, 2009, which is a Continuation of application Ser. No. 11/406,526 filed Apr. 21, 2006, which is a Continuation of application Ser. No. 09/733,984, now U.S. Pat. No. 7,084,919, which claims priority from Japanese Patent Application No. 11-354459 filed on Dec. 14, 1999. The entire disclosures of the prior application Ser. Nos. 12/349,800, 11/406,526, 09/733,984 and 11/354,459 are hereby incorporated by reference. \n\nBRIEF DESCRIPTION OF THE DRAWINGS \n\nThe present invention will be understood more fully from the detailed description given here below and from the accompanying drawings of the preferred embodiment of the invention, which, however, should not be taken to be limitative to the invention, but are for explanation and understanding only. \n\nIn the drawings: \n\nFIG. 1 is a front view showing the case of using the functions of a video camera, a digital still camera and a TV telephone in a portable terminal according to a first embodiment of the present invention;\n\nFIG. 2 is a rear elevation view of the portable terminal of FIG. 1 according to the first embodiment of the present invention;\n\nFIG. 3 is a perspective view of the portable terminal of FIG. 1 according to the first embodiment of the present invention;\n\nFIG. 4 is a front view from the side of a flip unit, showing the state of inwardly closing an operation key and a monitor with a touch panel of the portable terminal according to the first embodiment of the present invention;\n\nFIG. 5 is a side elevation view from the side of a photographic lens, in the portable terminal of FIG. 4 according to the first embodiment of the present invention;\n\nFIG. 6 is a bottom view of the portable terminal of FIG. 4 according to the first embodiment of the present invention;\n\nFIG. 7 is a rear elevation view from the side of the main unit in the portable terminal of FIG. 4 according to the first embodiment of the present invention;\n\nFIG. 8 is a plan view from the side of the top in the portable terminal of FIG. 4 according to the first embodiment of the present invention;\n\nFIG. 9 is a front view showing the state of opening the operation key of the main unit and the monitor with a touch panel on the flip unit in the same direction, in the portable terminal according to the first embodiment of the present invention;\n\nFIG. 10 is a perspective view showing the state of inwardly closing the operation key and the monitor with a touch panel in the portable terminal according to the first embodiment of the present invention;\n\nFIG. 11 is a perspective view showing the state of inwardly closing the face of the operation key of the main unit and the face of the liquid crystal monitor of the flip unit, in the portable terminal according to the first embodiment of the present invention;\n\nFIG. 12 is a front view showing the case of using a function of pen input, in the portable terminal according to the first embodiment of the present invention;\n\nFIG. 13 is a block diagram showing the internal structure of the portable terminal according to the first embodiment of the present invention;\n\nFIG. 14 is a flow chart for use in describing the processing of the portable terminal according to a second embodiment of the present invention;\n\nFIG. 15 is a front view showing the state of opening the speaker of the flip unit and the operation key of the main unit in the same direction, in the portable terminal according to a third embodiment of the present invention;\n\nFIG. 16 is a front view showing the case of using a function of a portable telephone, in the portable terminal according to the third embodiment of the present invention;\n\nDESCRIPTION OF THE PREFERRED EMBODIMENT \n\nThe preferred embodiment of the present invention will be discussed hereinafter in detail with reference to the accompanying drawings. In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention. It will be obvious, however, to those skilled in the art that the present invention may be practiced without these specific details. In other instance, well-known structures are not shown in detail in order to unnecessary obscure the present invention. \n\nFIGS. 1 to 12 are views each showing a main unit and a flip unit of a portable terminal according to a first embodiment of the present invention, which are put in various directions and seen from various directions.\n\nWith reference to FIGS. 1 to 12, in the portable terminal of the embodiment of the present invention, a main unit 10 and a flip unit 20 are connected in a movable way through an axial unit 30.\n\nThe axial unit 30 is provided with an opening/shutting axis 31 and a rotation axis 32 as illustrated in FIG. 1. The opening/shutting axis 31 is connected to the portable terminal so that the main unit and the flip unit can be relatively rotatable, and the rotation axis 32 is connected there in a rotatable way in the vertical direction across the rotation of the opening/shutting axis 31.\n\nFurther, a first photographic lens 33 for a digital camera is provided on one end of the opening/shutting axis 31 and an operation dial 34 is provided on the other end thereof.\n\nThe flip unit 20 is inside provided with a monitor with a touch panel 21, an operation button 22 for switching a screen, a second photographic lens 23 for a TV telephone and a speaker phone 24 as illustrated in FIG. 1.\n\nThe main unit 10 of the terminal is inside provided with an operation key 17 for inputting a telephone number, a moving image/static image switch 16 for switching the kind of an image to be taken and a microphone 18 as illustrated in FIG. 9. Further it is provided with a strobe 14 and a button 13 for taking an image on one side thereof as illustrated in FIG. 2, and it is provided with a zoom button 11, a data input/output terminal 12-2, a dummy plug for data input/output terminal 12-3, and a sound input/output terminal 12-1 on the other side thereof as illustrated in FIG. 1.\n\nFurther, the main unit 10 is provided with an input pen storing unit 19 for storing an input pen 40 used at a time of pen input.\n\nFIG. 13 is a block diagram showing the internal structure of the portable terminal of this embodiment.\n\nWith reference to FIG. 13, the portable terminal of this embodiment comprises a first photographic lens 33, a second photographic lens 23, a monitor with a touch panel 21, a speaker 24, a microphone 18, an operation unit 52 for a user performing various operations, a storing unit 53 for storing the taken picture, a communication unit 54 for wireless communication, etc. and an axial unit state sensor 55 for examining the state of the axial unit 30 to detect the directions of the main unit 10 and the flip unit 20, which are respectively controlled by a control unit 51.\n\nThe portable terminal of the embodiment performs various functions of a telephone, a TV telephone, a digital camera, a digital video camera, a pen input terminal and the like, by directing the main unit 10 and the flip unit 20 in the suitable direction for the respective functions.\n\nThis time, an example of using these functions of the portable terminal of the embodiment in the suitable directions of the main unit 10 and the flip unit 20 for the respective functions will be described in detail with reference to the drawings.\n\nFIGS. 4 to 8 are views showing the state of folding the portable terminal of the embodiment when it is not used.\n\nWhen it is not used, the main unit 10 and the flip unit 20 are folded around the opening/shutting axis 31 as illustrated in FIGS. 4 to 8. The touch panel monitor 21 of the flip unit 20 and the operation key 17 of the main unit 10 are thus closed inwardly, with no contact with the outside, thereby preventing damage to the touch panel monitor 21 and a malfunction of the operation key 17, with excellent portability.\n\nIn the case of using it as a TV telephone, the main unit 10 and the flip unit 20 are opened to a position of turning them to an L-shape around the opening/shutting axis 31, and then, the flip unit 20 is turned across at 90° in the horizontal direction, as illustrated in FIGS. 1, 2 and 3.\n\nA phone call is made by using the operation key 17 in the same way as the ordinal portable telephone. Conversation is made through the speaker phone 24. It is also possible to use the portable terminal by connecting a microphone or a headphone to the sound input/output terminal 12-1.\n\nIt is possible to operate the operation button 22 at use so to variously switch a screen to be displayed on the touch panel monitor 21. The screen on the touch panel monitor 21 can show not only an image of a communication party transmitted through the communication of the TV telephone, but also an image of a user's own face taken by the second photographic lens 23 that is transmitted from the user's side to the communication party or an image of scene and substance around the user that is taken by the first photographic lens 33. Further a form of displaying the above images at once is possible.\n\nMore specifically, three kinds of images; a communication party's image, a user's image and an image before the user' eyes may be switched variously, or combined. \n\nAs a form of displaying them, there may be considered a first form of displaying one of these images on the whole screen of the touch panel monitor 21, a second form of displaying two of them on each half screen of the touch panel monitor 21, a third form of displaying these three images on each one-third screen of the touch panel monitor 21, and a fourth form of displaying one of them on the whole screen of the touch panel monitor 21 and further displaying the other (one or two of them) small with it overlapped on the screen as a child screen.\n\nIn the fourth displaying form, the display position of the child screen may be decided in advance, or the display position and the size may be specified by the input pen 40 on the touch panel monitor 21 and after display, it can be changed to any desired position and size, or by the operation of the operation button 22, a desired one may be selected and displayed from the predetermined setting of a plurality of display positions.\n\nSimilarly to the selection of an image to be displayed on the touch panel monitor 21, an image to transmit to a communication party can be also selected variously by the operation of the above operation button 22.\n\nAlthough the TV telephone generally transmits a user's own face taken by the second photographic lens 23 to a communication party, the portable terminal of the present invention can switch the image to transmit to an image of the scene or substance before the user's eyes taken by the first photographic lens 33, or transmit the combined image, associated with or independently of the selection of the image to be displayed on the touch panel monitor 21.\n\nAs mentioned above, since it is possible to transmit an image including the scene before a user's eyes as well as the user's face while switching the image at ease, the function of the TV telephone according to the portable terminal of the embodiment is very convenient for transmission of the scene at a visiting place or the like and it is to make the best use of the portability of a portable terminal. \n\nIn the above-mentioned form, although the image of the scene before a user's eyes is transmitted, a form of transmitting only the user's face is possible. In this case, the main unit 10 and the flip unit 20 are only opened to a position of becoming a shape of L around the opening/shutting axis 31, with no need to rotate across the flip unit 20 at 90° in the horizontal direction.\n\nNext, in the case of using it as a digital video camera, it is preferable to use the main unit 10 and the flip unit 20 in the same direction as in the case of the above-mentioned TV telephone as shown in FIGS. 1 to 3.\n\nA user sets the moving image/static image switch 16 shown in FIG. 9 for the moving image, thereby deciding on the moving image as for the kind of the image to be taken by the first photographic lens 33. The size of the image to be taken is adjusted by using the zoom button 11 with reference to the touch panel monitor 21. Press of the button 13 for taking an image starts taking and the moving image taken by the first photographic lens 33 is converted into electronic data and stored in the storing unit 53.\n\nThe storing unit 53 stores the electronic data of the image into a built-in semiconductor memory, which can be read out and reproduced on the touch panel monitor 21 at any time. When the stored data is transmitted to an outside information processing terminal of a personal computer, the dummy plug for data input/output terminal 12-3 is extracted from the data input/output terminal 12-2 shown in FIG. 1 and instead of it, a connection cable is inserted therein. The other end of the connection cable is connected to the information processing terminal, thereby enabling data input/output.\n\nAlso it is possible to take an image in the state of fixing the portable terminal to a tripod by use of a 20 tripod fixing hole 15.\n\nSimilarly, in the case of using it as a digital still camera, it is preferable to use the main unit 10 and the flip unit 20 in the same direction as in the above-mentioned TV telephone as shown in FIGS. 1 to 3.\n\nA user sets the moving image/static image switch 16 shown in FIG. 9 for the static image, thereby deciding on the static image as for the kind of the image to be taken by the first photographic lens 33. The size of the image to be taken is adjusted by using the zoom button 11 with reference to the touch panel monitor 21. Press of the button 13 for taking an image starts taking and the static image taken by the first photographic lens 33 is converted into electronic data and stored in the storing unit 53.\n\nIn this case, the button 13 for taking an image takes a role of a shutter and by using this button an image is taken. Thus taken image is stored in the storing unit 53 and it can be read out and reproduced any time.\n\nAlso it is possible to take an image in the state of fixing the portable terminal to a tripod by use of a 15 tripod fixing hole 15.\n\nIn the case of using it as a pen input terminal, it is used in the state of closing the main unit 10 and the flip unit 20, making the inside surface of the main unit 10 into contact with the outside surface of the flip unit 20 as illustrated in FIG. 11. From the ordinary close state as shown in FIG. 10, once opening the main unit 10 and the flip unit 20 to any position around the opening/shutting axis 31, only the flip unit 20 is rotated across around the rotation axis 32 at 180° in the horizontal direction and the flip unit 20 is again combined with the main unit 10 around the opening/shutting axis 31, to be shown in the state of FIG. 11.\n\nThus, it becomes possible to input various data and instructions with the input pen 40 on the touch panel monitor 21 of the flip unit 20 as illustrated in FIG. 12. Since the portable terminal is closed small with the touch panel monitor 21 fixed outward, it is possible to support the portable terminal by the main unit 10 by hands so as not to wobble the touch panel monitor 21 at the input time with the input pen 40.\n\nAlternatively, it may be used in the state of closing the both, making the outside surface of the main unit 10 into contact with the outside surface of the flip unit 20. The main unit 10 and the flip unit 20 are opened around the opening/shutting axis 31 at 360° from the state as shown in FIG. 10, and then the outside of the main unit 10 is combined with the outside of the flip unit 20.\n\nIn the case of using it as the ordinary portable telephone, the main unit 10 and the flip unit 20 are opened around the opening/shutting axis 31 to any position as illustrated in FIG. 9, thereby enabling the communication. A telephone number is input with the operation key 17 in the same way as in the case of the TV telephone, a voice is supplied through the microphone 18 and the received voice is reproduced by the speaker 24.\n\nAs mentioned above, the portable terminal of the embodiment can realize a lot of functions of a telephone, a TV telephone, a digital camera, a digital video camera, a pen input terminal and the like, in compact. \n\nThis time, a portable terminal according to a second embodiment of the present invention will be described. \n\nIn the second embodiment, activation of various functions provided in the portable terminal of the present invention is controlled depending on the relative direction of the main unit 10 and the flip unit 20.\n\nWhen the relative direction of the main unit 10 and the flip unit 20 suitable for each function described in the first embodiment is detected by the axial unit state sensor 55, the corresponding function is activated or it is ready for activation.\n\nFIG. 14 is a flow chart for use in describing the control of the portable terminal of this embodiment.\n\nWith reference to FIG. 14, the axial unit state \n * 20 sensor 55 detects the respective angles of the opening/shutting axis 31 and the rotation axis 32 of the axial unit 30 in order to recognize the relative direction of the main unit 10 and the flip unit 20 (Step 1401).\n\nWhen the opening/shutting axis 31 is closed (Step 1402) and the rotation axis 32 has no rotation (namely, the flip unit 20 is directed to the front direction) (Step 1403), the axial unit state sensor 55 detects that the main unit 10 and the flip unit 20 are inwardly closed in an unused state at present (Step 1404). Because of the unused state, the processing of automatically cutting off the power supply is performed if necessary.\n\nWhen the opening/shutting axis 31 is closed (Step 1402) and the direction of the rotation axis 32 is rotated at 180° (namely, the flip unit is directed to the inverse direction) (Step 1403), the axial unit state sensor 55 detects that the both units are closed by making the inside of the main unit 10 face to face with the outside of the flip unit 20 in a state of using a function of pen input terminal (Step 1405).\n\nWhen the opening/shutting axis 31 is opened (Step 1402), the angle of the opening/shutting axis 31 is in the range of 90° to 180°, and the rotation axis 32 has no rotation (Step 1406), the sensor 55 detects that it is the case of using a telephone function (Step 1407).\n\nWhen the opening/shutting axis 31 is opened (Step 1402), the angle of the opening/shutting axis 31 is 90°, the rotation axis 32 is rotated at 90°, and the first photographic lens 33 and the second photographic lens 23 are directed in the inverse direction (Step 1408), it detects that it is the case of using one of the functions of a TV telephone, a digital video camera and a digital still camera (Step 1409). Which function is to be executed can be decided by a user's operation specifying it or a predetermined initial setting.\n\nWhen it is in none of the above cases (Step 1408), this step is returned to Step 1401, where the sensor 55 waits for the relative direction of the main unit 10 and the flip unit 20 to become the direction corresponding to one of the functions.\n\nWhen the current function to be used is recognized in Steps 1405, 1407, 1409 and the like, the corresponding function is activated or it is ready for activation if necessary in the case where the corresponding function is not yet activated. When the other function is under activation, the recognized function is activated, the function under activation is finished, and the switching processing for activating the newly recognized function can be performed.\n\nIn addition to the effect of the first embodiment, the portable terminal of this embodiment as mentioned above can perform automatic activation of each function provided in the portable terminal, in accordance with the relative direction of the main unit 10 and the flip unit 20, thereby activating or switching various functions at ease.\n\nA portable terminal of a third embodiment of the 25 present invention will be described. \n\nThe portable terminal of the third embodiment of the present invention is different from the first embodiment and the second embodiment in that a second speaker 25 is provided on the opposite side of the speaker phone 24 in the flip unit 20 as illustrated in FIGS. 15 and 16. Accordingly, in the case of using it as a portable telephone, it can be used with the outside of the flip unit facing to the inside of the main unit, by turning the flip unit 20 around the rotation axis 32 at 180°. In this case, a user's cheek doesn't come into contact with the touch panel monitor 21 when using it as the ordinal portable telephone, thereby enabling conversation without dirtying the surface of the monitor.\n\nA combination of the second embodiment and the third embodiment is enabled by replacing Step 1406 with the phrase the angle of the opening/shutting axis is in the range of 90° to 180° and the rotation axis is inversely rotated at 180°.\n\nThe other embodiment of the present invention will be described this time. \n\nA portable terminal provided with some of the \n\n20 functions or less than the functions; a telephone, a TV telephone, a digital camera, a digital video camera and a pen input terminal, as described in the above embodiments, is possible, other than the portable terminal provided with all the above-mentioned functions. \n\nFurther, a portable terminal further provided with a receiving function of radio waves or TV waves, a beeper function, a navigation system such as a car navigation and the like is also possible. Also in the case of providing with these functions, a lot of units and functions can be used in common, thereby adding the functions efficiently. \n\nThe storing unit 53 may be realized by a drive for storing data into a semiconductor memory or a magnetic memory that is a removable storing medium, instead of the form of using a built-in semiconductor memory as described in the above embodiments.\n\nIn the case of using the built-in semiconductor memory in the storing unit 53, it is possible to perform data exchange to the outward information terminal by the infrared communication, other than the form of using the data input/output terminal 12-2 and the connection cable.\n\nAs set forth hereinabove, the present invention has the following excellent effects. \n\nAs a first effect, in the case of using the portable terminal as a TV telephone, it is possible to transmit a user's own face and the scene of the user's view to a communication party at ease and at once. This is because the portable terminal of the present invention is provided with two photographic lenses and a switch, thereby to transmit the images at an easy operation. \n\nAs a second effect, it is possible to provide a portable terminal capable of various operations of a moving image, a static image, a character mail, a portable telephone and the like. This is because it is provided with two rotation axes capable of setting any angle, thereby to cope with various uses. \n\nAs a third effect, it is possible to transfer the taken image to an information processor such as a personal computer at ease or to transfer the image from the personal computer to the side of a portable terminal. This is because it is provided with a data input/output interface, thereby enabling connection to the other device at ease without passing through the storing medium such as a memory card. \n\nAlthough the invention has been illustrated and described with respect to exemplary embodiment thereof, it should be understood by those skilled in the art that the foregoing and various other changes, omissions and additions may be made therein and thereto, without departing from the spirit and scope of the present invention. Therefore, the present invention should not be understood as limited to the specific embodiment set out above but to include all possible embodiments which can be embodies within a scope encompassed and equivalents thereof with respect to the feature set out in the appended claims. \n\nBACKGROUND OF THE INVENTION \n\n1. Field of the Invention \n\nThe present invention relates to a portable terminal, and more particularly to a small-sized portable terminal for compactly realizing various functions of a telephone, a TV telephone, a digital camera, a digital video camera, a pen input terminal and the like. \n\n2. Description of the Related Art \n\nA portable terminal is a small-sized device having a processing function of communication, image and information, convenient to carry and excellent in portability. \n\nAs the conventional portable terminal widely used in the public, there are communication terminals and information terminals of, for example, a portable telephone, a PHS, a TV telephone, a digital camera, a digital video camera, and a pen input system. \n\nRecently, a portable terminal provided with some of these functions has made an appearance. In this method, since some functions are provided in one device, it is not necessary to carry several kinds of portable terminals and the portability that is the aim of a portable terminal is improved. \n\nFurther, since many units and functions are \n\ncommonly required in a plurality of portable terminals, when a plurality of functions are provided in one terminal, the common units can be shared and the terminal can be provided with a plurality of functions without losing the characteristic of a light and small portable terminal. \n\nThus, if a portable terminal provided with a plurality of functions is compared with the method of having individual portable terminals of various functions, it is effective in decreasing the power consumption with superiority in the maintenance and portability, and further decreasing the manufacturing cost and the purchase price since the common unit can be shared. \n\nAs an example of the conventional portable terminal with a plurality of functions, there is a technique disclosed in Japanese Patent Publication Laid-Open (Kokai) No. Heisei 06-292195, where a portable terminal, provided with a liquid crystal monitor, a CCD camera, a speaker and a communication function, for realizing functions of a portable telephone and a portable TV telephone is proposed. \n\nA portable TV telephone by the conventional portable terminal including a portable terminal of the Japanese Patent Publication Laid-Open (Kokai) No. Heisei 06-292195 generally adopts a form of setting a CCD camera adjacent to a liquid crystal monitor on the same surface of the liquid crystal monitor of the portable terminal. \n\nThus, while a user watches a received image displayed on the liquid crystal monitor, the CCD camera set adjacent to the liquid crystal monitor can take an image of the own face to send the same image to a communication party, thereby realizing a function of a portable TV telephone. \n\nFurther, a lot of the conventional portable terminals, including the portable terminal of the Japanese Patent Publication Laid-Open (Kokai) No. Heisei 06-292195, adopt a method of providing with a flip unit of the same area as (or a little less than) that of the main unit itself of the portable terminal and connecting both the flip unit and the main unit by a movable axial unit in a way of opening and shutting like a shell. In this case, since the main unit of the portable terminal is supported by hand, generally operation buttons are mainly provided on the main unit and a liquid crystal monitor is provided on the flip unit. \n\nIn this form, when the flip unit and the main unit are closed, there is a space in no contact with the outward, inside both the units, where the liquid crystal monitor and various operation buttons can be disposed. \n\nTherefore, by closing it in compact at a time of no use, it is possible to prevent damage to the liquid crystal monitor and a malfunction of the operation buttons, thereby realizing excellent portability. \n\nThe conventional portable terminal as mentioned above has the following problems. \n\nFirst, though there are a lot of advantages in adopting the method of providing one portable terminal with a plurality of functions such as a telephone, a TV telephone, a digital camera, a digital video camera, a pen input terminal and the like, the conventional portable terminal can combine only two or three functions. Especially, it is impossible to realize a portable terminal capable of combining all the abovementioned functions. \n\nThis is because if a plurality of functions are provided within one small and light portable terminal, the circuitry and structure of a device becomes too complicated and the operational performance is too deteriorated to solve faults. \n\nSecond, though a use of sending various images such as scenes and substances from a visiting place is required as a function of a portable TV telephone, making good use of the portability of the portable terminal, a portable TV telephone by the conventional portable terminal is very inconvenient for picking up an image other than a user's own face. \n\nThis is because only one CCD camera is provided adjacent to a liquid crystal monitor on the same surface of the liquid crystal monitor of the main unit in the conventional portable terminal. In order to pick up an image other than a user's own face such as a scene nearby, it is necessary to change the direction of a photographic lens. \n\nIf the direction is changed, a user cannot see the display on the liquid crystal monitor. Since the focus of the above-mentioned CCD camera is set at a position near the lens suitable for picking up a face image, in order to pick up a scene nearby, a liquid monitor is necessarily referred to, so as to adjust the focus of the lens. \n\nThird, in the above-mentioned conventional portable terminal where a flip unit is connected to a main unit in a movable way, the main unit and the flip unit are desired to be directed toward the suitable direction for executing various functions, in executing various functions of the portable terminal such as a telephone, a TV telephone, a digital camera, a digital video camera, a pen input terminal and the like. The conventional portable terminal, however, can operate only in a way of opening and closing the flip unit and the main unit, and it cannot be adjusted in the other directions flexibly. \n\nSUMMARY OF THE INVENTION \n\nIn order to solve the above conventional problems, a first object of the present invention is to provide a portable terminal having a portable TV telephone, a digital video camera, and a digital still camera, without damaging the portability. Further, it is to provide a portable terminal provided with a touch panel capable of writing with a pen, and provided with full functions as for the data communication as well as the TV telephone. \n\nIn order to solve the above conventional problems, a second object of the present invention is to provide a portable terminal provided with a function of a portable TV telephone capable of easily sending an image such as a scene nearby seen from the side of a user, to a communication party. \n\nIn order to solve the above conventional problems, a third object of the present invention is to provide a portable terminal capable of changing the direction of main unit and the flip unit to the suitable direction for executing the respective functions flexibly. \n\nAccording to one aspect of the invention, a portable terminal formed by connecting... | Lenovo Innovations Limited (Hong Kong),Quarry Bay,HK | Shibata Junichiro,Tokyo,JP | Yamaguchi Shuuji,Tokyo,JP | Lenovo Innovations Limited (Hong Kong) | Shibata Junichiro | Yamaguchi Shuuji | LENOVO INNOVATIONS LTD HONG KONG | LENOVO GROUP LTD | Shibata, Junichiro | Yamaguchi, Shuuji | 2 | Sughrue Mion, PLLC | NaN | Ho, Tuan | US | Dead | 12 | 2014 | US | 10 | 2011 | 1999-12-14 | 1999 | G06, H04 | H04 | 34833306 | 348375 | US5719799A | US5359362A | US6697117B1 | US8400531B2 | US5936610A | US6510325B1 | US6750848B1 | US5982429A | US6069648A | US7046287B2 | US5675358A | JP6292195A | JP8022343A | JP11069214A | 14 | NaN | 0 | US10015898B2 | US10127806B2 | US10157538B2 | US10237996B2 | US9978265B2 | 5 | 2019-02-26 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - 2018-12-30 | 2019-02-04 STCH INFORMATION ON STATUS: PATENT DISCONTINUATION - PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362 | 2019-02-04 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | 2018-08-13 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | 2014-09-11 AS ASSIGNMENT LENOVO INNOVATIONS LIMITED (HONG KONG), HONG KONG ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:NEC CORPORATION;REEL/FRAME:033720/0767 2014-06-18 | US8922696B2 | JP03546784B2 | JP2001169166A | JP2004007553A | JP2004007554A | US20010004269A1 | US20060187334A1 | US20100085463A1 | US20120033029A1 | US7084919B2 | US7492407B2 | US8068161B2 | 20010621US20010004269A1 |
| 6 | US8921169B2 | Semiconductor device and fabrication method thereof | JP200191275A | US2002105282A | US2007743189A | US2010849866A | US13104140A | US13531149A | 2001-03-27 | 2002-03-26 | 2007-05-02 | 2010-08-04 | 2011-05-10 | 2012-06-22 | US13890293A | 2013-05-09 | B2 | 2014-12-30 | Yamazaki Shunpei|Tokyo, JP | Suzawa Hideomi|Kanagawa, JP | Ono Koji|Kanagawa, JP | Kusuyama Yoshihiro|Kanagawa, JP | Semiconductor Energy Laboratory Co. Ltd.,Atsugi-shi, Kanagawa-ken,JP | Semiconductor Energy Laboratory Co. Ltd.,Atsugi,JP | SEMICONDUCTOR ENERGY LABORATORY CO. LTD. | L03 C | U11 E | W01 E | W04 E | L03-G05A | L03-H03A | L04-C06A | L04-C06B | L04-C07 | L04-C12 | U11-C05B4 | U11-C05B9 | U11-C07C2 | U11-C07D1 | W01-C01B3E | W01-C01D3C | W04-M01B1 | W04-M01D3 | H01L002184 | H01L002943 | H01L002120 | H01L0021265 | H01L0021336 | H01L002177 | H01L00218234 | H01L0027088 | H01L002712 | H01L0029423 | H01L002949 | H01L002966 | H01L0029786 | H01L00271296 | H01L002126513 | H01L0021266 | H01L002132136 | H01L002132139 | H01L002712 | H01L00271214 | H01L0027124 | H01L0027127 | H01L00271288 | H01L002942384 | H01L00294908 | H01L002966757 | H01L002978621 | H01L002978627 | H01L20297863 | 438164 | 257013 | 257014 | 257015 | 257E33008 | 438029 | 438632 | NaN | For forming a gate electrode, a conductive film with low resistance including Al or a material containing Al as its main component and a conductive film with low contact resistance for preventing diffusion of Al into a semiconductor layer are laminated, and the gate electrode is fabricated by using an apparatus which is capable of performing etching treatment at high speed. | Semiconductor device and fabrication method thereof | What is claimed is: \n1. A method for manufacturing an active matrix display device, comprising steps of: \nforming a semiconductor layer over a glass substrate; \nforming a first insulating film over the semiconductor layer; \nforming a conductive layer on and in contact with the first insulating film; \nforming a resist over the conductive layer, the resist having a first width; \netching the conductive layer by using the resist so as to form a wiring; \nadding an element selected from an n-type impurity element and a p-type impurity element into the semiconductor layer at a first concentration rate with the wiring and the resist thereover as a first mask; \netching both the wiring and the resist so that the resist has a second width, the second width being smaller than the first width; and \nadding the element into the semiconductor layer at a second concentration rate with the wiring and the resist thereover having the second width as a second mask, the second concentration rate being smaller than the first concentration rate. \n2. The method for manufacturing an active matrix display device according to claim 1, wherein the active matrix display device is a liquid crystal display device.\n3. The method for manufacturing an active matrix display device according to claim 1, wherein the semiconductor layer is an island shape.\n4. The method for manufacturing an active matrix display device according to claim 1, wherein the wiring is a gate electrode.\n5. The method for manufacturing an active matrix display device according to claim 1, further comprising a step of activating the element added into the semiconductor layer after adding the element.\n6. The method for manufacturing an active matrix display device according to claim 1, wherein the wiring has a tapered portion with a taper angle of 15° to 45°.\n7. The method for manufacturing an active matrix display device according to claim 1, wherein the conductive layer comprises a first metal layer, a second metal layer and a third metal layer.\n8. A method for manufacturing an active matrix display device, comprising steps of: \nforming a semiconductor layer over a glass substrate; \nforming a first insulating film over the semiconductor layer; \nforming a conductive layer on and in contact with the first insulating film; \netching the conductive layer so as to form a wiring consisting of one or more conductive materials, the wiring having a first width; \nadding an element selected from an n-type impurity element and a p-type impurity element into the semiconductor layer at a first concentration rate with the wiring as a first mask; \netching a side portion of the wiring so that the wiring has a second width, the second width being smaller than the first width; and \nadding the element into the semiconductor layer at a second concentration rate with the wiring having the second width as a second mask, the second concentration rate being smaller than the first concentration rate. \n9. The method for manufacturing an active matrix display device according to claim 8, wherein the active matrix display device is a liquid crystal display.\n10. The method for manufacturing an active matrix display device according to claim 8, wherein the semiconductor layer is an island shape.\n11. The method for manufacturing an active matrix display device according to claim 8, wherein the wiring is a gate electrode.\n12. The method for manufacturing an active matrix display device according to claim 8, further comprising a step of activating the element added into the semiconductor layer after adding the element.\n13. The method for manufacturing an active matrix display device according to claim 8, wherein the wiring has a tapered portion with a taper angle of 15° to 45°.\n14. The method for manufacturing an active matrix display device according to claim 8, wherein the conductive layer comprises a first metal layer, a second metal layer and a third metal layer.\n15. A method for manufacturing an active matrix display device, comprising steps of: \nforming a semiconductor layer over a glass substrate; \nforming a first insulating film over the semiconductor layer; \nforming a resist over the first insulating film, the resist having a first width; \nadding an element selected from an n-type impurity element and a p-type impurity element into the semiconductor layer at a first concentration rate with the resist as a first mask; \netching a conductive layer so as to form a wiring after the addition of the element, the wiring having a second width and the second width being smaller than the first width; and \nadding the element into the semiconductor layer at a second concentration rate with the wiring as a second mask, the second concentration rate being smaller than the first concentration rate. \n16. The method for manufacturing an active matrix display device according to claim 15, wherein the active matrix display device is a liquid crystal display device.\n17. The method for manufacturing an active matrix display device according to claim 15, wherein the semiconductor layer is an island shape.\n18. The method for manufacturing an active matrix display device according to claim 15, wherein the wiring is a gate electrode.\n19. The method for manufacturing an active matrix display device according to claim 15, further comprising a step of activating the element added into the semiconductor layer after adding the element.\n20. The method for manufacturing an active matrix display device according to claim 15, wherein the wiring has a tapered portion with a taper angle of 15° to 45°. | 20 | 1. A method for manufacturing an active matrix display device, comprising steps of: \nforming a semiconductor layer over a glass substrate; \nforming a first insulating film over the semiconductor layer; \nforming a conductive layer on and in contact with the first insulating film; \nforming a resist over the conductive layer, the resist having a first width; \netching the conductive layer by using the resist so as to form a wiring; \nadding an element selected from an n-type impurity element and a p-type impurity element into the semiconductor layer at a first concentration rate with the wiring and the resist thereover as a first mask; \netching both the wiring and the resist so that the resist has a second width, the second width being smaller than the first width; and \nadding the element into the semiconductor layer at a second concentration rate with the wiring and the resist thereover having the second width as a second mask, the second concentration rate being smaller than the first concentration rate. | 1. A method for manufacturing an active matrix display device, comprising steps of: forming a semiconductor layer over a glass substrate; forming a first insulating film over the semiconductor layer; forming a conductive layer on and in contact with the first insulating film; forming a resist over the conductive layer, the resist having a first width; etching the conductive layer by using the resist so as to form a wiring; adding an element selected from an n-type impurity element and a p-type impurity element into the semiconductor layer at a first concentration rate with the wiring and the resist thereover as a first mask; etching both the wiring and the resist so that the resist has a second width, the second width being smaller than the first width; and adding the element into the semiconductor layer at a second concentration rate with the wiring and the resist thereover having the second width as a second mask, the second concentration rate being smaller than the first concentration rate. | 8. A method for manufacturing an active matrix display device, comprising steps of: forming a semiconductor layer over a glass substrate; forming a first insulating film over the semiconductor layer; forming a conductive layer on and in contact with the first insulating film; etching the conductive layer so as to form a wiring consisting of one or more conductive materials, the wiring having a first width; adding an element selected from an n-type impurity element and a p-type impurity element into the semiconductor layer at a first concentration rate with the wiring as a first mask; etching a side portion of the wiring so that the wiring has a second width, the second width being smaller than the first width; and adding the element into the semiconductor layer at a second concentration rate with the wiring having the second width as a second mask, the second concentration rate being smaller than the first concentration rate. | 15. A method for manufacturing an active matrix display device, comprising steps of: forming a semiconductor layer over a glass substrate; forming a first insulating film over the semiconductor layer; forming a resist over the first insulating film, the resist having a first width; adding an element selected from an n-type impurity element and a p-type impurity element into the semiconductor layer at a first concentration rate with the resist as a first mask; etching a conductive layer so as to form a wiring after the addition of the element, the wiring having a second width and the second width being smaller than the first width; and adding the element into the semiconductor layer at a second concentration rate with the wiring as a second mask, the second concentration rate being smaller than the first concentration rate. | CROSS-REFERENCE TO RELATED APPLICATIONS \n\nThis application is a continuation of U.S. application Ser. No. 13/531,149, filed Jun. 22, 2012, now allowed, which is a continuation of U.S. application Ser. No. 13/104,140, filed May 10, 2011, now U.S. Pat. No. 8,207,536, which is a divisional of U.S. application Ser. No. 12/849,866, filed Aug. 4, 2010, now U.S. Pat. No. 7,952,152, which is a continuation of U.S. application Ser. No. 11/743,189, filed May 2, 2007, now U.S. Pat. No. 7,804,142, which is a divisional of U.S. application Ser. No. 10/105,282, filed Mar. 26, 2002, now U.S. Pat. No. 7,238,600, which claims the benefit of a foreign priority application filed in Japan as Serial No. 2001-091275 on Mar. 27, 2001, all of which are incorporated by reference. \n\nBRIEF DESCRIPTION OF THE DRAWINGS \n\nFIGS. 1A-1D are diagrams showing one preferred embodiment of the invention;\n\nFIG. 2 is an SEM photograph showing an observation result of a laminated conductive film as etched:\n\nFIGS. 3A-3E are diagrams showing one example for reduction to practice of the invention;\n\nFIGS. 4A-4E are diagrams showing one example for implementation of this invention;\n\nFIGS. 5A-5D are diagrams showing one example for implementation of this invention;\n\nFIGS. 6A-6D are diagrams showing one example for implementation of this invention;\n\nFIGS. 7A-7D are diagrams showing one example for implementation of this invention;\n\nFIGS. 8A-8D are diagrams showing one example for implementation of this invention;\n\nFIGS. 9A-9E are diagrams showing one example for implementation of this invention;\n\nFIGS. 10A-10D are diagrams showing one example for implementation of this invention;\n\nFIGS. 11A and 11B are diagrams showing one example for implementation of this invention;\n\nFIGS. 12A-12F are diagrams showing examples of electrical equipment;\n\nFIGS. 13A-13D are diagrams showing examples of electrical equipment; and\n\nFIGS. 14A-14C are diagrams showing examples of electrical equipment.\n\nBACKGROUND OF THE INVENTION \n\n1. Field of the Invention \n\nThe present invention relates to semiconductor devices including a drive circuit as formed using a semiconductor element with a semiconductor film as an active layer (a semiconductor layer including a channel formation region, a source region and a drain region) and also to a manufacturing method of the same. Note that typical examples of the semiconductor element are transistors including, although not limited to, field effect transistors such as metal oxide semiconductor (MOS) transistors and thin-film transistors (TFTs). In addition, the present invention relates in particular to large size display devices (more than 20 inches) wherein resistance of wiring lead becomes a problem in supplying signal, and also to a fabrication method thereof. \n\n2. Description of the Related Art \n\nTo realize reduction in weight and power consumption of portable information equipment such as a mobile telephone and a notebook PC, small-size or middle-size liquid crystal display devices have generally been used as display units thereof due to merits of such liquid crystal display devices. \n\nFurther, it is becoming a more active trend to enlarge the market of the liquid crystal display device up to a television (TV) and also to design a TV at home by using the liquid crystal display device in place of a traditional cathode ray tube (CRT). However, it is necessary to simultaneously satisfy higher fidelity and higher brightness in addition to the enlargement to realize a liquid crystal TV. \n\nFurther, with an increase in size of a display device, the number and length of wirings and resistivities of the wirings increase accordingly. An increase in wiring resistance would cause a delay in transmitting signals toward lead terminate ends to in turn badly affect the resultant displays. Therefore, a technique for reducing the wiring resistance becomes inevitable in order to widely spread the liquid crystal display devices to ordinary homes. \n\nSo far, as the technique for reducing wiring resistance, a method of widening line widths of the wirings and increasing the film thickness of the wirings have been considered, and actually, it has been realized to reducing the wiring resistance. However, the former is encountered with an enlargement of element areas in a pixel portion due to widening of the lead widths to result in decreasing an aperture ratio and to make it impossible to obtain higher brightness required. Alternatively, with the latter method, the increase in film thickness of wirings results in an increase in difference between a layer formed under the wirings and a layer formed on the wirings to cause production yields to decrease due to problems such as disconnection as a result of reduction of coating properties in fabricating insulating films and metal films for electrodes. \n\nAdditionally, although there is a method of using aluminum (Al) or copper (Cu) as materials with low resistance for wirings, which suffer from defects of less corrosion resistivity and less thermal resistivity. It occurs as problems that projections such as hillocks and whiskers or the like are formed by thermal treatment, and that aluminum atoms behave to diffuse into a channel formation region to result in operation defects of TFTs or degradation in TFT characteristics. In this way, while it is not easy to form a suitable gate electrode of a TFT by using the above-noted metal materials, no materials are less in resistance than aluminum (Al) or copper (Cu). The above serves as a problem against producing a liquid crystal display device with a large screen. \n\nIn this way, the above-stated problem becomes more appreciable with increasing performance required for a semiconductor device which has a plurality of integrated circuits such as an active matrix type liquid crystal display devices. \n\nSUMMARY OF THE INVENTION \n\nThe present invention is performed in view of the problem stated above, and the object is to provide, in a semiconductor device typically represented by an active-matrix type liquid crystal display device which has a circuit using semiconductor elements, a technique for realizing low resistivity of wirings required for enlargement and higher precision without increasing the number of steps in the manufacturing process, and further provide a method for fabricating a semiconductor device at low temperatures (temperatures lower than or equal to the distortion point of a glass substrate) to use glass substrates with a low cost. \n\nThe invention has the following structure. A conductive film containing W as its main component is used for a first layer to form a gate electrode in order to prevent aluminum of the gate electrode from transpiring and diffusing into a channel formation region with a film which contains Al as its main component and is low in resistance as a second layer and a film which contains Ti as its main component, to fabricate the gate electrode with a laminate structure of the above materials by using an apparatus which is capable of performing etching treatment at high speeds. \n\nAdditionally it is required that a TFT disposed in each of a variety of types of circuits be fabricated as a TFT in accordance with the function of the circuit. For example, it is desirable that the TFT provided in a driver circuit required to achieve high-speed operations be designed to have a specific structure with great emphasis on an increase in operation speed and at the same time on suppression of any possible degradation as an appreciable problem due to hot carrier injection. It is known as such structure that an LDD region as provided between a channel formation region and a drain region has a concentration in order that the concentration of an impurity element gradually gets higher toward the drain region. With the structure, the effect of relaxing electric field becomes more remarkable in a depletion layer adjacent to the drain region. \n\nIn order to form the LDD region with the above-noted concentration gradient of the impurity element, the present invention use a method of accelerating by electric fields an ionized impurity element for giving one conductivity type to pass through a gate insulating film and then add into a semiconductor layer. In addition, with the present invention, a gate electrode with a tapered shape is formed to have a thickness gradually increasing from an end portion toward inside by etching, and it is considered that the impurity element is somewhat added to the semiconductor layer through the tapered shape. In the present invention, the LDD region is formed in order that the concentration of the impurity element changes in a direction along the channel length of a TFT, without increasing the number of steps (without increasing the number of masks). \n\nDESCRIPTION OF THE PREFERRED EMBODIMENTS \n\nIn the embodiment mode, it is described that a method of fabricating a display device that is adaptable for the enlargement and high image quality by using materials with low resistance without increasing the number of steps, with reference to FIGS. 1 and 2.\n\nA base insulating film 1002 and a semiconductor layer 1003 are formed on a substrate 1001, and a gate insulating film 1004 with a film thickness of 40 to 150 nm is formed by plasma CYD method, sputtering method or low-pressure CYD method or the like. Then, On the gate insulating film 1004 a three-layered conductive film formed of a first conductive film 1005, a second conductive film 1006, and a third conductive film 1007 is formed. Thus, a mask 1008 is formed (FIG. 1A).\n\nThe present invention employs, as a conductive film for a gate electrode, a laminate structure of a conductive film with low resistance such as AI, Cu, or one of a chemical compound material and alloy material containing an element selected from the group consisting of Al and Cu as its main component: a conductive film with excellent heat resistance such as W, Mo, Ta, or one of a chemical compound material and alloy material containing an element selected from the group consisting of W, Mo, and Ta as its main component; and a conductive film with low contact resistance such Ti, or one of a chemical compound material and alloy material containing Ti as its main component. The laminate structure of these conductive films are etched repeatedly to thereby form a gate electrode without increasing the number of masks and further to form an impurity region in a semiconductor layer to obtain a TFT with the required performance. \n\nIn etching the conductive films, the etching rate of the conductive film to be processed, the selective ratio of an insulating film for a base film to the conductive film, and so forth should be considered. If the selective ratio is small, processing becomes difficult to make it difficult to form a TFT with a desired shape becoming. \n\nThen, in order to obtain the optimal processing method the experiment of etching conditions was performed after preparing a sample that a sequential laminated structure on a quartz substrate of an insulating film of the same material as a gate insulating film, a tungsten film with a film thickness of 50 nm, an alloy film of aluminum and titanium (AlTi) with a film thickness of 500 nm, and a titanium film with a film thickness of 30 nm in the Embodiment Mode. Suppose that the tungsten film is the first conductive film 1005, the alloy film of aluminum and titanium (AlTi) is the second conductive film 1006, and the titanium film is the third conductive film 1007, for the purpose of convenience.\n\nFirst. BCl 3, Cl2 and O2 are used as etching gas and a gas flow rate ratio thereof is set at 65/10/5 sccm, and RF (13.56 MHz) electrical power of 450 W is supplied to a coiled electrode at a pressure of 1.2 Pa to thereby produce a plasma and to perform etching. RF (13.56 MHz) electric power of 300 W is supplied also to the substrate side (sample stage) to apply a substantially negative self-bias voltage for the etching. Subsequently, CF4, Cl2 and O2 are used as etching gas and a gas flow rate ratio thereof is set at 25/25/10 sccm, and RF (13.56 MHz) electrical power of 500 W is supplied to a coiled electrode at a pressure of 1.0 Pa to thereby produce a plasma and to perform etching. RF (13.56 MHz) electric power of 20 W is supplied also to the substrate side (sample stage) to apply a substantially negative self-bias voltage for the etching. A photograph observed by SEM immediately after having done the etching under the above conditions is FIG. 2. With this etching treatment, a first electrode 1009a, a second electrode 1009b and a third electrode 1009c are formed from the first conductive film, the second conductive film and the third conductive film. The laminated conductive film shown in FIG. 2 is regarded as a gate electrode 1009 with the first shape, which consists of the first electrode 1009a, second electrode 1009b and third electrode 1009c. \n\nThen, FIG. 1B shows a schematic diagram of a state in which an impurity element that gives one conductivity type is doped in a self-alignment fashion using as a mask the first shaped gate electrode 1009 etched as shown in FIG. 2.\n\nThe first shaped gate electrode 1009 has a tapered portion at its edge, and the gate insulating film also have a portion etched from its surface to a certain degree. The impurity element for giving on conductivity type is doped through the gate insulating film into the semiconductor layer formed thereunder. In addition, it is also possible to dope the impurity element somewhat through the edge portion of the first shaped gate electrode with the taper shape and a nearby portion of the edge portion into the semiconductor layer formed thereunder. Thus, an impurity region (A) 1010 with the doped impurity at a high concentration is formed. At this time, it is considered that there is the possibility that the impurity element is doped into the semiconductor layer through the tapered portion of the first electrode 1009a and the gate insulating film to form an impurity region which overlaps the first shaped gate electrode.\n\nThen, BCl 3, Cl2 and O2 are used as etching gas and a gas flow rate ratio thereof is set at 65/10/5 sccm and RF (13.56 MHz) electrical power of 450 W is supplied to a coiled electrode at a pressure of 1.2 Pa to thereby produce a plasma and to perform etching. RF (13.56 MHz) electric power of 300 W is supplied also to the substrate side (sample stage) to apply a substantially negative self-bias voltage for the etching. Subsequently, CF4, Cl2 and O2 are used as etching gas and a gas flow rate ratio thereof is set at 25/25/10 sccm, and RF (13.56 MHz) electrical power of 500 W is supplied to a coiled electrode at a pressure of 1.0 Pa to thereby produce a plasma and to perform etching. RF (13.56 MHz) electric power of 20 W is supplied also to the substrate side (sample stage) to apply a substantially negative self-bias voltage for the etching. With the etching treatment, a fourth electrode 1011a, a fifth electrode 1011b and a sixth electrode 1011c are formed from the first electrode 1009a, the second electrode 1009b and the third electrode 1009c. The laminated structure consisting of the fourth electrode 1011a, fifth electrode 1011b and sixth electrode 1011c is regarded as a second shaped gate electrode 1011.\n\nThen, a schematic diagram of a state, in which an impurity element for giving one conductivity type is doped in a self-align fashion with the second shaped gate electrode as a mask, is shown in FIG. 1C.\n\nIn the second doping processing, the impurity element for giving one conductivity is doped, and an impurity region (B) 1012 is formed. Note that although the impurity element is added into the impurity region (A) 1010 formed by the first doping processing, the influence is negligible since the concentration in the second doping processing is low. Although the newly formed impurity region (B) 1012 is formed with the fourth electrode 1011a, fifth electrode 1011b and sixth electrode 1011c used as a mask, it is considered at this time that there is the possibility that an impurity element is doped into the semiconductor layer through the tapered portion of the fourth electrode 1011a and the gate insulating film to form of an impurity region which overlaps the second shaped gate electrode.\n\nThereafter, an interlayer insulating film 1013 is formed to cover the gate electrode 1011. Then, in the interlayer insulating film 1013, a contact hole that reaches a region 1010 of the semiconductor to become either a source region or a drain region. Next, a wiring lead 1014 used for electrical connection of each TFT is formed.\n\nAs stated above, with the etching method of employing gas plasma in a reduced pressure atmosphere with three layers of conductive films laminated, it becomes possible to form a gate electrode with a desired shape by changing etching conditions. Further, by doping an impurity element through the tapered portion of the gate electrode, it is possible to form in the semiconductor layer a region in which the concentration of the impurity element changes gradually. \n\nAdditionally, with respect to the inductively coupled plasma (ICP) etching method used to form the gate electrode of the present invention with conductive films with low resistance laminated, it is easy to control plasma and thus the method is applicable also for a substrate with a large-area to be processed. \n\nEmbodiment 1 \n\nIn Embodiment 1, a method for simultaneously fabricating on the same substrate both a pixel portion and TFTs (p-channel type TFT and n-channel type TFT) of a driver circuit to be provided at the periphery of the pixel portion is explained in detail with reference to FIGS. 3 to 6.\n\nIn FIG. 3A and FIG. 4A it is possible to use barium borosilicate glass, alumino-borosilicate glass, quartz or other similar suitable materials as a substrate 100 although there are no particular limitations to the material thereof. On a surface of the substrate 100, an inorganic insulating film is formed as a base insulating film 101 to have a thickness of from 10 to 200 nm. A preferable example of the base insulating film is a silicon oxynitride film which is fabricated by plasma CVD method, and a first silicon oxynitride film 101a made from SiH4, NH3, N2O is formed to have a thickness of 50 nm and then a second silicon oxynitride film 101b made from SiH4 and N2O is formed to have a thickness of 100 nm. The base insulating film 101 is provided to prevent alkali metals contained in the glass substrate from diffusing into a semiconductor film to be formed later. In the case of using quartz as the substrate, it will possibly be omitted.\n\nAs an amorphous silicon film 102 formed on the base insulating film 101 a semiconductor material containing therein silicon as a main component is used. A typical example is either an amorphous silicon film or an amorphous silicon germanium film or the like which is formed to have a thickness of 10 to 100 nm by plasma CVD method, low-pressure CVD method or sputter method. In order to obtain good crystals it is recommendable that the impurity concentration of oxygen and nitride or the like contained in the amorphous silicon film 102 be reduced to a level less than or equal to 5×1018/cm3, and preferably 1×1018/cm3 or less. Further, if the concentration of oxygen within the amorphous silicon film is high it will be difficult to release catalytic elements (especially, nickel) used during a crystallization process. Therefore, it is important in order to obtain a good crystalline semiconductor film that the oxygen concentration within the amorphous silicon film 102 is set less than or equal to 5×1018/cm3, and preferably 1×1018/cm3 or below. These impurities become a factor for inhibiting crystallization of amorphous semiconductor materials, and also a factor for increasing the density of a trap center and a recombination center even after crystallization. Accordingly, it is desirable to employ CVD equipment with adaptability for ultrahigh vacuum which has mirror-surface treatment (electrolytic polishing treatment) within a reaction chamber and an oil-free vacuum evacuation system, in addition to the using high-purity material gas.\n\nThe amorphous silicon film 102 thus formed is crystallized to thereby form a crystalline semiconductor film. As a method for such crystallization, the conventional laser annealing method, thermal annealing method or RTA method are employable.\n\nIt is preferable that, prior to the crystallization processing that hydrogen contained in the semiconductor film be released away, and it is recommendable that the crystallization be conducted after performing thermal treatment at 400 to 500° C. for about one hour to set an amount of the contained hydrogen at a level less than or equal to 5% of the number of all atoms contained in the semiconductor film since it is possible to prevent roughness of the surface. Generally, the concentration contained hydrogen in an amorphous semiconductor film by sputter method or LPCVD method is lower than that of the amorphous silicon film formed by plasma CVD methods. Additionally, it is known that even if an amorphous semiconductor film is formed by plasma CVD method, the concentration of contained hydrogen is formed in forming at a temperature of 400° C. or higher. \n\nIn Embodiment 1, a laser annealing method is used to perform crystallization of the amorphous silicon film 102. The laser crystallization method can employ an excimer laser, YAG laser, YVO4 laser or the like, which is the pulse oscillation type or alternatively the continuous emission type. In this case, the efficiency is good when laser light emitted from a laser oscillator is corrected and focused into a linear shape by an optical system to irradiate onto a semiconductor film. While the conditions for crystallization are selected appropriately, pulse oscillation frequency is set at 300 Hz and a laser energy density is set at 100 to 800 mJ/cm2 (typically at 200 to 700 mJ/cm2) in the case of using an excimer laser. Alternatively, in the case of using a YAG laser, it is preferable to use the second higher harmonic wave while the pulse oscillation frequency is set at 1 to 300 Hz with the laser energy density being set at 300 to 1,000 mJ/cm2 (typically 350 to 800 mJ/cm2). It may be performed to irradiate linearly corrected laser light with a width of 100 to 1000 ?m, e.g. 400 ?m, over the entire surface of the substrate while the overlap ratio of linear beams at this time is set at 80 to 98%.\n\nIn addition, the laser crystallization method can be performed in the atmosphere, an atmosphere of an inert gas such as nitrogen, a reduced atmosphere or the like. \n\nSubsequently, in order to form a semiconductor layer which includes a channel formation region, a source region, and a drain region, the crystalline silicon film is etched to form semiconductor layers 103 to 106. An impurity element which gives p-type may be doped to control the threshold value (Vth) of an n-channel type TFT. Known examples of the impurity element that gives p-type to semiconductor are XIII group elements in the periodic table, such as boron (B), aluminum (Al), gallium (Ga) and the like.\n\nThen, a gate insulating film 107 is formed to cover the semiconductor layers 103 to 06 thus separated (FIG. 3B, FIG. 4B). The gate insulating film 107 is formed by plasma CVD method or sputter method, and is formed of a silicon-containing insulating film to have a thickness of 40 to 150 nm. The silicon-containing insulating film may be used as a single layer or to be a laminate structure.\n\nOn the gate insulating film 107, a first conductive film 108 with a film thickness of 20 to 100 nm, a second conductive film 109 with a film thickness of 100 to 400 nm, and a third conductive film 110 with a thickness of 20 to 100 nm (FIG. 3C. FIG. 4C) are formed. Although a tungsten film with a film thickness of 50 nm, an alloy film of aluminum and titanium (AlTi) with a thickness of 500 nm, and a titanium film with a film thickness of 30 nm are sequentially laminated on the gate insulating film 107, the first conductive film 108, the second conductive film 109, and the third conductive film 110 are not limited only to these materials.\n\nNext, as shown in FIG. 3D and FIG. 4D, a resist mask 111 is formed by exposure process, followed by executing first etching treatment for forming gate electrodes and wirings. It is preferable to use an inductively coupled plasma (ICP) etching method. As the etching gas, chlorine-based gas represented by Cl2, BCl3, SiCl4, CCl4 or the like, fluorine-based gas represented by CF4, SF6, NF3, or O2. Although there are no specific limitations to the etching gases used, it is suitable here to use BCl3 and Cl2 and O2. For the etching, a gas flow rate of the above gas is set at 65, 10/5 sccm while RF (13.56 MHz) electrical power of 450 W is applied to a coiled electrode at a pressure of 1.2 Pa to produce plasma. RF (13.56 MHz) electric power of 300 W is supplied to the substrate side (sample stage) also to apply a substantially negative self-bias voltage. With this first etching condition, the Ti film and AlTi film are etched to have an edge portion of the first conductive film tapered.\n\nThereafter, the first etching condition is changed to a second etching condition to perform etching while CF 4, Cl2 and O2 are used as etching gas, a gas flow rate is set at 25/25/10 sccm, and RF (13.56 MHz) electric power of 500 W is applied to the coiled electrode at a pressure of 1 Pa to thereby generate plasma. RF (13.56 MHz) electric power of 20 W is applied to the substrate side (specimen stage) to thereby apply a substantially negative self-bias voltage.\n\nIn this first etching treatment, it makes edge portions of the first conductive film and the second conductive film have a tapered shape to design the shape of the resist mask appropriately and apply the bias voltage to the substrate side. This tapered portion has an angle of 15 to 45°. In this way, owing to the first etching treatment, first shaped gate electrodes 112 to 115 consisting of the first electrode, the second electrode and the third electrode (first electrodes 112a to 115a, second electrodes 112b to 115b and third electrodes 112c to 115c) are thus formed (FIG. 3D and FIG. 4D). A region of the gate insulating film which is not covered by the first shaped gate electrodes 112 to 115 is etched away by about 20 to 50 nm to be thinned.\n\nHere, a first doping process is performed to thereby dope into a semiconductor layer an impurity element for giving n-type (referred to as n-type impurity element hereinafter). Here, the n-type impurity element is added by ion dope method in a self-align fashion while the mask 111 used for forming the first electrodes is left and kept unchanged and also the first shaped gate electrode as is used as a mask. As the n-type impurity element, an element, such as phosphorus (P), arsenic (As) or the like, which belongs to the XV group in the periodic table is used. Here, phosphorus is used. With such an ion dope method, an n-type impurity region which contains the n-type impurity element at a concentration of 1×1020 to 1×1021/cm3 is formed in the first impurity regions 116 to 119, an n-type impurity region (A). At this time, it is considered that there is also the possibility that an impurity element is doped into the semiconductor layer through the tapered portion of the first electrode and the gate insulating film to form an impurity region which overlaps the first shaped gate electrode.\n\nNext, a second etching treatment is performed without removal of the resist mask 111. As etching gas, chlorine-based gases represented by Cl2, BCl3, SiCl4, CCl4 or the like, fluorine-based gas represented by CF4, SF6, NF3 or the like, or O2 may be used appropriately. Note here that although there are no specific limitations to the etching gases used, it is suitable here to use BCl3 and Cl2 and O2. A gas flow rate of the above gas is set at 65/10/5 sccm while RF (13.56 MHz) electrical power of 450 W is supplied to the coiled electrode at a pressure of 1.2 Pa to generate plasma. RF (13.56 MHz) electric power of 300 W is supplied to the substrate side (sample stage) also to thereby apply a substantially negative self-bias voltage.\n\nSubsequently, CF 4 and Cl2 plus O2 are used as etching gas to perform etching for about 30 seconds while a gas flow rate is set at 25/25/10 sccm and RF (13.56 MHz) electric power of 500 W is applied to the coiled electrode at a pressure of 1 Pa to thereby produce a plasma. Also, RF (13.56 MHz) electric power of 20 W is applied to the substrate side (sample stage) to thereby apply a substantially negative self-bias voltage.\n\nIn this way, the first electrodes 112a to 115a, the second electrodes 112b to 115b, and the third electrodes 112c to 115c, are etched to thus form second shaped gate electrodes 120 to 123 (fourth electrodes 120a to 123a, fifth electrodes 120b to 123b, and sixth electrodes 120c to 123c) which consist of the fourth electrode, fifth electrode and sixth electrode.\n\nThen, a second doping process is performed to add an n-type impurity element to the semiconductor layers 103 to 106. In this process, the second shaped gate electrodes 120 to 123 are used as a mask to form n-type impurity regions 124 to 127 containing therein the n-type impurity element at a concentration of 1×1017 to 1×1020/cm3, an n-type impurity region (B). At this time, it is considered that there is also the possibility that an impurity element is added to the semiconductor layer through tapered portion of the fourth electrode and the gate insulating film to form an impurity region overlapping the second shaped gate electrode.\n\nSubsequently, a region that will later become an n-channel type TFT is covered with masks 128 and 129, and then a third doping process is performed for doping into the semiconductor layers 104 and 106 an impurity element that gives p-type (referred to hereinafter as p-type impurity element). In the third doping process, the second shaped conductive layers are also used as a mask to dope the p-type impurity element in a self-alignment fashion. Then, p-type impurity regions 130 and 131 are formed, which contain the p-type impurity element at a concentration of 2×1020 to 3×1021/cm3.\n\nHere, looking at the p-type impurity regions 130 and 131 in detail, it can be seen that there are regions 130a and 131a containing n-type impurity element at a concentration of 1×1020 to 1×1021/cm3 and regions 130b and 131b containing n-type impurity element at a concentration of 1×1017 to 1×1020/cm3. However, in these impurity regions, the concentration of p-type impurity element is 1.5 to 3 times greater than the concentration of n-type impurity element, no problems occur in the case of functioning as the source region or drain region of a p-channel type TFT.\n\nNote that the impurity region 131 is formed in a semiconductor layer which forms a holding capacitor in the pixel portion.\n\nUp to the steps stated above, an impurity region with a conductivity type of n-type or p-type is formed in each of the semiconductor layers. Additionally, the second shaped electrode 123 becomes one electrode for the holding capacitor in the pixel portion.\n\nNext, a first interlayer insulating film 132a is formed (FIG. 5C and FIG. 6C). This first interlayer insulating film 132 is formed of an insulating film which contains silicon and hydrogen by plasma CVD method or sputtering method to a thickness of 100 to 200 nm. One preferr... | Semiconductor Energy Laboratory Co. Ltd.,Atsugi-shi, Kanagawa-ken,JP | Semiconductor Energy Laboratory Co. Ltd.,Atsugi,JP | Semiconductor Energy Laboratory Co. Ltd. | SEMICONDUCTOR ENERGY LABORATORY CO. LTD. | SEMICONDUCTOR ENERGY LABORATORY CO. LTD. | Yamazaki, Shunpei | Suzawa, Hideomi | Ono, Koji | Kusuyama, Yoshihiro | 4 | Fish & Richardson P.C. | NaN | Laurenzi, Mark A | US | Dead | 12 | 2014 | US | 5 | 2013 | 2001-03-27 | 2001 | H01 | H01 | 438164 | 438029 | 438632 | 257013 | 257014 | 257015 | 257E33008 | US6909114B1 | US20010049197A1 | US20020149016A1 | US20040115851A1 | US20050017242A1 | US20050189543A1 | JP6148685A | JP2000223716A | JP2000241832A | JP2001035808A | US5508209A | US5643826A | US6469317B1 | US6613618B1 | US6646287B1 | US6891195B2 | US20010030322A1 | US20010038065A1 | US20020016028A1 | US20020070382A1 | US20020110941A1 | JP11345975A | US5612234A | US6197624B1 | US6399960B1 | US6475836B1 | US6489952B1 | US6501098B2 | US6617644B1 | US6949767B2 | US7564059B2 | US20010025960A1 | US20010041392A1 | US20090315085A1 | JP7235680A | US5852481A | US6259138B1 | US6599785B2 | US6791112B2 | US20020013022A1 | US4905066A | US5641983A | US6165810A | US6365917B1 | US6635505B2 | US6784037B2 | US20010052950A1 | US20020017685A1 | US20020139980A1 | US20020142554A1 | US20020158288A1 | US20030211662A1 | JP8274336A | US6274887B1 | US6285042B1 | US6518594B1 | US6809021B2 | US6977394B2 | US7956362B2 | US20010055841A1 | US20020006705A1 | US20030122132A1 | US20040051142A1 | US20050056837A1 | US20050161675A1 | US20050205868A1 | EP82012A2 | JP7130652A | JP2001024196A | US5100820A | US5953582A | US6150249A | US6165824A | US6277679B1 | US6335541B1 | US6512271B1 | US6558993B2 | US6657260B2 | US6815273B2 | US7064020B2 | US20050051773A1 | US20050104068A1 | US20060051906A1 | EP1005093A2 | EP1071124A2 | JP10247735A | US5276347A | US5923962A | US6031290A | US6515336B1 | US6529251B2 | US6586766B2 | US6803601B2 | US20010030342A1 | US20020001886A1 | US20050110016A1 | EP1005094A2 | EP2259316A2 | JP2000223714A | US5585815A | US6180439B1 | US6420758B1 | US6545359B1 | 103 | Australian Patent Office Search Report and Written Opinion of Counterpart Singapore Patent Application No. 200201696-2, Feb. 16, 2004, 9 pages. | Ghandhi, S. VLSI Fabrication PrinciplesSilicon and Gallium Arsenide, A Wiley-Interscience Publication, Second Edition, 1994, pp. 552-553. | 2 | US20140295627A1 | US9059215B2 | 2 | 2023-02-28 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - 2022-12-30 | 2023-02-06 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | 2022-08-22 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | 2018-06-14 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) FEE PAYMENT YEAR 4 | 2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE | 2014-04-29 AS ASSIGNMENT SEMICONDUCTOR ENERGY LABORATORY CO., LTD., JAPAN ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:YAMAZAKI, SHUNPEI;SUZAWA, HIDEOMI;ONO, KOJI;AND OTHERS;SIGNING DATES FROM 20020312 TO 20020313;REEL/FRAME:032782/0313 | US8921169B2 | JP04926329B2 | JP2002289865A | SG121710A1 | US20020163049A1 | US20040084699A1 | US20070194315A1 | US20110024757A1 | US20110210336A1 | US20120264245A1 | US20130252385A1 | US20150099333A1 | US7164171B2 | US7238600B2 | US7804142B2 | US7952152B2 | US8207536B2 | US8440484B2 | US9142574B2 | 20021004JP2002289865A_ |
| 7 | US8924860B2 | Adding events to a calendar from another application | WO2000US30099A | US2003415720A | US2009576883A | 2000-10-31 | 2003-11-12 | 2009-10-09 | US13618470A | 2012-09-14 | B2 | 2014-12-30 | Espinoza Tony|San Francisco, CA, US | Lavoy Debra|San Jose, CA, US | Quigley Ben|Burlingame, CA, US | Sobotka Dave|Redwood City, CA, US | Sugarbaker Mike|Oakland, CA, US | Wolf Mary|Oak Hill, VA, US | Facebook Inc.,Menlo Park,CA,US | Espinoza Tony,San Francisco,CA,US | Lavoy Debra,San Jose,CA,US | Quigley Ben,Burlingame,CA,US | Sobotka Dave,Redwood City,CA,US | Sugarbaker Mike,Oakland,CA,US | Wolf Mary,Oak Hill,VA,US | META PLATFORMS INC. | T01 E | T01-G05C | T01-J12B1 | T01-N01A2 | T01-N01D2 | G06F0003048 | G06F00030481 | G06Q001010 | G06Q003002 | G06F00030482 | G06F000304812 | G06F000304842 | G06F000304847 | G06Q0010109 | G06Q00101093 | G06Q00300277 | Y10S0715963 | 715752 | 715963 | NaN | A method and apparatus is provided that allows a user to automatically add content, such as an event, to a container, such as, a calendar without directly accessing the container. Second and third preferred embodiments are also provided. | Adding events to a calendar from another application | The invention claimed is: \n1. A method comprising: \nidentifying a message with information associated with a user event; \nproviding, in the message, a selectable element associated with the user event that allows for the user event to be added to an electronic calendar application, the message being provided to a user in a first graphical user interface; \ndetecting, by at least one processor, a user selection of the selectable element provided in the message; \nupon detecting the user selection of the selectable element provided in the message, providing a second graphical user interface including one or more input fields for information related to the user event; \ndetecting, using the at least one processor, a user confirmation of information in the one or more input fields; and \nupon detecting the user confirmation of the information in the one or more input fields, creating, by the at least one processor, an entry in the electronic calendar application corresponding to the user event based on the information, wherein the entry is created in the electronic calendar application without opening the electronic calendar application. \n2. The method as recited in claim 1, wherein the first graphical user interface is associated with a first application, the first application differing from the electronic calendar application.\n3. The method as recited in claim 2, wherein the first application comprises an Internet browser.\n4. The method as recited in claim 1, wherein the selectable element comprises an icon.\n5. The method as recited in claim 1, wherein the selectable element comprises text.\n6. The method as recited in claim 5, wherein the text comprises a description of the user event.\n7. The method as recited in claim 1, wherein the one or more input fields comprise a title input field, a date input field, and a time input field.\n8. The method as recited in claim 7, further comprising auto-filling the title input field, the date input field, and the time input field upon providing the second graphical user interface.\n9. The method as recited in claim 7, further comprising receiving an input from the user for the title input field, the date input field, and the time input field.\n10. A method comprising: \nidentifying a message of a first application associated with an event that a user can attend or otherwise participate in, the message including information related to the event; \nproviding a selectable element associated with the event in the message that allows for the event to be added to an electronic calendar application, the message and the selectable element being provided to the user in a first graphical user interface; \ndetecting, by at least one processor, a user selection of the selectable element provided in the message; \nupon detecting the user selection of the selectable element provided in the message, providing a second graphical user interface including one or more input fields for information related to the event; \ndetecting, using the at least one processor, a user confirmation of information in the one or more input fields; and \nupon detecting the user confirmation of the information in the one or more input fields, creating by the at least one processor, an entry in the electronic calendar application corresponding to the event based on the information, wherein the entry is created in the electronic calendar application without opening the electronic calendar application, and the electronic calendar application differs from the first application. \n11. The method as recited in claim 10, wherein the first application comprises an Internet browser.\n12. The method as recited in claim 10, wherein the selectable element comprises an icon.\n13. The method as recited in claim 10, wherein the selectable element comprises text.\n14. The method as recited in claim 13, wherein the text comprises a description of the event.\n15. The method as recited in claim 10, further comprising providing a user interface portion indicating that the event has successfully been entered in the electronic calendar application.\n16. The method as recited in claim 15, wherein the user interface portion comprises one or more of a title, a date, and a time of the event.\n17. The method as recited in claim 16, wherein the user interface portion allows a user to modify one or more of the title, the date, and the time of the event.\n18. A non-transitory computer readable storage media storing instructions thereon that, when executed by a processor, cause a computer system to: \nidentify a message with information associated with a user event; \nprovide, in the message, a selectable element associated with the user event that allows for the user event to added to an electronic calendar application, the message being provided to a user in a first graphical user interface; \ndetect a user selection of the selectable element provided in the message; \nprovide a second graphical user interface including one or more input fields upon detecting the user selection of the selectable element provided in the message; \ndetect a user confirmation of information in the one or more input fields; and \ncreate an entry in the electronic calendar application corresponding to the user event based on the information upon detecting the user confirmation of the information in the one or more input fields, wherein the entry is created in the electronic calendar application without opening the electronic calendar application. \n19. The non-transitory computer readable storage media as recited in claim 18, wherein the instructions, when executed by the processor, further cause the computer system to provide a user interface portion indicting that the user event has successfully been entered in the electronic calendar application, wherein the user interface portion comprises one or more of a title, a date, a time of the user event, and allows the user to modify one or more of the title, the date, and the time of the user event.\n20. The non-transitory computer readable storage media as recited in claim 18, wherein the one or more input fields comprise a title input field, a date input field, and a time input field; and the instructions, when executed by the processor, further cause the computer system to auto-fill the title input field, the date input field, and the time input field upon providing the graphical user interface. | 20 | 1. A method comprising: \nidentifying a message with information associated with a user event; \nproviding, in the message, a selectable element associated with the user event that allows for the user event to be added to an electronic calendar application, the message being provided to a user in a first graphical user interface; \ndetecting, by at least one processor, a user selection of the selectable element provided in the message; \nupon detecting the user selection of the selectable element provided in the message, providing a second graphical user interface including one or more input fields for information related to the user event; \ndetecting, using the at least one processor, a user confirmation of information in the one or more input fields; and \nupon detecting the user confirmation of the information in the one or more input fields, creating, by the at least one processor, an entry in the electronic calendar application corresponding to the user event based on the information, wherein the entry is created in the electronic calendar application without opening the electronic calendar application. | 1. A method comprising: identifying a message with information associated with a user event; providing, in the message, a selectable element associated with the user event that allows for the user event to be added to an electronic calendar application, the message being provided to a user in a first graphical user interface; detecting, by at least one processor, a user selection of the selectable element provided in the message; upon detecting the user selection of the selectable element provided in the message, providing a second graphical user interface including one or more input fields for information related to the user event; detecting, using the at least one processor, a user confirmation of information in the one or more input fields; and upon detecting the user confirmation of the information in the one or more input fields, creating, by the at least one processor, an entry in the electronic calendar application corresponding to the user event based on the information, wherein the entry is created in the electronic calendar application without opening the electronic calendar application. | 10. A method comprising: identifying a message of a first application associated with an event that a user can attend or otherwise participate in, the message including information related to the event; providing a selectable element associated with the event in the message that allows for the event to be added to an electronic calendar application, the message and the selectable element being provided to the user in a first graphical user interface; detecting, by at least one processor, a user selection of the selectable element provided in the message; upon detecting the user selection of the selectable element provided in the message, providing a second graphical user interface including one or more input fields for information related to the event; detecting, using the at least one processor, a user confirmation of information in the one or more input fields; and upon detecting the user confirmation of the information in the one or more input fields, creating by the at least one processor, an entry in the electronic calendar application corresponding to the event based on the information, wherein the entry is created in the electronic calendar application without opening the electronic calendar application, and the electronic calendar application differs from the first application. | 18. A non-transitory computer readable storage media storing instructions thereon that, when executed by a processor, cause a computer system to: identify a message with information associated with a user event; provide, in the message, a selectable element associated with the user event that allows for the user event to added to an electronic calendar application, the message being provided to a user in a first graphical user interface; detect a user selection of the selectable element provided in the message; provide a second graphical user interface including one or more input fields upon detecting the user selection of the selectable element provided in the message; detect a user confirmation of information in the one or more input fields; and create an entry in the electronic calendar application corresponding to the user event based on the information upon detecting the user confirmation of the information in the one or more input fields, wherein the entry is created in the electronic calendar application without opening the electronic calendar application. | CROSS REFERENCE TO RELATED APPLICATIONS \n\nThe present application is a continuation of U.S. application Ser. No. 12/576,883, filed Oct. 9, 2009, which is a division of U.S. application Ser. No. 10/415,720, filed Nov. 12, 2003, which is now issued as U.S. Pat. No. 7,627,830, which is a 371 national stage application of international application number PCT/US00/30099, filed Oct. 31, 2000. Each of the aforementioned patent(s) and application(s) are hereby incorporated by reference in their entirety. \n\nBRIEF DESCRIPTION OF THE DRAWINGS \n\nFIG. 1 shows a flow diagram from a user's perspective, according to the invention;\n\nFIGS. 2 a and 2b are screen prints of the tool, according to a preferred embodiment of the invention;\n\nFIG. 3 is a screen print of an appointment corresponding to entries in the tool in FIGS. 2a and 2b, according to the invention; and\n\nFIG. 4 shows a flow diagram of the use of the Jot-it-Down embodiment.\n\nBACKGROUND OF THE INVENTION \n\n1. Technical Field \n\nThe present invention relates to gathering information and putting the information into associated containers. More particularly, the present invention relates to gathering information from an information source, such as, for example, a Web page, and storing the information in an associated online container, such as, for example, an online calendar, for the convenience of an end-user. \n\n2. Description of the Prior Art \n\nAs more and more people use the Internet to attain information relevant to their lives, more Internet tools and utilities are created for such users to help them be better organized. More specifically, Web features of Web products have been created that link with other features of Web products. For example, the generic online address book application operates in this fashion. To with, a user opens an email letter sent to him or her within a particular email application. At that point, the user is provided the opportunity to add the sender's email address to that application's online address book that belongs to the user. \n\nYahoo! Inc., (Yahoo!) has an online package of applications comprising, for example, a calendar and a bookmarking application. A user can enter event dates and appointments in the calendar, and can enter links to particular Web pages in Yahoo! Bookmarks. \n\nSimilarly, 1calendar.com provides an application that calendar-enables a user's events and contact listings. A user can add events or contacts to his or her calendar/addressbook with a single click. 1calendar teaches encoding the required data once, and 1calendar translates it into the required code for each user's favorite application. \n\nL. A. Lisle; S. L. Martin, and J. M. Mullaly, Data processing system for automatic storage of objects of an object type within a logical containment system and method therefor, U.S. Pat. No. 6,104,394 (Aug. 15, 2000) discloses a data processing system, software program and method that effectively and intuitively display a storage space of a data processing system to an end-user to allow the end-user to create a filing system which has an easily usable interface. In implementing this methodology, the user is allowed to simply request that all objects within an entire file system of a data processing system be placed in a logical container. A user sets the parameters for defining the desired characteristics of each of the objects stored within the logical container. Thus, a user is able to organize representations of desired objects in various storage locations without requiring extra steps by a user or excess memory. Furthermore, the contents of a logical container are dynamically updated in real-time to ensure that the filed information is current and accurate. The ability of a user to modify the containment settings and to have such modifications immediately reflected in the logical container rendered on a display device allows a user great flexibility in obtaining a desired graphical user interface. \n\nAll of the prior art to date is limited by a specific system environment. For example, Yahoo!'s linkages are all performed within, that is, are limited by, the Yahoo! Community. 1calendar is limited by Web calendars. \n\nIt would be advantageous to advance the level of and improve online services provided on the Web by providing functionality on the Web that allows a user to gather content from one Web information source, such as, for example, a Web page, and add the information to any online container of a corresponding type, such as, for example, a calendar, an address book, a shopping list, and the like. \n\nSUMMARY OF THE INVENTION \n\nA method and apparatus is provided that allows a user to automatically add content, such as an event, to a container, such as, a calendar with a single mouse click, and without directly accessing the container. In a second embodiment, the user opens a dialog box to automatically add personalized information, such as an appointment, to the container, such as the calendar, without entering the calendar application. In a third embodiment, an advertisement banner having an associated entity, such as, for example, an electronic coupon, scrolls horizontally across a Web page, and when the user clicks on the entity on the banner, a copy of the entity is placed in the user's associated container, such as, for example, a shopping list, without the user having to click to the container's site. \n\nDETAILED DESCRIPTION OF THE INVENTION \n\nA method and apparatus is provided that allows a user to automatically add content, such as an event, to a container, such as, a calendar with a single mouse click, and without directly accessing the container. In a second embodiment, the user opens a dialog box to automatically add personalized information, such as an appointment, to the container, such as the calendar, without entering the calendar application. In a third embodiment, an advertisement banner having an associated entity, such as, for example, an electronic coupon, scrolls horizontally across a Web page, and when the user clicks on the entity on the banner, a copy of the entity is placed in the user's associated container, such as, for example, a shopping list, without the user having to click to the container's site. \n\nIt is noted herein that in the appropriate context, the terms, link, insert, and logo are used interchangeably. \n\nIn the first preferred embodiment, a click-to-add invention makes it easy for channels, brands, partners, and individuals to integrate with a generic container application, such as, for example, a calendar application. From a user's perspective, the click-to-add invention taught herein allows the user to easily, quickly, and without disruption add content information, such as, for example, dates and events from World Wide Web (Web) sites to the user's container, such as, for example, a calendar. From channels', brands', and partners' perspectives, the invention herein is a valuable promotional tool. The invention makes channel, brand, partner, and an individual's content more relevant to the user, and encourages traffic to be driven or directed from the container application to the channel's, brand's, partner's, and individual's respective Web sites. \n\nFIG. 1 shows a flow diagram of an implementation from a user's perspective, according to the invention. In one preferred embodiment, a partner has placed a click-to-add link or insert beside an event on a page on their Web site. At some later point in time, a user clicks on the event (1), and the event is added to the user's personal calendar. A small success message (2) is displayed subsequently and provides the user an option to link to the personal calendar, from wherein the user can open the added event (3). A link back to the partner's site from the added event is provided according to the invention, and is shown in the magnified image.\n\nIt is noted that in the preferred embodiment, channels, brands, partners, and individuals can add text, images, or hyperlinks but are by no means limited to these common programming objects. Specifically, in one embodiment, a More Info section is suggested as a conventional place within which to add the programming objects cited herein above. \n\nExample 1 \n\nAgain, referring to FIG. 1, a user clicks on a click-to-add insert (1). The event is added to the user's calendar and a small success message pops up in the upper left hand corner of an election guide page (2). The user stays within the election guide page, but has the option to go to the calendar. When the user chooses to go to the calendar, the user sees the event, as well as a link, such as in the More Info section, that serves the purpose of driving or directing the user back into the content, i.e. the election guide page.\n\nIt is noted that implementing the click-to-add invention claimed herein on a Web site is easy, and comprises four main steps. The four steps are requesting a click-to-add partner identifier (ID) from an appropriate account manager; going to a proprietary Web site to access a tool for creating an insert, also referred to herein as a link, when creating one link at a time; filling in the fields of the tool; and publishing the link, or the insert. For producing a relatively large quantity of links at a time, an alternative embodiment is taught herein below. \n\nIn the preferred embodiment, the ID is used to identify and track the effectiveness of click-to-add promotions. \n\nIn the preferred embodiment, the tool provides an option to create links for Web pages that are not proprietary Web pages, i.e. that are business partners' Web pages, and the tool provides an option to create links for proprietary Web pages, such as, for example, America OnLine Web pages. \n\nFIGS. 2 a and 2b are screen prints of the tool, according to a preferred embodiment of the invention. The first category of fields comprises a click-to-add ID 201 and a choice of two options: full service 202 or link only 203. The full service option 202 allows the user to enter more detailed content information, while the link only option 203 only allows the user to enter link information. Following is a second category of information, comprising the various entry fields: title 204; date 205; time 206; untimed event 207; and duration 208. Following is a third category of information, comprising the main HTML block: the image source field 209 which is for a full, published entered URL and wherein referenced images must be 50×50 pixels; an event description field 210; an entry field for the text for a first link 211; an entry field for the source URL of the first link 212; an entry field for the text for a second link 213; and an entry field for the source URL of the second link 214. Following is a fourth category comprising an initiator, specifically, a click-to-add link button 215, for publishing the insert, or URL, according to the invention. Following is a fifth category comprising an output text field 216, specifically showing the resulting URL according to the invention. Herein below is a more detailed description of a preferred embodiment the tool.\n\nDetail Description of Fields of an Implementation of a Preferred Embodiment of the Tool \n\nTitle. Names the title of an associated event. It is preferred to be unique and descriptive to avoid being out of context the next time a viewer reads or sees it. This is a required field. Example: 8 p.m. ET: Season Finale of XXXXX, on XYZ. \n\nTime. It is noted that while in the preferred embodiment, times are not translated for different time zones, the functionality to translate for different time zones is an improvement within the scope of the invention. If an event is national, or is expected to be viewed in different time zones at the same time, for example, the World Series game airing, the event is marked as an untimed event. The associated time and time zones are added to the title field. For example, the title field could read, Live World Series game airing at 8 p.m. ET/5 p.m. PT. This is not a required field. \n\nDate. The event is added to users' calendars on this date. This is a required field. \n\nDuration. Add the duration in this field if the duration of the event is known. If the duration is not known, this field is left blank. \n\nEvent Description. Text description of the event is added here. \n\nImage. A selected image on a Web site or any other image that can be referenced on the appointment page is added here. The image is 50×50 pixels and is published somewhere on the Web site where it going to stay for some time to avoid users referencing broken images on an appointments page, for example. \n\nCreate Links. The first link field is for containing a link to a page where a user can find more useful or additional information. The second link field comprises text that will be hyper-linked to this useful page with more or additional information. It is preferred that the link be descriptive of the page to which it links. \n\nSubmit, Test, and Output. After all of the desired information is entered, the information is submitted. An Add this to My Calendar link is displayed. A user can click on this link to preview and test how the link works. The process is iterative. That is, if the link does not display all of the information in an appointment as intended, then return to the tool and edit the information, resubmit once again, and retest the link. When the test is satisfactory, the HTML code that is displayed in an Output field is ready for publishing on the Web site. \n\nExample 2 \n\nIt is noted that in the preferred embodiment, fields in the tool used to create the links and inserts correspond simply to fields in the container. For example, fields in a click-to-add link correspond simply to fields in an appointment. \n\nFIG. 3 is a screen print of an appointment information page corresponding to entries in the tool in FIGS. 2a and 2b, according to an implementation of a preferred embodiment of the invention. A first section shows corresponding fields Title 304, Date 205, Time 206, Duration 208, and, the first link, Click Here for More Info 311. The appointment page allows a wide variety of other functionality and options, such as, for example, a Tell a Friend section wherein a user can type in email addresses or screen names in a box 320.\n\nPublishing the Insert or Link. \n\nThe preferred embodiment allows for a wide variety of means for publishing the insert or link. Listed below are suggested examples, but the invention is by no means limited to such suggested examples: \n * Give the link or insert to the webmaster of the Web page containing the content;\n * Highlight the HTML code in the Output field, copy it, and give the copied HTML code to the webmaster to publish on the Web site; and\n * Have users embed the HTML code in the Web page as follows: \n * Highlight the HTML code in the Output field;\n * Copy the HTML code;\n * Paste the insert or link beside or underneath a promotion for an event on the user's HTML page; and\n * Publish the page on the Web site, and be ready to have end-users add the event to their calendars. \n An Important Note About Inserting. \n\nIn the preferred embodiment, when placing links or inserts on a channel, brand, or partner page, the links or inserts are required to be faithful to the proprietor's brand. Following in Table A is an example displaying two options for placing click-to-add inserts behind a calendar logo. It is appreciated that the example is by no means limited to the container being a calendar. \n\n\nTABLE A \n\nOption A: Option B:\nCreate a Key and Single Calendar Logos Skip the Key, Create All-In-One Logo/Links\nThe key explains what the single logos are and The button itself explains the feature and\nwhat they do. displays the Calendar logo.\nExample of the Key: Example of the Button:\nAdd these appointments to My Calendar by Add this to My Calendar \nclicking the .Place this beside or under events to be added\nThis should appear at the top or bottom of any to Calendars.\npage that carries the Calendar button. \nPlace the Calendar buttons (that the key \ndescribes) beside or under events to be added \nto Calendars. \nThe button would look like this. \n\n\n\nIt is noted that in an implementation of a preferred embodiment, the Full Service option available in the click-to-add (CTA) tool creates a small chunk of HTML that includes the CTA link, as well as the My Calendar logo. \n\nTechnical Guidelines for Producing Dynamic Container-Ready Links. \n\nIn the preferred embodiment, if a lot of published links or inserts are desired on a particular Web site that may be impractical to create with the publishing tool cited herein above, the following information is given to a software engineer to use to create the claimed links or inserts for any and every event on the Web site in an automatic fashion. \n\nIt is noted that the project described herein is by no means limited to the click-to-add embodiment, but can be applied in a much broader context without deviating from the scope and spirit of the invention. \n\nDescription of Click-to-Add Projects. \n\nThe channel, brand, partner, or individual must pass URLs to a container, such as, a calendar in order to allow users to access the content, such as, for example, scheduling appointments in personal calendars. No matter how these URLs are generated on a page, they must be constructed in a particular manner, described herein below in the section entitled, Parameters for Created URLs. \n\nStarting a Click-to-Add Project. \n\nThe preferred embodiment comprises the steps herein below: \n * Design a Click-to-Add program, such as where inserts appear on the Web site, what information they will contain, and the like;\n * Request a partner id number;\n * If added appointments are of a specific type exclusively, ask for a type ID number; and\n * Follow the parameters according to predetermined construction, such as those within this document, to create the links or inserts on the Web site. \n Parameters for Created URLs. \n\nIn the preferred embodiment, the claimed URLs, such as, for example, the CTA URLs must conform to a specific construction in order for the data therein to pass properly to the intended containers, such as, for example, personal calendars. Total character length of the URLs should not exceed 1000 characters. URLs greater in length may be truncated. \n\nA list of required URL elements in an implementation of a preferred embodiment are as follows in Table B. \n\nTable B \n\n\n * 1. DNS Root: http://calendaraol.com/cgi-bin/gx.cgi/AppLogic+XA?_W=CTA; \n * 2. Partner ID: _ID=n, wherein n is a specific identification number. It is noted that if these links are to be published on Rainman pages, then n must be preceded by 0. That is, the parameter is required to read, _ID=0n, wherein n is the partner identification number given. Otherwise, if the links are going to be simply on HTML pages, then do not precede the partner ID number with 0;\n * 3. Date: _D=MM/DD/YYYY, wherein if month or day is a single digit, precede with a zero;\n * 4. Time: Use either a or b herein below: \n * a._H=HH&_M=MM, if the event takes place at a specific time, or\n * b._H=NT, if the event does not occur at a specific time during the day, or if the time of day is put in the title as text;\n * 5. Event Type: _ET=<event type>;\n * 6. Title: _T=<text>, wherein up to 60 characters is recommended, and the entire URL must be equal to or less than 1000 characters;\n * 7. Information: _I=<text>, wherein up to 525 characters recommended. It is important that the information goes last, so that if the URL is over 1000 characters, then something in the information will be cut short rather than a piece of the URL that is actually essential for the link to work.\n\nOptional Fields \n * 8. Duration Hour: _DH=; and\n * 9. Duration Minute: _DM=;\n\nIt is noted that the URLs are constructed using these items, and that each should be separated by an &. See example herein below. The URLs should be constructed in the order shown above, each current one appended to the last. \n\nThe following is also noted: \n * 1. Do not put targets in URLs;\n * 2. Certain characters do not work in URLs. For instance, a URL cannot contain spaces. Substitutes must be used for these types of characters. Following is a sample list of suggested substitutes.\n\n\n\nSpaces %20 or +\nColons %3A\nCommas %2C\n# %23\nSemicolon %3B\n$ %24\n% %25\n! %21\n& %26\n( %28\n) %29\n? %3F\n? %22\n< %3C\n> %3E\nLine Break %20 (See next section, Section 4.)\n\n * 3. The character % OD occurs when line breaks are escaped in links. This character breaks CTA links, therefore, it is recommended to avoid this character in links. \n OPTIONAL: Allowing Users to Generate Some of the Information for CTA Links. \n\nIn another preferred embodiment, partners choose to allow users to generate some of the information created in the links and inserts, such as, for example, the click-to-add links. \n\nWhile allowing users to generate some of the information in the link is an exciting application of invention, such as, for example, the click-to-add embodiment, there is nevertheless an important item with which to be careful. That is, when users insert line breaks into a field, such as, for example, an Event Description or any other field, most scripts will transform the line break into a default character in the resulting URL. The default character typically is % OD. \n\nThe % OD character breaks links, such as, for example, the claimed click-to-add links. Therefore, when implementing the interactive CTA feature comprising the functionality to incorporate user input, either the user is prohibited to enter line breaks in the fields via, for example, a pop-up that reminds the user to remove line breaks, or by overriding the % OD character with some other character or set of characters in the resulting CTA link, such as, for example, %20, which is a space. \n\nMore on Programming Information into Added Appointments. \n\nIn the preferred embodiment, regular text or HTML text can be placed into a Notes field of the claimed URL, following substitution rules, such as, for example, those cited herein above. Following is an example of guidelines for an implementation of a preferred embodiment. \n * Plain or HTML text information is displayed in a More Info field just below the title on added appointments. HTML text can include links back to the Web site. Referenced images are no larger than 50×50 pixels in size. An example of such HTML text is provided in a sample URL herein below;\n * The More Info field is restricted to 60 pixels in height and 265 pixels in width;\n * HTML characters, such as, for example, <and > should be escaped in the URL according to the characters cited herein above; and\n * All <open> commands must be </closed>, except for <br>, <img src>, and <p>. Any <open> commands that are not closed will cause the URL to be truncated just before the unclosed <open> command. \n Example of Created URL. \n\nHerein below in Table B is a sample URL according to the invention, and constructed with the following information embedded in it. \n\nTable B \n\nEvent Details \n * Title: One Wild and Crazy Netscape Event\n * Date: Dec. 31, 2000\n * Time: 11:30 pm\n * Duration: 1 hour\n * Partner ID Number: 15\n\nMore Information Details \n * Image: http://home.netscape.com/images/nc_ha_AIM30.gif\n * Text for event description: This is going to be one wild and crazy Netscape event. You will not want to miss it!\n * Text for a link: Click here for more Netscape information.\n * Link back to partner site: http://www.netscape.com\ \n Sample URL \n\nFollowing is the URL created by inputting the above event information into the claimed tool: \n\n\n\nhttp://calendar.aol.com/cgi- \nbin/gx.cgi/AppLogic+XA?_W=CTA&_ET=0&_ID=15&_D=12/31/2000&_H= \n23&_M=30&_DH=1&_DM=00&_T=One+Wild+and+Crazy+Event&_I=%3C \ntable+border%3D0%3E%3Ctr+valign%3Dtop%3E%3Ctd%3E%3Cimg+src \n%3Dhttp%3A//home.netscape.com/images/nc_ha_AIM30.gif+height%3D5 \n0+width%3D50+alt%3D%22%22%3E%3C/td%3E%3Ctd%3E%3Cfont+siz \ne%3D1+face%3DArial%3EThis+is+going+to+be+one+wild+and+crazy+Ne \ntscape+event.++You+will+not+want+to+miss+it%21%3Cbr%3E%3Cbr%3 \nE%3Ca+href%3Dhttp%3A//www.netscape.com%3EClick+here+for+more+ \nNetscape+information.%3C/a%3E%3C/font%3E%3C/td%3E%3C/tr%3E% \n3C/table%3E \n\n\nEmbedded within the URL link herein above is the event information and the More Information in an HTML format for display in an added appointment. The HTML tags are escaped in order to pass to the calendar in the URL. \n\nIt is noted that the claimed URL herein, as sampled herein above, instead of taking a user away to another Web site or Web page, the URL adds value to a client's product, because from the client's end-user's perspective, the URL serves to add the client's information into the user's container. \n\nIt is noted that the claimed invention herein provides a way for end-users to collect information of a certain type into the end-users' particular container. \n\nJot-it-Down. \n\nJot-it-Down is a second preferred embodiment of the invention. Jot-it-Down behaves as a dynamic click-to-add. That is, the claimed URL is created dynamically. \n\nFIG. 4 shows a flow diagram of the use of the Jot-it-Down embodiment. A user clicks the Jot-it-Down link from a Web page 400 and a pop up window 401 opens. The pop up window comprises input fields (402-405) for the user to input information. Examples of such input fields are title, date, time, and notes. After the user enters the desired information, including notes, the user then closes the Jot-it-Down pop up window. Shortly thereafter, a success window 406 opens stating that the user-entered information has been successfully added to the desired container and providing the user with two options (407 and 408). The first option is the user closes the success window and defaults to remaining at the Web page 400. The second option is from the success window, the user links to the container.\n\nAn application of the Jot-it-Down (JID) embodiment of the invention is a company decides what information is put in the pop up JID window. Then, when the employee clicks on the JID link, the predetermined information by the company is put into the employee's container. \n\nAdd Banner. \n\nAdd Banner is a third preferred embodiment of the invention. An advertisement banner having an associated entity, such as, for example, an electronic coupon scrolls horizontally across a Web page, and when the user clicks on the entity on the banner a copy of the entity is placed in the user's associated container, such as, for example, a shopping list, without the user having to click to the container's site. It is noted that clicking the link on the banner puts the entity in the user's entity container. From a technical perspective, functionality is added to Add Banner. \n\nIn the preferred embodiment, the Add Banner feature also provides a success window the use thereof results in two options for the user. The first option is the user closes the success window and remains on the current Web page. The second option is the user links from the success window to the appropriate container. \n\nAn example of a container in the Add Banner embodiment of the invention is a shopping list. In this example, the user's workflow is not disrupted, because the user has the option to click-to-add a desired coupon to the user's shopping list, instead of the user having to link to the corresponding merchant's Web site. \n\nIt is noted that all three significant preferred embodiments of the invention provide a success indicator, which comprises, but is not limited to, a first option directing the end-user to a container, and a default option, wherein the end-user remains at the original information source, such as, for example, a Web page. \n\nIt is noted that there are four typical types of users: \n * Internal partners;\n * external partners;\n * any product; and\n * any individual.\n\nIt is noted that the use of the invention claimed herein provides an important advantage to the user in that it does not disrupt the user's workflow. \n\nIt is noted that the invention provides a link for the user from the container to the original information source, such as, for example, an original Web page or Web page corresponding to an entity, such as, for example, a coupon in the Add Banner embodiment. \n\nIt is noted that beyond the standard links and logos, a wide variety of implementation options of the invention herein is possible as well as practical. \n\nAccordingly, although the invention has been described in detail with reference to particular preferred embodiments, persons possessing ordinary skill in the art to which this invention pertains will appreciate that various modifications and enhancements may be made without departing from the spirit and scope of the claims that follow. | Facebook Inc.,Menlo Park,CA,US | Espinoza Tony,San Francisco,CA,US | Lavoy Debra,San Jose,CA,US | Quigley Ben,Burlingame,CA,US | Sobotka Dave,Redwood City,CA,US | Sugarbaker Mike,Oakland,CA,US | Wolf Mary,Oak Hill,VA,US | Facebook Inc. | Espinoza Tony | Lavoy Debra | Quigley Ben | Sobotka Dave | Sugarbaker Mike | Wolf Mary | META PLATFORMS INC.(FORMERLY FACEBOOK INC) | META PLATFORMS INC.(FORMERLY FACEBOOK INC) | Espinoza, Tony | Lavoy, Debra | Quigley, Ben | Sobotka, Dave | Sugarbaker, Mike | Wolf, Mary | 6 | Keller Jolley Preece | NaN | Sax, Steven | US | Dead | 12 | 2014 | US | 9 | 2012 | 2000-10-31 | 2000 | G06 | G06, Y10 | 715752 | 715963 | US6091956A | US6163803A | US7251775B1 | US6272484B1 | US6618775B1 | US6925444B1 | US7627830B1 | US6253228B1 | US6594819B1 | US6148331A | US6591295B1 | US6725203B1 | US7302696B1 | US20010044797A1 | EP984370A2 | WO2000062226A2 | US5864848A | US6934740B1 | US6369840B1 | US6662231B1 | US6636888B1 | US7167728B1 | US7475346B1 | US20020059196A1 | US7376587B1 | US6496803B1 | US8327275B2 | US20020095335A1 | US6499021B1 | US6167402A | US6510461B1 | US6932270B1 | US7133834B1 | US20060212361A1 | US6591244B2 | US6310947B1 | US6553341B1 | US5905246A | US6421653B1 | US20020010623A1 | US20020023001A1 | US6208996B1 | US8032913B1 | US6181838B1 | US7286649B1 | US20010042078A1 | 46 | Appelt W. et al., Effectiveness and efficiency: the need for tailorable user interfaces on the Web, Computer Networks and ISDN Systems, North Holland Publishing. Amsterdam, NL, vol. 30, No. 1-7, Apr. 1, 1998, pp. 499-508, XP004121398, ISSN: 0169-7552, p. 501, col. 1, line 1col. 2, line 16. DOI:10.1016/S0169-7552(98)00016-6 4 | Bentley R. et al., Basic support for cooperative work on the World Wide Web, International Journal of Human-Computer Studies, Jun. 1997, Academic Press, UK, vol. 46, bo. 6, pp. 827-846, XP002175762, ISSN: 1071-5819, Downloaded from <http://citeseer.nj.nec.com/bentley97basic.html> on the Aug. 7, 2001, p. 833, line 5p. 834, line 6. DOI:10.1006/ijhc.1996.0108 10 | International Search Report dated Sep. 25, 2001 as received in PCT/US00/30099. | Tsuda I. et al., WorkWare: WWW-based chronological document organizer, Proceedings. 3rd Asia Pacific Computer Interaction 1998 Meeting, Shonan Village Center, Japan, Jul. 15-17, 1998, pp. 380-385, XP002175763, 1998, Los Alamitos, CA, USA, IEEE Comput. Soc, USA, ISBN: 0-8186-8347-3, p. 381, col. 2, line 14p. 382, col. 1, line 2. 9 | U.S. Appl. No. 10/415, 720, filed Jul. 26, 2007, Office Action. | U.S. Appl. No. 10/415, 720, filed Dec. 11, 2007, Office Action. | U.S. Appl. No. 10/415, 720, filed Jul. 25, 2008, Office Action. | U.S. Appl. No. 10/415, 720, filed Jan. 7, 2009, Office Action. | U.S. Appl. No. 10/415, 720, filed Jul. 9, 2009, Notice of Allowance. | U.S. Appl. No. 12/576, 883, filed Mar. 15, 2012, Office Action. | U.S. Appl. No. 12/576, 883, filed Jul. 31, 2012, Notice of Allowance. | 11 | US10346530B2 | US10719199B2 | US10761697B2 | US10990254B2 | US20150089379A1 | 5 | 2022-05-25 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 8TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1552); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY FEE PAYMENT YEAR 8 | 2021-12-20 AS ASSIGNMENT META PLATFORMS, INC., CALIFORNIA CHANGE OF NAME;ASSIGNOR:FACEBOOK, INC.;REEL/FRAME:058961/0436 2021-10-28 | 2018-06-14 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) FEE PAYMENT YEAR 4 | 2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE | 2013-07-16 AS ASSIGNMENT AMERICA ONLINE, INC., VIRGINIA ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:ESPINOZA, TONY;LAVOY, DEBRA;QUIGLEY, BEN;AND OTHERS;SIGNING DATES FROM 20030304 TO 20031105;REEL/FRAME:030809/0260 | 2013-07-16 AS ASSIGNMENT AOL INC., VIRGINIA ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:AOL LLC;REEL/FRAME:030809/0282 2009-12-04 | 2013-07-16 AS ASSIGNMENT AOL LLC, VIRGINIA CHANGE OF NAME;ASSIGNOR:AMERICA ONLINE, INC.;REEL/FRAME:030813/0482 2006-04-03 | 2013-07-16 AS ASSIGNMENT FACEBOOK, INC., CALIFORNIA ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:AOL INC.;REEL/FRAME:030809/0369 2012-06-14 | US8924860B2 | AU200115798A | US10719199B2 | US20100031163A1 | US20130173399A1 | US20150082185A1 | US20150089379A1 | US7627830B1 | US8327275B2 | WO2002037365A1 | 20020510WO2002037365A1 |
| 8 | US8920372B2 | Method and apparatus for heating solutions within intravenous lines to desired temperatures during infusion | US200116128A | 2001-12-17 | US200560765A | 2005-02-18 | B2 | 2014-12-30 | Faries Jr. Durward I.|Las Vegas, NV, US | Heymann Bruce R.|Vienna, VA, US | Blankenship Calvin|Frostburg, MD, US | Hendrix David|Ashburn, VA, US | Medical Solutions Inc.,Chantilly,VA,US | Faries Jr. Durward I.,Las Vegas,NV,US | Heymann Bruce R.,Vienna,VA,US | Blankenship Calvin,Frostburg,MD,US | Hendrix David,Ashburn,VA,US | MEDICAL SOLUTIONS INC | FARIES JR DURWARD I | HEYMANN BRUCE R | BLANKENSHIP CALVIN | HENDRIX DAVID | Q56 N | NaN | A61F000712 | A61M000544 | A61M000514 | A61M000544 | A61M00051415 | A61M220514 | A61M22053368 | A61M22053653 | 604114 | 392465 | 392467 | 392470 | 392481 | 604113 | NaN | An IV line temperature controlled warming device includes a housing and a fluid cassette or cartridge that receives fluid from an IV line and includes intravenous line tubing arranged in a preformed configuration. The configuration includes tubing sections arranged in generally circular and concentric portions and a central serpentine tubing section that basically reverses fluid flow and facilitates flow in opposing directions within adjacent tubing sections. The fluid cassette is retained within the device on a base plate partially disposed within a device housing interior, while a housing cover is selectively opened and closed to permit access to the base plate. The base plate includes a heater plate disposed thereon, while the cover and heater plate each include heating elements to apply heat to opposing surfaces of the tubing cassette. The heating elements are controlled by a controller in response to measured temperatures of the heater plate and fluid. | Method and apparatus for heating solutions within intravenous lines to desired temperatures during infusion | What is claimed is: \n1. A warming device for heating intravenous fluids to desired temperatures comprising: a housing member including a top surface and a housing member interior; a fluid cassette removably placeable on said housing member top surface to receive fluid from an intravenous fluid line, wherein said fluid cassette is removably connectable to said intravenous fluid line and includes an elongated portion of intravenous fluid line tubing with tubing sections secured to each to form a looped fluid flow path through said cassette; a cover member positionable relative to said housing member to selectively cover and provide access to said housing member top surface to enable insertion and removal of said fluid cassette within said device; a plurality of heating elements to heat said fluid cassette, wherein at least one of said heating elements is disposed within said housing member interior and at least one other of said heating elements includes a looped configuration and is disposed on said cover member to be coincident said looped fluid flow path, and wherein said heating elements are positioned to facilitate insertion of said cassette between at least two of the plurality of heating elements; at least one temperature sensor disposed within said housing member interior to measure at least one temperature; and a controller coupled to said at least one temperature sensor and said heating elements to control said heating elements in accordance with said at least one measured temperature.\n2. The warming device of claim 1, wherein said controller further enables said heating elements when said fluid cassette is placed within said device and disables said heating elements when said fluid cassette is absent from said device.\n3. The warming device of claim 1, wherein said cover member is pivotally secured to said housing member and said housing member includes: \nat least one of said heating elements in the form of a heater plate to heat said fluid cassette; and \na base plate including a receiving surface serving as said housing member top surface to receive and retain said heater plate and said fluid cassette within said device. \n4. The warming device of claim 3, wherein: \nsaid base plate further includes an electrically conductive post disposed on said receiving surface; \nsaid fluid cassette further includes an electrically conductive contact disposed around a portion of said fluid line tubing; \neach said cover member heating element includes a contact plate; and \nsaid controller controls said heating elements in response to said contact engaging said conductive post and said contact plate. \n5. The warming device of claim 1, wherein said fluid cassette includes inlet and outlet terminals disposed proximate each other.\n6. The warming device of claim 5, wherein said fluid cassette tubing includes an inlet tubing section including said inlet terminal and an outlet tubing section including said outlet terminal, and wherein said fluid cassette includes tubing sections extending adjacent each other in a spiral configuration to form an annular section of said tubing cassette with said inlet and outlet tubing sections extending tangentially from said annular section.\n7. The warming device of claim 6, wherein said annular section includes an intermediate section to direct fluid flow received from said inlet terminal in a reverse direction through said annular section tubing sections toward said outlet terminal.\n8. The warming device of claim 1, wherein said intravenous fluid line is connected to a pre-heated container of fluid and said device is positioned toward a patient infusion site, and wherein said controller controls said heating elements to heat said fluid to compensate for heat loss due to exposure of said intravenous line fluid to an ambient environment during infusion.\n9. The warming device of claim 1, wherein said fluid cassette tubing includes concentric tubing sections each defining a path for fluid flow in a particular direction, and wherein said fluid flow direction within each concentric tubing section is opposite to the fluid flow direction within a concentric tubing section adjacent that section.\n10. The warming device of claim 1, wherein said fluid cassette includes a fitting in fluid communication with said fluid line tubing to measure temperature of fluid flowing within said fluid cassette.\n11. The warming device of claim 10, wherein said fitting includes a thermally conductive member in direct contact with fluid flowing within said fitting, and said housing further includes: \na temperature sensing probe suitably dimensioned to extend within said fitting and releasably engage said thermally conductive member to measure temperature of said fluid flowing within said cassette. \n12. The warming device of claim 1, wherein said controller selectively enables and disables said heating elements in accordance with a comparison of said at least one measured temperature with a desired fluid temperature.\n13. The warming device of claim 12, wherein said controller includes at least one input device to facilitate entry of said desired fluid temperature.\n14. The warming device of claim 1, wherein said housing member includes at least one of said heating elements in the form of a heater plate to heat said fluid cassette, wherein said at least one temperature sensor includes a first sensor disposed proximate said heater plate to measure a temperature of said heater plate and a second sensor disposed proximate said fluid cassette to measure a temperature of fluid flowing therein, and wherein said controller selectively enables and disables said heating elements in accordance with a comparison of said measured temperatures with a desired fluid temperature.\n15. The warming device of claim 1 further including a heat controller to control said heating elements to attain a predetermined temperature, wherein said heat controller is selectively disabled by said controller in accordance with said at least one measured temperature.\n16. The warming device of claim 1 further including a pivotable mount securable to a support structure to receive and place said warming device in a desired position.\n17. The warming device of claim 1, wherein at least one of said housing member and cover member are transparent.\n18. The warming device of claim 1, wherein said plurality of heating elements includes a first type of heating element including a heater plate and a second different type of heating element including electrically conductive wiring.\n19. In a warming device including a housing member, a fluid cassette removably placeable on a housing member top surface, a cover member positionable relative to said housing member, a plurality of heating elements, at least one temperature sensor and a controller, a method of heating intravenous fluids to desired temperatures comprising: \n(a) receiving fluid within said cassette from an intravenous fluid line, wherein said fluid cassette is removably connectable to said intravenous fluid line and said cover member selectively covers and provides access to said housing member top surface to enable insertion and removal of said fluid cassette within said device, wherein said fluid cassette is disposed within said warming device between at least two of said heating elements and includes an elongated portion of intravenous fluid line tubing with tubing sections secured to each other form a looped fluid flow path through said cassette; \n(b) heating said fluid cassette within said warming device via said heating elements, wherein at least one of said heating elements is disposed within a housing member interior and at least one other of said heating elements includes a looped configuration and is disposed on said cover member to be coincident said looped fluid flow path; \n(c) measuring at least one temperature; and \n(d) controlling said heating elements in accordance with said at least one measured temperature. \n20. The method of claim 19, wherein step (d) further includes: \n(d.1) enabling said heating elements when said fluid cassette is placed within said device and disabling said heating elements when said fluid cassette is absent from said device. \n21. The method of claim 19, wherein said cover member is pivotally secured to said housing member and said housing member includes at least one of said heating elements in the form of a heater plate to heat said fluid cassette and a base plate including a receiving surface serving as said housing member top surface to receive and retain said heater plate and said fluid cassette within said device, and step (d) further includes: \n(d.1) controlling said cover member and heater plate heating elements in accordance with said at least one measured temperature to heat said fluid cassette. \n22. The method of claim 21, wherein said base plate further includes an electrically conductive post disposed on said receiving surface and said fluid cassette further includes an electrically conductive contact disposed around a portion of said fluid line tubing, wherein each said cover member heating element includes a contact plate, and step (d.1) further includes: \n(d.1.1) controlling said heating elements in response to said contact engaging said conductive post and said contact plate. \n23. The method of claim 19, wherein said fluid cassette includes inlet and outlet terminals disposed proximate each other, and step (a) further includes: \n(a.1) receiving fluid from said intravenous fluid line via said inlet terminal; and \nstep (d) further includes: \n(d.1) directing heated fluid from said fluid cassette to said intravenous line via said outlet terminal. \n24. The method of claim 23, wherein said fluid cassette tubing includes an inlet tubing section including said inlet terminal and an outlet tubing section including said outlet terminal, wherein said fluid cassette includes tubing sections extending adjacent each other in a spiral configuration to form an annular section of said tubing cassette with said inlet and outlet tubing sections extending tangentially from said annular section, wherein said annular section includes an intermediate section, and step (a.1) further includes: \n(a.1.1) directing fluid flow received from said inlet terminal in a reverse direction through said annular section tubing sections toward said outlet terminal via said intermediate section. \n25. The method of claim 19, wherein said intravenous fluid line is connected to a pre-heated container of fluid and said device is positioned toward a patient infusion site, and step (d) further includes: \n(d.1) controlling said heating elements to heat said fluid to compensate for heat loss due to exposure of said intravenous line fluid to an ambient environment during infusion. \n26. The method of claim 19, wherein said fluid cassette tubing includes concentric tubing sections each defining a path for fluid flow in a particular direction, and step (a) further includes: \n(a.1) directing fluid flow in a direction within each concentric tubing section that is opposite to the fluid flow direction within a concentric tubing section adjacent that section. \n27. The method of claim 19, wherein said fluid cassette includes a fitting in fluid communication with said fluid line tubing, and step (c) further includes: \n(c.1) measuring temperature of fluid flowing within said fluid cassette via said fitting. \n28. The method of claim 27, wherein said fitting includes a thermally conductive member in direct contact with fluid flowing within said fitting and said housing member includes a temperature sensing probe suitably dimensioned to extend within said fitting and releasably engage said thermally conductive member, and step (c.1) further includes: \n(c.1.1) measuring temperature of said fluid flowing within said cassette via said temperature sensing probe. \n29. The method of claim 19, wherein step (d) further includes: \n(d.1) selectively enabling and disabling said heating elements in accordance with a comparison of said at least one measured temperature with a desired fluid temperature. \n30. The method of claim 29, wherein said controller includes at least one input device, and step (d.1) further includes: \n(d.1.1) facilitating entry of said desired fluid temperature via said at least one input device. \n31. The method of claim 19, wherein said housing member includes at least one of said heating elements in the form of a heater plate to heat said fluid cassette, wherein said at least one temperature sensor includes a first sensor disposed proximate said heater plate and a second sensor disposed proximate said fluid cassette, and step (c) further includes: \n(c.1) measuring a temperature of said heater plate via said first sensor; and \n(c.2) measuring a temperature of fluid flowing within said fluid cassette via said second sensor; and \nstep (d) further includes: \n(d.1) selectively enabling and disabling said heating elements in accordance with a comparison of said measured temperatures with a desired fluid temperature. \n32. The method of claim 19, wherein said warming device further includes a heat controller, and step (d) further includes: \n(d.1) controlling said heating elements to attain a predetermined temperature via said heat controller, wherein said heat controller is selectively disabled by said controller in accordance with said at least one measured temperature. \n33. The method of claim 19, wherein said warming device further includes a pivotable mount securable to a support structure, and step (a) further includes: \n(a.1) receiving said warming device on said mount to facilitate placement of said warming device in a desired position. \n34. The method of claim 19, wherein at least one of said housing member and cover member are transparent.\n35. The method of claim 19, wherein said plurality of heating elements includes a first type of heating element including a heater plate and a second different type of heating element including electrically conductive wiring.\n36. A warming device for heating intravenous fluids to desired temperatures comprising: a housing member including a top surface and a housing member interior; fluid flow means removably placeable on said housing member top surface for receiving fluid from an intravenous fluid line, wherein said fluid flow means is removably connectable to said intravenous fluid line and includes an elongated portion of intravenous fluid line tubing with tubing sections secured to each other in said manipulated form to form a looped fluid flow path through said fluid flow means; cover means positionable relative to said housing member for selectively covering and providing access to said housing member top surface to enable insertion and removal of said fluid flow means within said device; a plurality of thermal means for heating said fluid flow means, wherein at least one of said thermal means is disposed within said housing member interior and at least one other of said thermal means includes a looped configuration and is disposed on said cover means to be coincident said looped fluid flow path, and wherein said thermal means are positioned to facilitate insertion of said fluid flow means between at least two of the plurality of thermal means; temperature means within said housing member interior for measuring at least one temperature; and control means coupled to said temperature means and said thermal means for controlling said thermal means in accordance with said at least one measured temperature.\n37. The warming device of claim 36, wherein said control means includes detection means for enabling said thermal means when said fluid flow means is placed within said device and disabling said thermal means when said fluid flow means is absent from said device.\n38. The warming device of claim 36, wherein said cover means is pivotally secured to said housing member and said housing member includes: \nat least one of said thermal means in the form of a heater plate for heating said fluid flow means; and \nbase means including a receiving surface serving as said housing member top surface for receiving and retaining said heater plate and said fluid flow means within said device. \n39. The warming device of claim 38, wherein: \nsaid base means further includes an electrically conductive post disposed on said receiving surface; \nsaid fluid flow means further includes an electrically conductive contact disposed around a portion of said fluid line tubing; \neach said thermal means of said cover means includes a contact plate; and \nsaid control means includes detection means for controlling said thermal means in response to said contact engaging said conductive post and said contact plate. \n40. The warming device of claim 36, wherein said fluid flow means includes inlet and outlet terminals disposed proximate each other.\n41. The warming device of claim 40, wherein said fluid flow means tubing includes an inlet tubing section including said inlet terminal and an outlet tubing section including said outlet terminal, wherein said fluid flow means includes tubing sections extending adjacent each other in a spiral configuration to form an annular section of said fluid flow means with said inlet and outlet tubing sections extending tangentially from said annular section.\n42. The warming device of claim 41, wherein said annular section includes an intermediate section to direct fluid flow received from said inlet terminal in a reverse direction through said annular section tubing sections toward said outlet terminal.\n43. The warming device of claim 36, wherein said fluid flow means tubing includes concentric tubing sections each defining a path for fluid flow in a particular direction, and wherein said fluid flow direction within each concentric tubing section is opposite to the fluid flow direction within a concentric tubing section adjacent that section.\n44. The warming device of claim 36, wherein said fluid flow means includes a fitting in fluid communication with said fluid line tubing to measure temperature of fluid flowing within said fluid flow means.\n45. The warming device of claim 36, wherein said control means includes power means for selectively enabling and disabling said plurality of thermal means in accordance with a comparison of said at least one measured temperature with a desired fluid temperature.\n46. The warming device of claim 36, wherein said housing member includes at least one of said thermal means in the form of a heater plate for heating said fluid flow means, wherein said temperature means includes first sensing means disposed proximate said heater plate for measuring a temperature of said heater plate and second sensing means disposed proximate said fluid flow means for measuring a temperature of fluid flowing therein, and wherein said control means includes power means for selectively enabling and disabling said thermal means in accordance with a comparison of said measured temperatures with a desired fluid temperature.\n47. The warming device of claim 36 further including heat control means for controlling said thermal means to attain a predetermined temperature, wherein said heat control means is selectively disabled by said control means in accordance with said at least one measured temperature.\n48. The warming device of claim 36, wherein at least one of said housing member and cover means are transparent.\n49. The warming device of claim 36, wherein said plurality of thermal means includes a first type of heating element including a heater plate and a second different type of heating element including electrically conductive wiring. | 49 | 1. A warming device for heating intravenous fluids to desired temperatures comprising: a housing member including a top surface and a housing member interior; a fluid cassette removably placeable on said housing member top surface to receive fluid from an intravenous fluid line, wherein said fluid cassette is removably connectable to said intravenous fluid line and includes an elongated portion of intravenous fluid line tubing with tubing sections secured to each to form a looped fluid flow path through said cassette; a cover member positionable relative to said housing member to selectively cover and provide access to said housing member top surface to enable insertion and removal of said fluid cassette within said device; a plurality of heating elements to heat said fluid cassette, wherein at least one of said heating elements is disposed within said housing member interior and at least one other of said heating elements includes a looped configuration and is disposed on said cover member to be coincident said looped fluid flow path, and wherein said heating elements are positioned to facilitate insertion of said cassette between at least two of the plurality of heating elements; at least one temperature sensor disposed within said housing member interior to measure at least one temperature; and a controller coupled to said at least one temperature sensor and said heating elements to control said heating elements in accordance with said at least one measured temperature. | 1. A warming device for heating intravenous fluids to desired temperatures comprising: a housing member including a top surface and a housing member interior; a fluid cassette removably placeable on said housing member top surface to receive fluid from an intravenous fluid line, wherein said fluid cassette is removably connectable to said intravenous fluid line and includes an elongated portion of intravenous fluid line tubing with tubing sections secured to each to form a looped fluid flow path through said cassette; a cover member positionable relative to said housing member to selectively cover and provide access to said housing member top surface to enable insertion and removal of said fluid cassette within said device; a plurality of heating elements to heat said fluid cassette, wherein at least one of said heating elements is disposed within said housing member interior and at least one other of said heating elements includes a looped configuration and is disposed on said cover member to be coincident said looped fluid flow path, and wherein said heating elements are positioned to facilitate insertion of said cassette between at least two of the plurality of heating elements; at least one temperature sensor disposed within said housing member interior to measure at least one temperature; and a controller coupled to said at least one temperature sensor and said heating elements to control said heating elements in accordance with said at least one measured temperature. | 19. In a warming device including a housing member, a fluid cassette removably placeable on a housing member top surface, a cover member positionable relative to said housing member, a plurality of heating elements, at least one temperature sensor and a controller, a method of heating intravenous fluids to desired temperatures comprising: (a) receiving fluid within said cassette from an intravenous fluid line, wherein said fluid cassette is removably connectable to said intravenous fluid line and said cover member selectively covers and provides access to said housing member top surface to enable insertion and removal of said fluid cassette within said device, wherein said fluid cassette is disposed within said warming device between at least two of said heating elements and includes an elongated portion of intravenous fluid line tubing with tubing sections secured to each other form a looped fluid flow path through said cassette; (b) heating said fluid cassette within said warming device via said heating elements, wherein at least one of said heating elements is disposed within a housing member interior and at least one other of said heating elements includes a looped configuration and is disposed on said cover member to be coincident said looped fluid flow path; (c) measuring at least one temperature; and (d) controlling said heating elements in accordance with said at least one measured temperature. | 36. A warming device for heating intravenous fluids to desired temperatures comprising: a housing member including a top surface and a housing member interior; fluid flow means removably placeable on said housing member top surface for receiving fluid from an intravenous fluid line, wherein said fluid flow means is removably connectable to said intravenous fluid line and includes an elongated portion of intravenous fluid line tubing with tubing sections secured to each other in said manipulated form to form a looped fluid flow path through said fluid flow means; cover means positionable relative to said housing member for selectively covering and providing access to said housing member top surface to enable insertion and removal of said fluid flow means within said device; a plurality of thermal means for heating said fluid flow means, wherein at least one of said thermal means is disposed within said housing member interior and at least one other of said thermal means includes a looped configuration and is disposed on said cover means to be coincident said looped fluid flow path, and wherein said thermal means are positioned to facilitate insertion of said fluid flow means between at least two of the plurality of thermal means; temperature means within said housing member interior for measuring at least one temperature; and control means coupled to said temperature means and said thermal means for controlling said thermal means in accordance with said at least one measured temperature. | CROSS-REFERENCE TO RELATED APPLICATIONS \n\nThis application is a divisional of U.S. patent application Ser. No. 10/016,128, entitled Method and Apparatus for Heating Solutions Within Intravenous Lines to Desired Temperatures During Infusion and filed Dec. 17, 2001 now U.S. Pat. No. 8,226,605, the disclosure of which is incorporated herein by reference in its entirety. \n\nBRIEF DESCRIPTION OF THE DRAWINGS \n\nFIG. 1 is a view in perspective of an IV line temperature controlled warming device including an IV tubing cassette or cartridge disposed therein according to the present invention.\n\nFIG. 2 is an exploded view in perspective of the warming device of FIG. 1.\n\nFIG. 3 is a view in perspective of a heating element for a cover of the warming device of FIG. 1.\n\nFIG. 4 is an exploded view in perspective of an outlet tubing portion of the cassette of FIG. 1 disposed on a device base plate and including a sensor fitting to measure temperature of fluid within the cassette.\n\nFIG. 5 is an electrical schematic diagram of an exemplary control circuit for the warming device of FIG. 1.\n\nFIG. 6 is a side view in perspective of a mount utilized to support a warming device according to the present invention.\n\nBACKGROUND OF THE INVENTION \n\n1. Technical Field \n\nThe present invention pertains to devices for warming intravenous (IV) solution during infusion into a patient. In particular, the present invention pertains to a device for receiving and heating a preformed IV tubing cassette or cartridge connected to an IV line to warm solution flowing within the line to a desired temperature during infusion into a patient. \n\n2. Discussion of Related Art \n\nIntravenous (IV) fluids are typically infused into a patient utilizing a liquid filled bag or container and an IV fluid line. The fluids are generally delivered from the container to the patient via gravitational forces and/or applied pressure. It is important in many situations that the temperature of the fluid within the IV line be maintained within a desirable and safe temperature range upon entering the patient body so as to eliminate any potential for thermal shock and injury to the patient. \n\nAccordingly, the related art provides several devices for controlling the temperature of fluid in an IV line for infusion into a patient. For example, U.S. Pat. No. 4,167,663 (Granzow, Jr. et al.) discloses a blood warming device including a housing with a heating compartment and an access door. The heating compartment includes a warming bag that is internally baffled to define a tortuous flow path and has an inlet port and an outlet port for allowing fluid to flow through the bag. The bag is sandwiched between a plate on the access door and an opposing plate within the heating compartment. The two plates include heating elements to heat the bag and the fluid flowing therein. The device further includes temperature sensors to measure the temperature of fluid flowing within the bag and control circuitry to control the heating elements in accordance with the measured temperatures. \n\nU.S. Pat. No. 4,356,383 (Dahlberg et al.) discloses a fluid heating apparatus including a box-shaped member having an enclosure member or cap, a conduit or bag disposed between the box-shaped member and cap and a pair of heating plates respectively connected to the box-shaped member and cap to abut opposing sides of the conduit and heat fluid flowing therethrough. A temperature sensing device is positioned for engaging the conduit at a predetermined location to sense the temperature of fluid within the conduit. The apparatus further includes a contact member to engage the conduit at a predetermined location for compressing the conduit to constrict the cross-sectional area of the flow passage when the flow rate of fluid is below a predetermined flow rate. \n\nU.S. Pat. No. 5,245,693 (Ford et al.) discloses an apparatus for heating parenteral fluids for intravenous delivery to a patient. The apparatus includes a disposable cassette which is made up of a unitary member divided to form a serpentine flow path by a plurality of path separators. Thin, flexible metallic foil membranes are sealingly joined to the unitary member on the upper and bottom surfaces thereof to form an enclosed, fluid-tight serpentine flow path between the plurality of path separators. The entire periphery of the unitary member and heat conductive foil membranes are sealingly held by a framework. The disposable cassette slides between first and second heating blocks which contact the heat conductive foil membranes so as to provide heat transfer to fluid flowing in the serpentine flow path. The heating blocks are designed to provide a gradation of heat energy where more heat is energy is available for transfer to the fluid at the inlet end of the serpentine flow path than that available for transfer to the fluid at the serpentine flow path outlet end. \n\nU.S. Pat. No. 5,381,510 (Ford et al.) discloses a disposable, in-line heating cassette and apparatus for raising the temperature of fluids. The cassette comprises a spacer defining a sinuous or serpentine flow pathway interposed between flexible foils and mounted on a frame. The frame comprises inlet and outlet tubes and related input and output parts which communicate with the serpentine path. Juxtaposed heating plates in direct contact with the cassette substantially contact the entire heating surface of the foils, thereby providing a thermal path from the heating plate to the foil and further to the fluid. The heating plates have several electrically conductive strips thereon for generating a gradation of heat energy where more heat energy is available for transfer at the inlet end than at the outlet end of the serpentine flow path. \n\nU.S. Pat. No. 6,175,688 (Cassidy et al.) discloses an intravenous fluid heater dimensioned to be wearable adjacent a patient intravenous fluid infusion situs. The heater includes a heat exchanger for defining a flow path through the heater for fluid to be infused via the infusion situs. At least one controllable heating element is provided for heating the fluid in the flow path by heat conduction thereto through the heat exchanger. Sensors are included for sensing respective temperatures of entering and exiting fluids of the flow path. A controller controls heating of the fluid in the flow path based on temperatures of the exiting fluids to cause the fluid in the flow path to be substantially uniformly heated to a desired infusion temperature prior to exiting the heater. \n\nU.S. Pat. No. 6,261,261 (Gordon) discloses an infrared heating device for prewarming solutions that includes a cassette having a predetermined length of tubing connectable between an IV solution source and an infusion site for a patient. An infrared energy-generating sheet is positioned onto the cassette adjacent the IV tubing. In one embodiment of the device, the IV tubing is arranged in a spiral path on the cassette. \n\nThe related art devices described above suffer from several disadvantages. In particular, the Granzow, Jr. et al., Dahlberg et al., Ford et al. and Cassidy et al. devices each generally employ housings that inhibit viewing of fluid during treatment. Thus, the fluid may incur certain undesirable conditions within the devices (e.g., contamination, air bubbles, etc.) that are beyond the view of, and may be undetected by, an operator, thereby risking serious injury to a patient. Further, these devices tend to employ heat exchangers generally with a serpentine fluid flow path defined therein that typically includes a plurality of overlapping fluid flow passageways. The path generally includes dimensions different than those of the fluid lines, thereby tending to affect the rate of fluid flow and, consequently, the amount of thermal energy required to heat the fluid to a desired temperature. As a result, the devices may need to further employ flow sensors to measure and account for changes in fluid flow in order to ensure maintenance of proper fluid temperature, thereby increasing system complexity and costs. Moreover, the overlapping passageways tend to confine thermal energy that may otherwise be distributed to heat the fluid, thereby limiting the device heating potential. The Gordon device utilizes a cassette with a fluid flow path formed of tubing. However, this device employs infrared radiation to thermally treat the fluid, thereby involving special safety measures and requiring additional components to isolate the radiation from the patient. In addition, the above-described systems of the related art include heat exchangers or fluid flow paths including inlets separated from fluid outlets, thereby tending to increase complexity of connections and installation for use with an infusion apparatus. \n\nOBJECTS AND SUMMARY OF THE INVENTION \n\nAccordingly, it is an object of the present invention to warm solution within an IV line during infusion by heating a preformed IV tubing cassette or cartridge connected to and receiving solution from the IV line. \n\nIt is another object of the present invention to uniformly heat an IV tubing cassette or cartridge containing solution from an IV line by simultaneously heating opposing cassette surfaces. \n\nYet another object of the present invention is to disable operation of an IV solution warming device in response to detecting the absence of a cassette within that device. \n\nStill another object of the present invention is to configure an IV tubing cassette or cartridge to occupy a minimal amount of warming device housing space, while providing sufficient residence time for fluid to be heated to a desired temperature within the device. \n\nA further object of the present invention is to thermally treat a warming device IV tubing cassette or cartridge containing fluid, while enabling viewing of the fluid within the device. \n\nYet another object of the present invention is to heat IV solution with a warming device employing an IV cassette or cartridge including tubing arranged to form concentric passages that alternately direct IV solution flow in opposing directions to enhance thermal transfer between the passages during solution warming. \n\nThe aforesaid objects may be achieved individually and/or in combination, and it is not intended that the present invention be construed as requiring two or more of the objects to be combined unless expressly required by the claims attached hereto. \n\nAccording to the present invention, an IV line temperature controlled warming device includes a housing and a fluid cassette or cartridge that receives fluid from an IV line and includes intravenous line tubing arranged in a preformed configuration to enable the IV line fluid to flow therethrough. The preformed configuration includes tubing sections arranged in generally circular and concentric portions and a central serpentine tubing section that includes a generally S-shaped configuration. The serpentine section basically reverses fluid flow and facilitates flow in opposing directions within adjacent tubing sections. The fluid cassette is retained within the device on a base plate partially disposed within a device housing interior, while a housing cover is selectively opened and closed to permit access to the base plate. The base plate includes a heater plate disposed thereon, while the cover and heater plate each include heating elements to apply heat to opposing surfaces of the tubing cassette. The heating elements are controlled by a controller in response to measured temperatures of the heater plate and fluid. In addition, the device includes various safeguards that ensure device operation during appropriate conditions (e.g., appropriate temperatures, proper placement of a compatible cassette within the device, etc.). \n\nThe above and still further objects, features and advantages of the present invention will become apparent upon consideration of the following detailed description of specific embodiments thereof, particularly when taken in conjunction with the accompanying drawings, wherein like reference numerals in the various figures are utilized to designate like components. \n\nDETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS \n\nAn IV line temperature controlled warming device for heating and maintaining fluids flowing within an IV fluid line at desired temperatures is illustrated in FIG. 1. Specifically, warming device 2 includes a housing 10 with a lid or cover 22 pivotally attached thereto. The warming device receives a tubing cassette or cartridge 50 that is typically connected to an intravenous line (IV) supplying intravenous solution from an IV solution bag or container to a patient. The device housing includes a base plate 30 to receive cassette 50 and a heater plate 42 disposed on the base plate beneath the cassette to heat a cassette bottom surface as described below. An additional heater or heating element 25 is disposed on cover 22 to heat the cassette top surface as described below. Thus, the cassette is disposed between the heater plate and cover heating elements to receive heat on opposing cassette surfaces for uniform heating of solution or other fluid flowing therein. A controller 62 is partially disposed within the housing to enable entry of desired solution temperatures and to control device operation as described below. The warming device may be oriented in a variety of positions (e.g., horizontally, vertically, etc.) and may be mounted to or supported by various structures (e.g., a patient arm or other body portion, swing arm, arm board, bed, bed rail, operating room or other table, IV pole, wall, floor, posts, etc.). The warming device is preferably positioned in close proximity to an infusion site of a patient in order to heat IV fluid (e.g., may heat fluid with or without skin contact), and may be portable for use in various locations. The warming device may be utilized for operating room, pre-op and/or post-op procedures or at any other times where infusion is being performed. In addition, a pre-heated IV solution bag or container may be used in conjunction with the warming device. In this case, the device is typically disposed at or near the patient infusion site and basically heats the fluid to compensate for heat loss during infusion due to exposure of the fluid to the ambient environment.\n\nReferring to FIGS. 2-4, housing 10 includes front and rear walls 12, 14, side walls 16, 18 and a bottom wall 20. Side walls 16, 18 are attached to and extend between front and rear walls 12, 14, while bottom wall 20 is attached to the bottom edges of the front, rear and side walls. The housing walls are substantially rectangular and collectively define a housing interior with an open top portion. It is to be understood that the terms top, bottom, side, front, rear, horizontal, vertical, upper, lower, up, down, height, length, width, depth and the like are used herein merely to describe points of reference and do not limit the present invention to any specific orientation or configuration. Front wall 12 includes a substantially rectangular opening 13 defined therein for receiving controller 62. The controller is disposed through the front wall and partially within the housing interior. The housing may be constructed of any suitable rigid material (e.g., plastic), and is preferably constructed of a substantially transparent material to permit viewing of the fluid within the cassette, especially during heating. This enables an operator to detect various conditions (e.g., contamination, air bubbles, etc.) that may cause injury to a patient. The housing basically houses the device electrical components and supports the base plate as described below.\n\nBase plate 30 has a generally rectangular configuration and includes a lower portion 31 that is suitably dimensioned to fit within the housing open top portion. The base plate is constructed of a suitably rigid material (e.g., an acrylic resin) to receive and retain the heater plate and tubing cassette thereon as described below. The base plate is preferably transparent to enable viewing of intravenous fluid flowing within the cassette as described above. An upper portion 32 of the base plate has dimensions greater than those of lower portion 31 to permit the base plate to rest on the upper edges of the housing front, rear and side walls with the base plate lower portion slightly extending within the housing interior. An upper surface 34 of the base plate includes a generally annular recess or groove 36 defined therein. The groove basically forms a substantially circular engagement section 39 on the base plate upper surface within an area defined by a groove inner diameter or dimension. A channel 37 extends tangentially from a circumferential edge of the annular groove to a base plate front edge. Channel 37 includes an opening 75 for receiving a device temperature probe and a cassette temperature sensing fitting to measure temperature of fluid within the cassette as described below. A serpentine channel 38 including a generally S-shaped configuration is defined within section 39 and facilitates proper alignment of cassette 50 within the device for temperature heating and measurement of fluid as described below. The ends of channel 38 emerge from section 39 to communicate with annular groove 36. A post 40 is disposed at the approximate center of channel 38 and is typically constructed of an electrically conductive material (e.g., copper). The post facilitates formation of a conductive path to enable device operation as described below.\n\nHeater plate 42 includes a configuration compatible with the upper surface of base plate 30. Specifically, heater plate 42 includes a generally annular portion 43 with an elongated and generally rectangular projection 44 extending tangentially from an annular portion circumferential edge. The heater plate is preferably flat, but may include a grooved surface to receive cassette tubing sections or to form fluid flow paths to enable use of the device without the cassette. Channel projections 46 extend from the inner edge of the annular portion and are angularly spaced by approximately one-hundred eighty degrees. The channel projections are suitably configured and dimensioned to occupy initial portions of channel 38 of base plate 30 while permitting conductive post 40 to be exposed. Heater plate 42 includes a conventional or other heating element 80 (FIG. 5) disposed on the underside of the heater plate. The heating element is preferably in form of a conventional etched silicon rubber heating pad or other heater affixed to the heater plate underside by a pressure sensitive adhesive. Alternatively, the heating element may be contoured to a heater plate grooved surface or be attached to the flat surface via any conventional fastening techniques (e.g., adhesives, etc.). The heating element heats the heater plate and is coupled to a warming device control circuit to control heating of the cassette as described below. Heater plate annular portion 43 and projections 44, 46 are disposed within groove 36 and channels 37, 38 of the base plate, respectively, to enable the heater plate to heat an engaging surface of a tubing cassette placed thereon. The heater plate may be constructed of any thermally conductive materials.\n\nCassette 50 includes a configuration compatible with the base plate to facilitate placement of the cassette within the warming device. Specifically, the cassette includes an inlet portion 52, an outlet portion 54 adjacent the inlet portion and a cassette body 57 defining a fluid flow path. The cassette body includes tubing sections 59, preferably transparent, arranged in generally circular and concentric sections 65, 67. A central serpentine tubing section 56 includes a generally S-shaped configuration that basically reverses fluid flow and facilitates flow in opposing directions within adjacent concentric tubing sections 65, 67. In other words, fluid enters the cassette via inlet portion 52 and flows through concentric sections 65 toward central serpentine tubing section 56. The serpentine section receives fluid from an innermost tubing section 65 and directs the fluid to flow in concentric sections 67 toward outlet portion 54. Thus, fluid flows in concentric sections 65 in a direction opposite to that of fluid flow in adjacent sections 67. The concentric tubing sections are in close proximity to each other to enable thermal transfer between adjacent sections. The cassette may include any quantity of tubing sections to produce a residence time within the warming device sufficient to heat the fluid. The concentric tubing sections may be spaced a slight distance from each other or be positioned to contact adjacent sections, while the tubing may be manipulated to form and maintain a cassette configuration via any conventional techniques or manufacturing processes (e.g., molded, glued, etc.). The serpentine tubing section facilitates alternate or opposing fluid flow directions (e.g., without utilizing overlapping or serpentine type configurations) and proper alignment of the cassette within the base plate as described below. However, the cassette may include any configuration reversing fluid flow direction, and may include overlapping or non-overlapping tubing sections. The cassette inlet, outlet and body may be constructed of a flexible plastic (e.g., polyvinyl chloride (PVC)) or any other material suitable for IV fluid line applications.\n\nInlet and outlet tubing portions 52, 54 are adjacent each other and extend tangentially from a circumferential edge of body 57. These tubing portions further include dimensions suitable for being received and retained within base plate channel 37. The inlet and outlet tubing portions terminate at respective inlet and outlet terminals 53, 55 that extend externally of the device housing when the cassette is received and retained within the base plate annular groove and channels. The inlet and outlet terminals include suitable connectors (e.g., Luer locks) to connect inlet and outlet tubing portions 52, 54 to any selected portions of an IV line. Serpentine tubing section 56 has dimensions sufficient to be retained within base plate channel 38 and basically facilitates appropriate alignment of the cassette within the base plate for heating and temperature measurement of the fluid. A contact 60 is disposed around a substantially central portion of serpentine tubing section 56. The contact is preferably constructed of an electrically conductive material (e.g., copper), and may be in any desired form (e.g., a metallic band, wrap, rod, fluid, etc.). The base plate configuration enables cassette contact 60 to contact conductive post 40 and a contact 26 of cover heating element 25 when the tubing cassette is placed within the base plate groove and channels and the cover is in a closed state. The post and contacts basically serve to form or complete an electrical path or circuit to enable device operation in response to proper placement of a compatible cassette within the device. The warming device may alternatively employ contacts or conductive members disposed on any device components at any locations to form an electrical path through a pressure switch that senses closure of the device on the cassette for proper operation. The pressure switch may further include a dual element sensor to measure fluid temperatures within the cassette inlet and outlet portions.\n\nA sheet or backing 61 may be attached to the cassette top and/or bottom surface to secure the tubing arrangement thereon. The sheet may include an annular configuration similar to that of cassette 50, and may include tabs 63 disposed on the sheet at any desired locations to facilitate manipulation of the cassette relative to the warming device (e.g., facilitate insertion and removal of the cassette within the warming device). The warming device may accommodate any quantity of cassettes, while the cassette may include any quantity of preformed tubing to form a plural level or layer cassette. In other words, the cassette may include any quantity of tubing sections disposed on any quantity of planes (e.g., stacked one above the other, etc.). This tends to provide additional residence or heating time for fluid within the cassette. The fluid flow path through the cassette may be formed in any manner, and may be defined by any structures (e.g., tubing, sealed channels, pools, chambers, etc.).\n\nFlow of IV fluid through cassette 50 is described. Basically, fluid from an IV line enters the cassette at inlet terminal 53 and is directed in a winding pattern through concentric tubing sections 65 toward serpentine section 56. Upon reaching tubing section 56, the fluid is directed in an opposing direction through concentric tubing sections 67 toward outlet portion 54 to exit the cassette at outlet terminal 55 and return to the IV line or be directed to a desired location (e.g., an infusion site). In essence, fluid flowing within the cassette travels in opposing directions within adjacent concentric tubing sections of the cassette body. The flow pattern defined by the tubing cassette provides a greater residence time for fluid within the cassette, thereby extending the exposure of the fluid to heating elements within the device housing. Further, the flow pattern enhances heat exchange between adjacent tubing sections 65, 67 that contain fluid exposed to the heating elements for different intervals (e.g., fluid flowing within sections 67 toward outlet portion 54 has a greater residence time than fluid flowing in adjacent tubing sections 65 toward serpentine section 56). It is to be understood that the designation of portion 52 as the inlet portion and portion 54 as the outlet portion is for illustrative purposes only, since either portion may serve as an inlet or outlet portion depending upon the manner in which the terminals of the tubing cassette are connected to an IV line.\n\nCover or lid 22 is generally rectangular and pivotally connected to an upper edge of rear wall 14 to selectively control access to the housing. The cover includes an open bottom portion and is configured to receive and cover upper portion 32 of base plate 30. The cover may be connected in any suitable manner to the housing rear wall via any fastening devices (e.g., hinges, brackets, etc.), and may include a handle (not shown) or any other suitable device or structure to facilitate pivoting of the cover with respect to the housing. The cover may alternatively be connected to any of the housing walls or base plate, and may be constructed of any suitable materials (e.g., an acrylic resin). However, the cover is preferably constructed of a transparent material to enable viewing of intravenous fluid flowing within the tubing cassette as described above. A latching or locking mechanism (not shown) may be disposed on the cover and/or housing to secure the cover in a closed state and press the cover against the cassette to enhance contact between the cassette top and bottom surfaces and the cover heating element and heater plate, respectively.\n\nThe cover includes heating element 25 (FIG. 3) to apply heat to the cassette top surface. Specifically, heating element 25 is disposed on a cover interior surface in facing relation with the heater plate. The heating element is preferably implemented by a clear or transparent acrylic heater including a sheet 27 with electrically conductive wiring 24 embedded therein. The transparent heating element enables viewing of the fluid flowing within the cassette as described above. Wiring 24 is arranged within sheet 27 and, hence, on the cover to coincide with the tubing cassette received on the base plate. The configuration of the electrical wiring basically includes a generally annular body portion 29 with a tangentially extending section 33. These sections basically outline and are disposed coincident the corresponding body and inlet and outlet portions of the cassette to apply heat to those cassette sections. Contact 26 (e.g., an electrically conductive plate) is disposed on sheet 27 within the confines of wiring body portion 29 and facilitates formation of an electrical path from the cover heating element contact through cassette contact 60 to the base plate conductive post to enable device operation as described below. Wiring 24 further includes connection terminals 28 disposed toward a circumferential edge of wiring body portion 29 to connect the heating element to a device control circuit as described below.\n\nIn order to measure temperature of fluid within cassette 50, a fitting 90 is disposed within outlet portion 54 at a location toward outlet terminal 55. Fitting 90 (FIG. 4) includes a substantially cylindrical base portion 92 and a generally cylindrical projection 94 extending transversely relative to the cassette tubing from an intermediate section of the base portion. The base portion includes open ends 95 and a longitudinal channel defined therethrough to permit fluid flow through the base portion. The open ends are securable to outlet portion 54. Projection 94 similarly includes open ends and facilitates access to the base portion channel. Fitting 90 typically includes a T-type configuration, however, any configuration (e.g., a Y-type fitting, cross fitting, coupling, etc.) may be utilized. Each base portion open end 95 may be secured to the outlet portion via any suitable connector, while the fitting is typically disposable with the cassette after each use to maintain fluid sterility. The fitting may be constructed of plastic or any other rigid material suitable for use with IV lines. A thermally conductive receptacle 96 is secured within projection 94 and extends partially within base portion 92 for contacting fluid flowing within the base portion channel. Receptacle 96 may be constructed of stainless steel or any other material having suitable thermal conductivity, and may be secured within the projection via any suitable securing techniques (e.g., friction fit, adhesives, etc.). The receptacle includes a generally cylindrical body with a closed distal end that extends partially within the base portion and an open proximal end for receiving a temperature probe or sensor 98 as described below. A flange extends radially from the open proximal end of the receptacle to engage an interior surface of the projection. The receptacle includes dimensions sufficient to provide a fluid tight seal between the projection and base portion channel to maintain fluid within the channel.\n\nTemperature probe 98 is disposed within the device housing and extends through opening 75 defined in the base plate to be removably inserted within the receptacle when the cassette is placed on the base plate. The distal end of the probe is disposed in contact with the receptacle closed end, while the probe may be secured within the receptacle via friction fit, a locking or securing mechanism or any other securing techniques. Cassette 50 is placed on the heater plate with projection 94 inserted within the base plate opening 75 to enable the probe to engage the receptacle. Sensor wiring (not shown) connects the probe to controller 62 (FIG. 2) to provide a fluid temperature for controlling system operation. The receptacle is typically sterile and permits re-use of temperature probe 98 with subsequent cassettes to maintain sterility. The temperature probe may be implemented by any conventional or other temperature sensor (e.g., RTD, IR, NTC, thermistor, thermocouple, etc.). The fitting may be substantia... | Medical Solutions Inc.,Chantilly,VA,US | Faries Jr. Durward I.,Las Vegas,NV,US | Heymann Bruce R.,Vienna,VA,US | Blankenship Calvin,Frostburg,MD,US | Hendrix David,Ashburn,VA,US | Medical Solutions Inc. | Faries Jr. Durward I. | Heymann Bruce R. | Blankenship Calvin | Hendrix David | MEDICAL SOLUTIONS INC | MEDICAL SOLUTIONS INC | Faries, Jr., Durward I. | Heymann, Bruce R. | Blankenship, Calvin | Hendrix, David | 4 | Edell, Shapiro & Finnan, LLC | NaN | Bosques, Edelmira | US | Alive | 12 | 2014 | US | 2 | 2005 | 2001-12-17 | 2001 | A61 | A61 | 604114 | 604113 | 392481 | 392465 | 392467 | 392470 | US4476877A | US20070106243A1 | US6158458A | US5572873A | US20030222933A1 | US6736788B1 | US4498901A | US3500366A | US4336435A | US6553336B1 | US4680977A | US20040170409A1 | US5986239A | US20060253075A1 | US4533350A | US1770832A | US3614385A | US4038519A | US4090514A | US4329569A | US4375813A | US4705505A | US4772778A | US4808159A | US5081697A | US5108372A | US5169389A | US5250032A | US5282264A | US5381510A | US5411482A | US5531698A | US5649910A | US5658252A | US5713864A | US5876370A | US5935106A | US5961492A | US6062429A | US6860271B2 | US7262698B1 | US7608460B2 | US7611504B1 | US20030000939A1 | US20080058697A1 | US6221045B1 | US6869538B2 | US5707151A | US4430077A | US5816797A | US4397648A | US6045648A | US4934152A | US4532414A | US6850252B1 | US558979A | US1110919A | US1794215A | US2063902A | US2204764A | US2910981A | US3140716A | US3247851A | US3475590A | US3553426A | US3629552A | US4481410A | US4614514A | US4673820A | US4678460A | US4756299A | US4801777A | US4967061A | US5019047A | US5184613A | US5279598A | US5296684A | US5306896A | US5662611A | US5669877A | US5681284A | US5690614A | US5772409A | US5773795A | US5806528A | US5891096A | US6039926A | US6142974A | US6146359A | US6371121B1 | US6480257B2 | US7238171B2 | US7671302B1 | US8444599B2 | US20100111135A1 | US20100222763A1 | DE3709122A1 | GB2029677A | JP58030666A | WO1999022786A1 | WO1999058177A1 | US4718896A | US3596515A | US5609784A | US4586691A | US5494196A | US2990875A | US6221051B1 | US20030216831A1 | US5245693A | US5590648A | US5186057A | US522866A | US1092643A | US1493450A | US1847954A | US2124293A | US2470481A | US3640277A | US3908652A | US4098123A | US4138890A | US4187847A | US4407133A | US4709135A | US4735609A | US4747826A | US4804367A | US4844074A | US4847470A | US4994021A | US5040380A | US5103817A | US5153827A | US5263323A | US5297234A | US5392025A | US5485408A | US5531697A | US5683381A | US5788669A | US5840068A | US5879143A | US5919218A | US6129702A | US6139528A | US6967575B1 | US8636691B2 | US20020147426A1 | US20030004470A1 | US20070142773A1 | US20080021392A1 | US20080205481A1 | US20120053518A1 | US20140236615A1 | US20050070845A1 | US4844397A | US3563090A | US6641556B1 | US5805455A | US4063551A | US4628186A | US6524239B1 | US4572536A | US5875282A | US675647A | US1062111A | US1847573A | US4309592A | US4430078A | US4495402A | US4522308A | US4523078A | US4543095A | US4647756A | US4657004A | US4680445A | US4684367A | US4759749A | US4859360A | US4906816A | US4934336A | US5073167A | US5090617A | US5125900A | US5195976A | US5205820A | US5243833A | US5261875A | US5263929A | US5318540A | US5364371A | US5370674A | US5399166A | US5420962A | US5567119A | US5567136A | US5584811A | US5658250A | US5743878A | US5807332A | US5829880A | US5879329A | US5893843A | US5961700A | US6024539A | US6175688B1 | US6236809B1 | US6660974B2 | US6722782B2 | US6768085B2 | US7176030B2 | US8313462B2 | US8789534B2 | WO1999026690A1 | US20020151854A1 | US4634432A | US4936828A | US5399007A | US3157727A | US20030135388A1 | US5290222A | US6824528B1 | US6740059B2 | US4432761A | US6248077B1 | US1223274A | US1390500A | US1726212A | US1982213A | US1995302A | US2254994A | US3485245A | US3526134A | US3551641A | US3636767A | US3651695A | US4121574A | US4356383A | US4551136A | US4552277A | US4682979A | US4781548A | US4832689A | US4883117A | US5013889A | US5042455A | US5061241A | US5063994A | US5129033A | US5180896A | US5261411A | US5338157A | US5348539A | US5417274A | US5474538A | US5540561A | US5564915A | US5707431A | US5729653A | US5755275A | US5788671A | US5810771A | US5935099A | US5954485A | US6035102A | US6096007A | US6315767B1 | US6464666B1 | US6649040B1 | US6788997B1 | US8734404B2 | US8734405B2 | US8821011B2 | US20070215018A1 | US20080147016A1 | US20100168671A1 | US20100222762A1 | GB2274514A | WO1998038953A1 | US4509943A | US20060020255A1 | US5733263A | US5961866A | US6316750B1 | US1479451A | US5954700A | US6641602B2 | US20060100578A1 | US6334707B1 | US20020041621A1 | US4529309A | US803352A | US1960417A | US4009615A | US4167663A | US4293762A | US4384578A | US4464563A | US4745248A | US4878537A | US4923681A | US5059182A | US5241951A | US5243172A | US5254094A | US5308335A | US5397875A | US5408577A | US5451209A | US5492534A | US5512043A | US5514095A | USRE35501E1 | US5928196A | US6467953B1 | US6566631B2 | US6788885B2 | US7417205B2 | US7540864B2 | US20020158058A1 | US20040189258A1 | US20050142013A1 | US20120191050A1 | JP2000300666A | WO1990015313A1 | US6748164B1 | US5862672A | US4823833A | US6607027B2 | US6254572B1 | US3940742A | US3591290A | US4585441A | US4904848A | US2701789A | US5720728A | US20070000910A1 | US5744806A | US20010009610A1 | US4674977A | US6261261B1 | US5989238A | US1987119A | US3612059A | US3845661A | US4490884A | US4613327A | US4651813A | US4707587A | US4874359A | US4991976A | US5075167A | US5096822A | US5097898A | US5125069A | US5164161A | US5279558A | US5330431A | US5342313A | US5364385A | US5389078A | US5423759A | US5433704A | US5538399A | US5647854A | US5658478A | US5695473A | US5824000A | US6174300B1 | US7090658B2 | US7726876B2 | US7740611B2 | US7942851B2 | US8226293B2 | US8487738B2 | US20050059952A1 | US20070161952A1 | US20120285236A1 | US20130197437A1 | US20140231406A1 | WO1992021272A1 | WO1994002189A1 | US2880764A | US5074658A | US4314484A | US3293868A | US4747450A | US20050222933A1 | US5269749A | US5096078A | US6117122A | US7031778B2 | US20020081109A1 | US4625086A | US785524A | US1838026A | US2087586A | US2766907A | US3370153A | US3590215A | US3801278A | US3895741A | US4531941A | US4626243A | US4782212A | US4874033A | US4900308A | US5061630A | US5106373A | US5211631A | US5232439A | US5290230A | US5408576A | US5411480A | US5424512A | US5823746A | US6384380B1 | US7031602B2 | US7041941B2 | US7276675B2 | US8226605B2 | US20020156451A1 | US20050242930A1 | FR2786057A1 | WO1998045658A1 | 426 | Health Devices, vol. 25, No. 10, Oct. 1996. | Minco Products, Inc. Bulletin CTI98, 1996. | Eurotherm Controls, Inc. Model 2116 Temperature Controller, 1997. | Ellenwood, Drop Detector, IBM Technical Bulletin, vol. 12, No. 5, Oct. 1969. | CBi Medical, Inc., IV Fluid Warmer Model 8362, 1992. | 5 | US10281215B2 | US20150024330A1 | US9119912B2 | US9211381B2 | US9492624B2 | US9656029B2 | US9764100B2 | US9851151B2 | 8 | 2022-06-30 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 8TH YR, SMALL ENTITY (ORIGINAL EVENT CODE: M2552); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY FEE PAYMENT YEAR 8 | 2019-02-26 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE | 2019-02-26 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YR, SMALL ENTITY (ORIGINAL EVENT CODE: M2551); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY FEE PAYMENT YEAR 4 | 2019-02-26 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - 2018-12-30 | 2019-02-26 FEPP FEE PAYMENT PROCEDURE PETITION RELATED TO MAINTENANCE FEES GRANTED (ORIGINAL EVENT CODE: PMFG); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY | 2019-02-26 FEPP FEE PAYMENT PROCEDURE SURCHARGE, PETITION TO ACCEPT PYMT AFTER EXP, UNINTENTIONAL. (ORIGINAL EVENT CODE: M2558); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY | 2019-02-26 FEPP FEE PAYMENT PROCEDURE PETITION RELATED TO MAINTENANCE FEES FILED (ORIGINAL EVENT CODE: PMFP); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY | 2019-02-25 PRDP PATENT REINSTATED DUE TO THE ACCEPTANCE OF A LATE MAINTENANCE FEE + 2019-02-26 | 2019-02-04 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY | 2018-08-13 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY | US8920372B2 | AU2002366329A1 | US20030114795A1 | US20050142013A1 | US20120053518A1 | US8226605B2 | US9492624B2 | WO2003051437A1 | 20030619US20030114795A1 |
| 9 | US8921332B2 | Chromosomal modification involving the induction of double-stranded DNA cleavage and homologous recombination at the cleavage site | US1999118669P | WO2000US3014A | US2001917295A | US2003337229A | US2006636397A | US2009607502A | 1999-02-03 | 2000-02-03 | 2001-07-27 | 2003-01-06 | 2006-12-08 | 2009-10-28 | US13417969A | 2012-03-12 | B2 | 2014-12-30 | Choulika André|Paris, FR | Mulligan Richard C.|Lincoln, MA, US | Children's Medical Center Corporation,Boston,MA,US | Institut Pasteur,Paris,FR | Choulika André,Paris,FR | Mulligan Richard C.,Lincoln,MA,US | CHILDREN'S MEDICAL CENTER CORPORATION | B04 C | C06 C | D16 C | B04-E01 | B04-E03E | B04-F0100E | B04-L05A | B11-C08E4 | B12-K04A | B12-K04F | B14-S03 | C04-E01 | C04-E03E | C04-F0100E | C04-L05A | C11-C08E4 | C12-K04A | C12-K04F | C14-S03 | D05-A02C | D05-C03C | D05-H12A | D05-H14 | D05-H17A3 | A61K004800 | C12N001509 | A61K00317088 | A61K003847 | A61P004300 | C07H002104 | C12N000510 | C12N000922 | C12N001500 | C12N001590 | C12N0015907 | A61P004300 | C12N000922 | C12N0015902 | A61K004800 | C07K231900 | C07K231903 | C12N280080 | 514044R | 42409461 | 43500618 | 4353201 | 5360231 | 5360232 | 5360234 | NaN | Methods of modifying, repairing, attenuating and inactivating a gene or other chromosomal DNA in a cell are disclosed. Also disclosed are methods of treating or prophylaxis of a genetic disease in an individual in need thereof. Further disclosed are chimeric restriction endonucleases. | Chromosomal modification involving the induction of double-stranded DNA cleavage and homologous recombination at the cleavage site | What is claimed is: \n1. A method of modifying a specific sequence in chromosomal DNA of a cell in vitro comprising: \ninducing in the cell double stranded cleavage of chromosomal DNA at a genomic site of interest in the specific sequence to be modified, wherein the inducing comprises contacting the genomic site of interest with a chimeric restriction endonuclease, said chimeric restriction endonuclease comprising a DNA binding sequence and a DNA cleavage domain, and said restriction endonuclease recognizing a DNA sequence of at least 12 bp, wherein said restriction endonuclease is introduced as a protein or is encoded by a nucleic acid vector that is expressed; and \ncontacting said cell with a targeting DNA or a nucleic acid vector encoding said targeting DNA in an amount sufficient to produce recombination between said targeting DNA and said chromosomal DNA at the site of interest, wherein said targeting DNA comprises (1) DNA homologous to the region surrounding the genomic site of interest and (2) DNA which modifies the specific sequence upon recombination between said targeting DNA and said chromosomal DNA, \nthereby modifying the specific sequence in the chromosomal DNA of the cell. \n2. The method of claim 1, wherein said restriction endonuclease recognizes a DNA sequence of at least 18 bp.\n3. The method of claim 1, wherein the DNA binding sequence of said chimeric endonuclease is a zinc finger binding domain.\n4. The method of claim 1, wherein the DNA binding sequence of said chimeric endonuclease is a meganuclease recognition site.\n5. The method of claim 1, wherein the DNA binding sequence of said chimeric endonuclease is a meganuclease recognition site from I-SceI.\n6. The method of claim 1, wherein the DNA cleavage domain is a restriction endonuclease cleavage domain.\n7. The method of claim 1, wherein said cell is a bacterial cell.\n8. The method of claim 1, wherein said cell is a mammalian cell.\n9. The method of claim 1, wherein said cell is a plant cell.\n10. The method of claim 9, further comprising a step of producing a transgenic plant from said cell.\n11. The method of claim 1, wherein said cell is a stem cell.\n12. The method of claim 11, further comprising a step of producing a transgenic animal from said cell.\n13. The method of claim 1, wherein said cell is a blood cell.\n14. The method of claim 1, wherein said cell is a T-cell.\n15. The method of claim 1, wherein said cell is a human cell.\n16. The method of claim 1, further comprising a step of producing recombinant molecules from said cell.\n17. The method of claim 1, wherein said chimeric endonuclease and/or targeting DNA are introduced into the cell using a nucleic acid vector.\n18. The method of claim 17, wherein said nucleic acid vector is a RNA molecule.\n19. The method of claim 17, wherein said nucleic acid vector is a viral vector.\n20. The method of claim 1, wherein the specific sequence of interest is a mutation.\n21. The method of claim 1, wherein said targeting DNA attenuates or inactivates a chromosomal gene of interest.\n22. The method of claim 1, wherein said targeting DNA introduces a mutation into said genomic site of interest.\n23. The method of claim 1, wherein said targeting DNA introduces a reporter gene into said genomic site of interest.\n24. The method of claim 1, wherein said targeting DNA introduces an expression cassette into said genomic site of interest.\n25. The method of claim 1, wherein said targeting DNA allows for the selection of the resulting recombinant cells.\n26. The method of claim 1, wherein said targeting DNA comprises DNA that repairs the specific sequence of interest.\n27. A method of modifying a specific sequence in chromosomal DNA of a cell in vitro comprising: \ninducing in the cell double stranded cleavage of chromosomal DNA at a genomic site of interest in the specific sequence to be modified, wherein the inducing comprises contacting the genomic site of interest with a chimeric restriction endonuclease, said chimeric restriction endonuclease comprising a DNA binding sequence and a DNA cleavage domain, wherein the DNA cleavage domain is the FokI cleavage domain, and said restriction endonuclease recognizes a DNA sequence of at least 12 bp, wherein said restriction endonuclease is introduced as a protein or is encoded by a nucleic acid vector that is expressed; and \ncontacting said cell with a targeting DNA or a nucleic acid vector encoding said targeting DNA in an amount sufficient to produce recombination between said targeting DNA and said chromosomal DNA at the site of interest, wherein said targeting DNA comprises (1) DNA homologous to the region surrounding the genomic site of interest and (2) DNA which modifies the specific sequence upon recombination between said targeting DNA and said chromosomal DNA, \nthereby modifying the specific sequence in the chromosomal DNA of the cell. \n28. The method of claim 27, wherein said restriction endonuclease recognizes a DNA sequence of at least 18 bp.\n29. The method of claim 27, wherein the DNA binding sequence of said chimeric endonuclease is a zinc finger binding domain.\n30. The method of claim 27, wherein the DNA binding sequence of said chimeric endonuclease is a meganuclease recognition site.\n31. The method of claim 27, wherein the DNA binding sequence of said chimeric endonuclease is a meganuclease recognition site from I-SceI.\n32. The method of claim 27, wherein said cell is a bacterial cell.\n33. The method of claim 27, wherein said cell is a mammalian cell.\n34. The method of claim 27, wherein said cell is a plant cell.\n35. The method of claim 34, further comprising a step of producing a transgenic plant from said cell.\n36. The method of claim 27, wherein said cell is a stem cell.\n37. The method of claim 36, further comprising a step of producing a transgenic animal from said cell.\n38. The method of claim 27, wherein said cell is a blood cell.\n39. The method of claim 27, wherein said cell is a T-cell.\n40. The method of claim 27, wherein said cell is a human cell.\n41. The method of claim 27, further comprising a step of producing recombinant molecules from said cell.\n42. The method of claim 27, wherein said chimeric endonuclease and/or targeting DNA are introduced into the cell using a nucleic acid vector.\n43. The method of claim 42, wherein said nucleic acid vector is a RNA molecule.\n44. The method of claim 42, wherein said nucleic acid vector is a viral vector.\n45. The method of claim 27, wherein the specific sequence of interest is a mutation.\n46. The method of claim 27, wherein said targeting DNA attenuates or inactivates a chromosomal gene of interest.\n47. The method of claim 27, wherein said targeting DNA introduces a mutation into said genomic site of interest.\n48. The method of claim 27, wherein said targeting DNA introduces a reporter gene into said genomic site of interest.\n49. The method of claim 27, wherein said targeting DNA introduces an expression cassette into said genomic site of interest.\n50. The method of claim 27, wherein said targeting DNA allows for the selection of the resulting recombinant cells.\n51. The method of claim 27, wherein said targeting DNA comprises DNA that repairs the specific sequence of interest.\n52. The method of claim 1, wherein said restriction endonuclease recognizes a DNA sequence of a length selected from the group consisting of 12, 15, 18, 20, 24, 25 and 39 bp.\n53. The method of claim 1, wherein said restriction endonuclease is selected from the group consisting of Endo.sce, HO, I-Ceu I, I-Chu I, I-Cre I, I-Csm I, I-Dir I, I-DMO I, I-Flmu I, I-Flmu II, I-Ppo I, I-Sce I, I-Sce III, I-Sce IV, I-Tev I, I-Tev II, I-Tev III, PI-Mle I, PI-Mtu I, PI-Psp I, PI-Tli I, PI-Tli II and PI-Sce V.\n54. The method of claim 27, wherein said restriction endonuclease recognizes a DNA sequence of a length selected from the group consisting of 12, 15, 18, 20, 24, 25 and 39 bp.\n55. The method of claim 27, wherein said restriction endonuclease is selected from the group consisting of Endo.sce, HO, I-Ceu I, I-Chu I, I-Cre I, I-Csm I, I-Dir I, I-DMO I, I-Flmu I, I-Flmu II, I-Ppo I, I-Sce I, I-Sce III, I-Sce IV, I-Tev I, I-Tev II, I-Tev III, PI-Mle I, PI-Mtu I, PI-Psp I, PI-Tli I, PI-Tli II and PI-Sce V. | 55 | 1. A method of modifying a specific sequence in chromosomal DNA of a cell in vitro comprising: \ninducing in the cell double stranded cleavage of chromosomal DNA at a genomic site of interest in the specific sequence to be modified, wherein the inducing comprises contacting the genomic site of interest with a chimeric restriction endonuclease, said chimeric restriction endonuclease comprising a DNA binding sequence and a DNA cleavage domain, and said restriction endonuclease recognizing a DNA sequence of at least 12 bp, wherein said restriction endonuclease is introduced as a protein or is encoded by a nucleic acid vector that is expressed; and \ncontacting said cell with a targeting DNA or a nucleic acid vector encoding said targeting DNA in an amount sufficient to produce recombination between said targeting DNA and said chromosomal DNA at the site of interest, wherein said targeting DNA comprises (1) DNA homologous to the region surrounding the genomic site of interest and (2) DNA which modifies the specific sequence upon recombination between said targeting DNA and said chromosomal DNA, \nthereby modifying the specific sequence in the chromosomal DNA of the cell. | 1. A method of modifying a specific sequence in chromosomal DNA of a cell in vitro comprising: inducing in the cell double stranded cleavage of chromosomal DNA at a genomic site of interest in the specific sequence to be modified, wherein the inducing comprises contacting the genomic site of interest with a chimeric restriction endonuclease, said chimeric restriction endonuclease comprising a DNA binding sequence and a DNA cleavage domain, and said restriction endonuclease recognizing a DNA sequence of at least 12 bp, wherein said restriction endonuclease is introduced as a protein or is encoded by a nucleic acid vector that is expressed; and contacting said cell with a targeting DNA or a nucleic acid vector encoding said targeting DNA in an amount sufficient to produce recombination between said targeting DNA and said chromosomal DNA at the site of interest, wherein said targeting DNA comprises (1) DNA homologous to the region surrounding the genomic site of interest and (2) DNA which modifies the specific sequence upon recombination between said targeting DNA and said chromosomal DNA, thereby modifying the specific sequence in the chromosomal DNA of the cell. | 27. A method of modifying a specific sequence in chromosomal DNA of a cell in vitro comprising: inducing in the cell double stranded cleavage of chromosomal DNA at a genomic site of interest in the specific sequence to be modified, wherein the inducing comprises contacting the genomic site of interest with a chimeric restriction endonuclease, said chimeric restriction endonuclease comprising a DNA binding sequence and a DNA cleavage domain, wherein the DNA cleavage domain is the FokI cleavage domain, and said restriction endonuclease recognizes a DNA sequence of at least 12 bp, wherein said restriction endonuclease is introduced as a protein or is encoded by a nucleic acid vector that is expressed; and contacting said cell with a targeting DNA or a nucleic acid vector encoding said targeting DNA in an amount sufficient to produce recombination between said targeting DNA and said chromosomal DNA at the site of interest, wherein said targeting DNA comprises (1) DNA homologous to the region surrounding the genomic site of interest and (2) DNA which modifies the specific sequence upon recombination between said targeting DNA and said chromosomal DNA, thereby modifying the specific sequence in the chromosomal DNA of the cell. | RELATED APPLICATIONS \n\nThis application is a continuation of U.S. application Ser. No. 12/607,502, filed Oct. 28, 2009, now abandoned, which is a divisional of U.S. application Ser. No. 11/636,397, filed Dec. 8, 2006, now granted as U.S. Pat. No. 7,629,326, which is a continuation of U.S. application Ser. No. 10/337,229, filed Jan. 6, 2003, now abandoned, which is a continuation of U.S. application Ser. No. 09/917,295, filed Jul. 27, 2001, now abandoned, which is a continuation of International Application No. PCT/US00/03014, which designated the United States and was filed on Feb. 3, 2000, published in English, and which claims the benefit of U.S. Provisional Application No. 60/118,669, filed Feb. 3, 1999. The entire teachings of the above applications are incorporated herein by reference. \n\nBRIEF DESCRIPTION OF THE DRAWINGS \n\nFIGS. 1 and 2 are schematic diagrams illustrating an experiment to measure gene conversion efficiency in vivo by I-SceI-induced gene activation.\n\nFIG. 3 is a schematic diagram illustrating the measure of the gene conversion efficiency from meganuclease-mediated gene conversion experiments.\n\nFIG. 4 is a table which provides the results from I-SceI meganuclease-mediated gene conversion experiments.\n\nFIG. 5 is a table providing examples of meganuclease enzymes.\n\nFIG. 6 is a schematic diagram illustrating a method of inserting an I-SceI site in genomic DNA.\n\nBACKGROUND OF THE INVENTION \n\nHomologous recombination provides a method for genetically modifying chromosomal DNA sequences in a precise way. In addition to the possibility of introducing small precise mutations in order to alter the activity of the chromosomal DNA sequences, such a methodology makes it possible to correct the genetic defects in genes which can cause disease. Unfortunately, current methods for achieving homologous recombination are inherently inefficient, in that homologous recombination-mediated gene repair can usually be achieved in only a small proportion of cells that have taken up the relevant targeting or correcting DNA. For example, in cultured mammalian cells, such recombinational events usually occur in only one in ten thousand cells which have taken up the relevant targeting or correcting DNA. \n\nThus, there is a need to develop new and improved methods of homologous recombination-mediated gene repair. \n\nSUMMARY OF THE INVENTION \n\nThe present invention is related to Applicants' discovery that induction of double stranded DNA cleavage at a specific site in chromosomal DNA induces a cellular repair mechanism which leads to highly efficient recombinational events at that locus. As a result, Applicants' invention relates to methods which result in induction in cells of double stranded DNA cleavage at a specific site in chromosomal DNA. In one embodiment, induction of a double stranded break at a site of interest in chromosomal DNA of the cell is accompanied by the introduction of a targeting DNA homologous to the region surrounding the cleavage site, which results in the efficient introduction of the targeting DNA into the locus. In a second embodiment, induction of a double stranded break at a site of interest in chromosomal DNA of the cell leads to introduction of chromosomal DNA homologous to the region surrounding the site of interest into the site of interest via gene conversion. \n\nThe present invention relates to a method of repairing a specific sequence of interest in chromosomal DNA of a cell comprising (a) inducing in the cell a double stranded break at a site of interest, and (b) introducing into the cell targeting DNA, wherein the targeting DNA comprises (1) DNA homologous to the region surrounding the site of interest and (2) DNA which repairs the specific sequence of interest upon recombination between the targeting DNA and the chromosomal DNA. The targeting DNA is introduced into the cell under conditions appropriate for introduction of the targeting DNA into the site of interest. In a second embodiment, the method of repairing a specific sequence of interest in chromosomal DNA of a cell comprises inducing in the cell double stranded cleavage at a site of interest under conditions appropriate for chromosomal DNA homologous to the region surrounding the site of interest to be introduced into the site of interest and repair of the specific sequence of interest. \n\nIn a particular embodiment, the specific sequence of interest is a mutation. \n\nThe present invention also relates to a method of modifying a specific sequence in chromosomal DNA of a cell comprising (a) inducing in the cell double stranded cleavage at a site of interest in the specific sequence to be modified, and (b) introducing into the cell targeting DNA, wherein the targeting DNA comprises (1) DNA homologous to the region surrounding the site of interest and (2) DNA which modifies the specific sequence upon recombination between the targeting DNA and the chromosomal DNA. The targeting DNA is introduced into the cell under conditions appropriate for introduction of the targeting DNA into the site of interest. In a second embodiment, the method of modifying a specific sequence in chromosomal DNA of a cell comprises inducing in the cell double stranded cleavage at a site of interest in the specific sequence to be modified under conditions appropriate for chromosomal DNA homologous to the region surrounding the site of interest to be introduced into the site of interest and modification of the specific sequence. \n\nThe invention further relates to a method of attenuating an endogenous gene of interest in a cell comprising (a) inducing in the cell double stranded cleavage at a site of interest in the endogenous gene of interest, and (b) introducing into the cell targeting DNA, wherein the targeting DNA comprises (1) DNA homologous to the region surrounding the site of interest and (2) DNA which attenuates the gene of interest upon recombination between the targeting DNA and the gene of interest. The targeting DNA is introduced into the cell under conditions appropriate for introduction of the targeting DNA into the site of interest. \n\nThe invention relates to a method of introducing a mutation into a site of interest in chromosomal DNA of a cell comprising (a) inducing in the cell double stranded cleavage at the site of interest, and (b) introducing into the cell targeting DNA, wherein the targeting DNA comprises (1) DNA homologous to the region surrounding the site of interest and (2) the mutation to be introduced into the chromosomal DNA. The targeting DNA is introduced into the cell under conditions appropriate for introduction of the targeting DNA into the site of interest. \n\nThe invention also relates to a method for treating or prophylaxis of a genetic disease in an individual in need thereof comprising (a) inducing in cells of the individual double stranded cleavage at a site of interest, and (b) introducing into the individual targeting DNA, wherein the targeting DNA comprises (1) DNA homologous to the region surrounding the site of interest and (2) DNA which repairs the site of interest upon recombination between the targeting DNA and the chromosomal DNA. The targeting DNA is introduced into the individual under conditions appropriate for introduction of the targeting DNA into the site of interest. In a second embodiment the method for treating or prophylaxis of a genetic disease in an individual in need thereof comprises inducing in cells of the individual double stranded cleavage at a site of interest under conditions appropriate for chromosomal DNA homologous to the region surrounding the site of interest to be introduced into the site of interest and repair of the site of interest. Alternatively, cells can be removed from an individual to be treated, modified by the present method and introduced into the individual. \n\nThe invention relates to a method of correcting a genetic lesion in chromosomal DNA of a cell comprising inducing in the cell double stranded cleavage at a site of interest in the genetic lesion under conditions appropriate for chromosomal DNA homologous to the region surrounding the site of interest to be introduced into the site of interest and correct the genetic lesion. Here, too, the method can be carried out in cells present in an individual or in cells removed from the individual, modified and then returned to the individual (ex vivo). \n\nDouble stranded breaks (cleavages) at a site of interest can be achieved by restriction endonucleases or chemical entities which recognize and cleave the site of interest. Double stranded breaks at a site of interest can also be achieved by the chimeric restriction endonucleases of the invention. \n\nThe invention also relates to chimeric restriction endonucleases produced by linking DNA binding sequence(s) and DNA cleavage domains. DNA binding sequences include zinc finger binding domains and meganuclease recognition sites. DNA cleavage domains include restriction endonuclease cleavage domains. Nucleic acid molecules which encode the chimeric restriction endonucleases of the invention and host cells which comprise the nucleic acid molecules of the invention are also included in the invention. \n\nThe present invention further relates to the resulting cells and their uses, such as for treatment or prophylaxis of a condition or disorder in an individual (e.g., a human or other mammal or vertebrate). For example, cells can be produced (e.g., ex vivo) by the method described herein and then introduced into an individual using known methods. Alternatively, cells can be modified in the individual (without being removed from the individual). \n\nDETAILED DESCRIPTION OF THE INVENTION \n\nThe present invention is based on Applicants' discovery that induction of double stranded DNA cleavage at a specific site in chromosomal DNA induces a cellular repair mechanism which leads to highly efficient recombinational events at that locus. Frequencies of homologous recombination can be stimulated 1,000 fold and can lead to the introduction of specific genetic modifications in approximately 10% of transfected cells (uncorrected for transfection efficiencies) using the methods described herein. The introduction of the double stranded break is achieved, for example, by a restriction endonuclease which recognizes the site of interest. In one embodiment of the invention, the introduction of the double stranded break is accompanied by the introduction of a targeting segment of DNA homologous to the region surrounding the cleavage site, which results in the efficient introduction of the targeting sequences into the locus (either to repair a genetic lesion or to alter the chromosomal DNA in some specific way). In a second embodiment of the invention, the induction of a double stranded break at a site of interest is employed to obtain correction of a genetic lesion via a gene conversion event in which the homologous chromosomal DNA sequences from the other copy of the gene donates sequences to the sequences where the double stranded break was induced. This latter strategy leads to the correction of genetic diseases in which either one copy of a defective gene causes the disease phenotype (such as occurs in the case of dominant mutations) or in which mutations occur in both alleles of the gene, but at different locations (as is the case of compound heterozygous mutations). Large segments of DNA can be altered by this method, so it is possible to repair even large deletions of chromosomal DNA. Targeting DNA (or targeting segment of DNA) homologous to the region surrounding the cleavage site is also referred to herein as a repair matrix. \n\nDouble stranded breaks (cleavages) at a site of interest can be achieved by restriction endonucleases or chemical entities which recognize and cleave the site of interest. Examples of chemical entities which recognize and cleave a site of interest are described by Dervan et al., for example, in U.S. Pat. No. 4,665,184, U.S. Pat. No. 4,942,217, U.S. Pat. No. 4,795,700, and U.S. Pat. No. 5,789,155, which references are incorporated in their entirety herein by reference. Double stranded breaks at a site of interest can also be achieved by the chimeric restriction endonucleases of the invention, as described herein. \n\nA restriction endonuclease site can be inserted into genomic DNA of a cell at a site of interest by either gene targeting through homologous recombination or by random insertion using a variety of methods. Examples of suitable methods include microinjection of naked DNA, stable calcium phosphate precipitation, transfection and using recombinant retroviruses. Insertion of a restriction endonuclease site can be achieved by the selection of cells that have inserted the restriction endonuclease site into a place (locus or site) of interest and in the proper copy number. Selection can be done by using a reporter gene that can be popped out after analysis of the modified cells. The term reporter gene, as used herein, refers to a nucleic acid sequence whose product can be easily assayed, for example, colorimetrically as an enzymatic reaction product, such as the lacZ gene which encodes for ?-galactosidase. The reporter gene can be operably linked to a suitable promoter so that expression of the reporter gene can be used to assay integration of the restriction endonuclease site into the genome of a cell. Examples of widely-used reporter molecules include enzymes such as ?-galactosidase, ?-glucoronidase, ?-glucosidase; luminescent molecules such as green flourescent protein and firefly luciferase; and auxotrophic markers such as His3p and Ura3p. (See, e.g., Chapter 9 in Ausubel, F. M., et al. Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (1998)). Depending on the cellular target, cells can be used for reimplantation into an animal, in tissue culture or to produce transgenic animal by reimplantation to produce chimeras. Restriction endonuclease site (e.g., I-Sce I site) containing constructs can be injected into a fertilized egg in order to produce a transgenic animal.\n\nTo insert a restriction endonuclease site into the genomic DNA of a cell at a site of interest by targeting through homologous recombination, the restriction endonuclease site is inserted into a targeting DNA molecule, which comprises DNA homologous to a genomic cellular target of interest. Preferably, the homologous DNA is at least about 4 to about 6 kb long and can be designated as the left and right arms of the targeting DNA construct. A restriction endonuclease site and an expression cassette allowing for the selection of the resulting recombinant cells are inserted between the two homologous arms. In a particular embodiment, the expression cassette can be the neomycin resistance gene (neo) operably linked to the Pgk promoter and including the polyadenylation site of the SV40 virus at the 3? end. The cassette is bounded by two direct repeated loxP sites of the P1 phage for a post-selection excision step of the cassette. Geneticin resistant clones (Geneticin resistance is the result of the expression of the neo cassette) can be evaluated for proper targeting by polymerase chain reaction (PCR) on genomic DNA of the resistant clones and by Southern blot analysis. Targeted cells are then treated with the Cre protein of the P1 phage to induce the loss of the floxed resistance cassette. As a result, cells bearing one I-SceI site at the proper location are obtained. Targeted cells can be cells that are used to produce recombinant molecules or embryonic stem cells (ESC) that are used to produce transgenic animals by injection of the ESC into blastocysts and reimplantion of blastocysts into a foster mother. These animals can be used for recombinant protein production or as models for diseases. \n\nA restriction endonuclease used in the present invention recognizes a target DNA sequence (e.g., a restriction endonuclease site) which would not lead to death of the cells upon cleavage of the DNA sequence by the restriction endonuclease. A meganuclease enzyme, which recognizes a very large DNA sequence, is an example of a restriction endonuclease which can be used in the present invention. An example of a meganuclease enzyme is I-SceI, which recognizes an 18-bp site (DNA sequence) that does not appear to be represented in murine or human DNA. Other examples of meganuclease enzymes are provided in FIG. 5. Other meganuclease enzymes (natural and synthetic) are known and described in the art. In a particular embodiment, a restriction endonuclease used in the present invention has a specificity of at least 6.7×10?10 of cleaving (cutting) frequency. A restriction endonuclease used in the present invention can be introduced into a cell or individual as the restriction endonuclease itself or as a vector comprising a nucleic acid which encodes the restriction endonuclease.\n\nA model chromosomal locus was generated in which a site for the meganuclease I-SceI was introduced within the target region for recombination, and double stranded DNA cleavage via introduction of a vector encoding the restriction endonuclease was induced. For application of the method to the manipulation of any chromosomal DNA locus, chimeric restriction endonucleases generated by the juxtaposition of specific DNA binding sequences (in some cases generated by the linking of specific zinc finger binding domains) and DNA cleavage domains can be used to elicit cleavage, either by introduction of an appropriate expression construct, the enzyme, or an RNA encoding the enzyme. In the case of direct introduction of enzyme, enzyme domains can be coupled to facilitators of protein entry into cells, such as tat, HSV VP22, or anthrax toxin. A functional chimeric restriction enzyme containing a domain which recognizes the I-SceI recognition site and a cleavage domain from FokI enzyme was generated. In another embodiment, chemical entities capable of recognizing and cleaving a specific chromosomal site can be used to induce recombination. \n\nThe present invention relates to a method of repairing a specific sequence of interest in chromosomal DNA of a cell comprising (a) inducing in the cell a double stranded break at a site of interest, and (b) introducing into the cell targeting DNA, wherein the targeting DNA comprises (1) DNA homologous to the region surrounding the site of interest and (2) DNA which repairs the specific sequence of interest upon recombination between the targeting DNA and the chromosomal DNA. The targeting DNA is introduced into the cell under conditions appropriate for introduction of the targeting DNA into the site of interest. In a second embodiment, the method of repairing a specific sequence of interest in chromosomal DNA of a cell comprises inducing in the cell double stranded cleavage at a site of interest under conditions appropriate for chromosomal DNA homologous to the region surrounding the site of interest to be introduced into the site of interest and repair of the specific sequence of interest. \n\nIn a method of repairing a specific sequence of interest in chromosomal DNA of a cell, in a particular embodiment, the targeting DNA is designed to include (1) DNA homologous to chromosomal DNA adjacent to the specific sequence of interest, wherein the homologous DNA is sufficient for recombination between the targeting DNA and chromosomal DNA, and (2) DNA which repairs the specific sequence of interest upon recombination between the targeting DNA and chromosomal DNA. Typically, the homologous DNA of the targeting DNA construct flanks each end of the DNA which repairs the specific sequence of interest. That is, the homologous DNA is at the left and right arms of the targeting DNA construct and the DNA which repairs the sequence of interest is located between the two arms. \n\nIn a particular embodiment, the specific sequence of interest is a mutation. Thus, in this embodiment, the invention relates to a method of repairing a mutation in chromosomal DNA of a cell comprising (a) inducing in the cell a double stranded break at a site of interest, and (b) introducing into the cell targeting DNA, wherein the targeting DNA comprises (1) DNA homologous to the region surrounding the site of interest and (2) DNA which repairs the mutation upon recombination between the targeting DNA and the chromosomal DNA. The targeting DNA is introduced into the cell under conditions appropriate for introduction of the targeting DNA into the site of interest. In a second embodiment, the method of repairing a mutation in chromosomal DNA of a cell comprises inducing in the cell double stranded cleavage at a site of interest under conditions appropriate for chromosomal DNA homologous to the region surrounding the site of interest to be introduced into the site of interest and repair of the mutation. \n\nIn a method of repairing a mutation in chromosomal DNA of a cell, in a particular embodiment, the targeting DNA is designed to include (1) DNA homologous to chromosomal DNA adjacent to the mutation, wherein the homologous DNA is sufficient for recombination between the targeting DNA and chromosomal DNA, and (2) DNA which repairs the mutation upon recombination between the targeting DNA and chromosomal DNA. Typically, the homologous DNA of the targeting DNA construct flanks each end of the DNA which repairs the mutation. That is, the homologous DNA is at the left and right arms of the targeting DNA construct and the DNA which repairs the mutation is located between the two arms. \n\nAs used herein, a mutation refers to a nucleotide change, such as a single or multiple nucleotide substitution, deletion or insertion, in a nucleotide sequence. Preferably, the mutation is a point mutation. Chromosomal DNA which bears a mutation has a nucleic acid sequence that is different in sequence from that of the corresponding wildtype chromosomal DNA. \n\nAs used herein, chromosomal DNA adjacent to a specific sequence of interest refers to chromosomal DNA present near or next to the specific sequence of interest. \n\nThe present invention also relates to a method of modifying a specific sequence (or gene) in chromosomal DNA of a cell comprising (a) inducing in the cell double stranded cleavage at a site of interest in the specific sequence to be modified, and (b) introducing into the cell targeting DNA, wherein the targeting DNA comprises (1) DNA homologous to the region surrounding the site of interest and (2) DNA which modifies the specific sequence upon recombination between the targeting DNA and the chromosomal DNA. The targeting DNA is introduced into the cell under conditions appropriate for introduction of the targeting DNA into the site of interest. In a second embodiment, the method of modifying a specific sequence in chromosomal DNA of a cell comprises inducing in the cell double stranded cleavage at a site of interest in the specific sequence to be modified under conditions appropriate for chromosomal DNA homologous to the region surrounding the site of interest to be introduced into the site of interest and modification of the specific sequence. \n\nIn a method of modifying a specific sequence (or gene) in chromosomal DNA of a cell, in a particular embodiment, the targeting DNA is designed to include (1) DNA homologous to the specific sequence (or gene) to be modified, wherein the homologous DNA is sufficient for recombination between the targeting DNA and chromosomal DNA, and (2) DNA which modifies the specific sequence (or gene) upon recombination between the targeting DNA and the chromosomal DNA. Typically, the homologous DNA of the targeting DNA construct flanks each end of the DNA which modifies the specific sequence (or gene). That is, the homologous DNA is at the left and right arms of the targeting DNA construct and the DNA which modifies the specific sequence (or gene) is located between the two arms. \n\nThe invention further relates to a method of attenuating an endogenous gene of interest in a cell comprising (a) inducing in the cell double stranded cleavage at a site of interest in the endogenous gene of interest, and (b) introducing into the cell targeting DNA, wherein the targeting DNA comprises (1) DNA homologous to the region surrounding the site of interest and (2) DNA which attenuates the gene of interest upon recombination between the targeting DNA and the gene of interest. The targeting DNA is introduced into the cell under conditions appropriate for introduction of the targeting DNA into the site of interest. \n\nIn a method of attenuating or inactivating an endogenous gene of interest in a cell, in a particular embodiment, the targeting DNA is designed to include (1) DNA homologous to a target site of the endogenous gene of interest, wherein the homologous DNA is sufficient for recombination between the targeting DNA and the gene of interest, and (2) DNA which attenuates or inactivates the gene of interest upon recombination between the targeting DNA and the gene of interest. Typically, the homologous DNA of the targeting DNA construct flanks each end of the DNA which attenuates or inactivates the gene of interest. That is, the homologous DNA is at the left and right arms of the targeting DNA construct and the DNA which attenuates or inactivates the gene of interest is located between the two arms. \n\nThe invention relates to a method of introducing a mutation into a site of interest in chromosomal DNA of a cell comprising (a) inducing in the cell double stranded cleavage at the site of interest, and (b) introducing into the cell targeting DNA, wherein the targeting DNA comprises (1) DNA homologous to the region surrounding the site of interest and (2) the mutation to be introduced into the site of interest. The targeting DNA is introduced into the cell under conditions appropriate for introduction of the targeting DNA into the site of interest. \n\nIn a method of introducing a mutation into a target site (or gene) of chromosomal DNA of a cell, in a particular embodiment, the targeting DNA is designed to include (1) DNA homologous to the target site (or gene), wherein the homologous DNA is sufficient for recombination between the targeting DNA and the chromosomal DNA, and (2) the mutation which is introduced into the chromosomal DNA upon recombination between the targeting DNA and the chromosomal DNA. Typically, the homologous DNA of the targeting DNA construct flanks each end of the mutation. That is, the homologous DNA is at the left and right arms of the targeting DNA construct and the mutation to be introduced into the chromosomal DNA (i.e., into a target site or gene) is located between the two arms. \n\nThe invention also relates to a method for treating or prophylaxis of a genetic disease in an individual in need thereof comprising (a) inducing in cells of the individual double stranded cleavage at a site of interest, and (b) introducing into the individual targeting DNA, wherein the targeting DNA comprises (1) DNA homologous to the region surrounding the site of interest and (2) DNA which repairs the site of interest. The targeting DNA is introduced into the individual under conditions appropriate for introduction of the targeting DNA into the site of interest. In a second embodiment the method for treating or prophylaxis of a genetic disease in an individual in need thereof comprises inducing in cells of the individual double stranded cleavage at a site of interest under conditions appropriate for chromosomal DNA homologous to the region surrounding the site of interest to be introduced into the site of interest. \n\nThe invention relates to a method of correcting a genetic lesion in chromosomal DNA of a cell comprising inducing in the cell double stranded cleavage at a site of interest in the genetic lesion under conditions appropriate for chromosomal DNA homologous to the region surrounding the site of interest to be introduced into the site of interest. \n\nThe invention also relates to the generation of animal models of disease in which restriction endonuclease sites (e.g., I-SceI target sites) are introduced at the site of the disease gene for evaluation of optimal delivery techniques. \n\nThe invention further relates to chimeric restriction endonucleases generated by the juxtaposition of specific DNA binding sequence(s) and DNA cleavage domain(s). These chimeric restriction endonucleases can be manufactured according to methods generally known in the art. For example, the DNA binding sequence(s) and DNA cleavage domain(s) can be produced as separate components, which are than joined (linked) using known methods or can be produced as a single continuous unit. For example, the chimeric restriction endonucleases can be manufactured by chemical synthesis or recombinant DNA/RNA technology (see, e.g., Sambrook et al., Eds., Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor University Press, New York (1989); and Ausubel et al., Eds., Current Protocols In Molecular Biology, John Wiley & Sons, New York (1998). In a particular embodiment, chimeric restriction endonucleases capable of recognizing specific DNA sequences unique to a disease allele can be generated through juxtaposition of zinc finger DNA binding domains and restriction endonuclease cleavage domains.\n\nDNA binding sequences include zinc finger binding domains and meganuclease recognition sites. DNA cleavage domains include restriction endonuclease cleavage domains. Thus, in a particular embodiment, the chimeric restriction endonuclease is generated by the linking of specific zinc finger binding domains and DNA cleavage domains. In another embodiment, the chimeric restriction endonuclease is generated by joining a meganuclease recognition site and a restriction endonuclease cleavage domain. In a further embodiment, the chimeric restriction endonuclease is produced by joining a I-SceI meganuclease recognition site and the FokI cleavage domain. \n\nThe phrases site of interest, target site and specific site, as used herein, refer to a distinct chromosomal location at which a double stranded break (cleavage) is to be induced, thereby inducing a cellular repair mechanism which leads to highly efficient recombinational events at that locus. \n\nTargeting DNA and/or restriction endonucleases introduced into a cell or individual as described above can be inserted in a vector. As used herein, a vector includes a nucleic acid vector, e.g., a DNA vector, such as a plasmid, a RNA vector, virus or other suitable replicon (e.g., viral vector). \n\nViral vectors include retrovirus, adenovirus, parvovirus (e.g., adeno-associated viruses), coronavirus, negative strand RNA viruses such as orthomyxovirus (e.g., influenza virus), rhabdovirus (e.g., rabies and vesicular stomatitis virus), paramyxovirus (e.g. measles and Sendai), positive strand RNA viruses such as picornavirus and alphavirus, and double stranded DNA viruses including adenovirus, herpesvirus (e.g., Herpes Simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxvirus (e.g., vaccinia, fowlpox and canarypox). Other viruses include Norwalk virus, togavirus, flavivirus, reoviruses, papovavirus, hepadnavirus, and hepatitis virus, for example. Examples of retroviruses include: avian leukosis-sarcoma, mammalian C-type, B-type viruses, D-type viruses, HTLV-BLV group, lentivirus, spumavirus (Coffin, J. M., Retroviridae: The viruses and their replication, In Fundamental Virology, Third Edition, B. N. Fields, et al., Eds., Lippincott-Raven Publishers, Philadelphia, 1996). Other examples include murine leukemia viruses, murine sar... | Children's Medical Center Corporation,Boston,MA,US | Institut Pasteur,Paris,FR | Choulika André,Paris,FR | Mulligan Richard C.,Lincoln,MA,US | Children's Medical Center Corporation | Institut Pasteur | Choulika André | Mulligan Richard C. | INSTITUT PASTEUR | CHILDREN'S MEDICAL CENTER CORPORATION | INSTITUT PASTEUR | CHILDREN'S MEDICAL CENTER CORPORATION | Choulika, André | Mulligan, Richard C. | 2 | Edwards Wildman Palmer LLP | Corless, Peter F. | Cowles, Christopher R. | NaN | Kelly, Robert M | US | Dead | 12 | 2014 | US | 3 | 2012 | 1999-02-03 | 1999 | A61, C12, C07 | C12, A61, C07 | 514044R | 4353201 | 43500618 | 42409461 | 5360231 | 5360232 | 5360234 | US7629326B2 | US7285538B2 | US8476072B2 | US7960525B2 | 4 | http://en.wikipedia.org/wiki/DNA-bindingdomain, author unknown, no journal/volume/number, First page only, downloaded Sep. 23, 2012, first page only. | http://en.wikipedia.org/wiki/Homingendonuclease, 9 pages long, author unknown, no journal/volume/number, downloaded Sep. 23, 2012. | Deonarain (1998) Expert Opin. Ther. Pat., 8: 53-69. DOI:10.1517/13543776.8.1.53 423 | Verma (1997) Nature, 389: 239-242. DOI:10.1038/38410 2349 | Eck et al. (1996) Goodman & Gilman's The Pharmacological Basis of Therapeutics, McGraw-Hill, New York, NY., pp. 77-101. | Gorecki (2001) Expert Opin. Emerging Drugs 6(2): 187-98. | http://en.wikipedia.org/wiki/Geneconversion, no author, no journal/volume/number. | Ziady, et al. (2002) Molecular Therapy, 5(4): 413-19. DOI:10.1006/mthe.2002.0556 1 | Yin, et al. (1997) Cell Death and Differentiation, 4: 796-805. DOI:10.1038/sj.cdd.4400302 2 | Bibikova, M. et al., Enhancing Gene Targeting with Designed Zinc Finger Nucleases, Science, vol. 300, May 2, 2003, p. 764. DOI:10.1126/science.1079512 60 | Kim, Y-G, et al., Hybrid restriction enzymes: Zinc finger fusions to Fok I cleavage domain, Proc. Natl. Acad. Sci. USA, vol. 93, pp. 1156-1160, Feb. 1996. DOI:10.1073/pnas.93.3.1156 174 | Smith, J. et al., Requirements for double-strand cleavage by chimeric restriction enzymes with zinc finger DNA-recognition domains, Nucleic Acids Research, 2000, vol. 28, No. 17, pp. 3361-3369. DOI:10.1093/nar/28.17.3361 59 | 12 | EP3848459A1 | US10000772B2 | US10072066B2 | US10077445B2 | US10113167B2 | US10125361B2 | US10131885B2 | US10155011B2 | US10166255B2 | US10208317B2 | US10227611B2 | US10253316B2 | US10266850B2 | US10278372B2 | US10287559B2 | US10301646B2 | US10301651B2 | US10308961B2 | US10323242B1 | US10323258B2 | US10329559B1 | US10337029B2 | US10351878B2 | US10358658B2 | US10358659B2 | US10376889B1 | US10385359B2 | US10385360B2 | US10400253B2 | US10406177B2 | US10406525B1 | US10407697B2 | US10415058B2 | US10415061B2 | US10421959B1 | US10421980B2 | US10428352B2 | US10435662B1 | US10435678B2 | US10435713B2 | US10443031B1 | US10443074B2 | US10443076B2 | US10457960B2 | US10465185B1 | US10478822B1 | US10487341B2 | US10501738B2 | US10508273B2 | US10513712B2 | US10519467B2 | US10526598B2 | US10526619B2 | US10532324B1 | US10533152B1 | US10533190B2 | US10550363B1 | US10550407B2 | US10557216B2 | US10563227B2 | US10570419B2 | US10577631B2 | US10597680B2 | US10612045B2 | US10626419B2 | US10640791B2 | US10669560B2 | US10676759B2 | US10689669B1 | US10711257B2 | US10711280B2 | US10731181B2 | US10738327B2 | US10745716B2 | US10752920B2 | US10774344B1 | US10793878B1 | US10858761B2 | US10900054B2 | US10907178B2 | US10912797B2 | US10920189B2 | US10927385B2 | US10947532B2 | US10954498B2 | US10975390B2 | US10982230B2 | US10982231B2 | US10988780B2 | US10988782B2 | US10993419B2 | US11001863B2 | US11008589B2 | US11008590B2 | US11021696B2 | US11028412B2 | US11060083B2 | US11066675B2 | US11078458B2 | US11098325B2 | US11147837B2 | US11154574B2 | US11186849B2 | US11234418B2 | US11242543B2 | US11266692B2 | US11268061B2 | US11268088B2 | US11274318B2 | US11293034B2 | US11312953B2 | US11332761B2 | US11401532B2 | US11414657B2 | US11439666B2 | US11473108B2 | US11479794B2 | US11485959B2 | US11492643B2 | US11549127B2 | US11583556B2 | US11591592B2 | US9228208B2 | US9260752B1 | US9410198B2 | US9546384B2 | US9650648B2 | US9663782B2 | US9725714B2 | US9803194B2 | US9809814B1 | US9834786B2 | US9885026B2 | US9888673B2 | US9909122B2 | US9963715B2 | WO2016166268A1 | WO2018007263A1 | WO2018073391A1 | WO2018189360A1 | WO2018206791A1 | WO2019076486A1 | WO2019076489A1 | WO2021224395A1 | WO2021224416A1 | 145 | 2023-02-28 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - (Filing Date: 2015-10-14) 2022-12-30 | 2023-02-06 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY (Filing Date: 2015-10-14) | 2022-08-22 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY (Filing Date: 2015-10-14) | 2018-07-02 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) (Filing Date: 2015-10-14) FEE PAYMENT YEAR 4 | 2017-05-02 CONR REEXAMINATION DECISION CONFIRMS CLAIMS + With reference to: US-C1; REEXAMINATION CERTIFICATE (Filing Date: 2015-10-14) 2017-04-28 | 2015-12-08 RR REQUEST FOR REEXAMINATION FILED + 2015-10-14 | 2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE | 2012-05-25 AS ASSIGNMENT CHILDREN'S MEDICAL CENTER CORPORATION, MASSACHUSET ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:MULLIGAN, RICHARD C.;REEL/FRAME:028272/0408 2009-11-30 | 2012-05-25 AS ASSIGNMENT INSTITUT PASTEUR, FRANCE ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:CHOULIKA, ANDRE;REEL/FRAME:028272/0353 2009-11-30 | US8921332B2 | AU200029829A | CA2361191A1 | EP1147209A2 | JP2002535995A | US20020107214A1 | US20040019002A1 | US20070141038A1 | US20100111924A1 | US20120230971A1 | US20150259655A1 | US20170037434A1 | US7629326B2 | US9458439B2 | WO2000046386A2 | WO2000046386A3 | WO2000046386A9 | 20000810CA2361191A1 |
| Publication Number | Title | Priority Number | Priority Date | Application Number | Application Date | Publication Kind Code | Publication Date | Inventor - w/address | Assignee/Applicant | Assignee - Current US | DWPI Class | DWPI Manual Codes | IPC - Current | CPC - Current | US Class | ECLA | Abstract | Title (Original language) | Claims | Claims Count | First Claim | Independent Claims | Description | Assignee/Applicant (Original Language) | Assignee - Original | Optimized Assignee | Ultimate Parent | Inventor | Inventor Count | Attorney/Agent | Correspondent | Examiner | Publication Country Code | Dead/Alive | Publication Month | Publication Year | Application Country/Region | Application Month | Application Year | Priority Date - Earliest | Earliest Priority Year | IPC Class | CPC Class | US Class - Original | Cited Refs - Patent | Count of Cited Refs - Patent | Cited Refs - Non-patent | Count of Cited Refs - Non-patent | Citing Patents | Count of Citing Patents | INPADOC Legal Status | INPADOC Family Members | INPADOC Family ID | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 2774 | US8925087B1 | Apparatus and methods for in-the-cloud identification of spam and/or malware | US2009487959A | 2009-06-19 | US2009487959A | 2009-06-19 | B1 | 2014-12-30 | Oliver Jonathan James|Kew, AU | Liang Yifun|Milpitas, CA, US | Trend Micro Incorporated,Tokyo,JP | Oliver Jonathan James,Kew,AU | Liang Yifun,Milpitas,CA,US | TREND MICRO INCORPORATED | T01 E | W01 E | T01-C03A | T01-D01 | T01-E04 | T01-F05B2 | T01-G08A | T01-J05B2B | T01-N01D3 | T01-N02A1A | T01-N02A2 | T01-N02A3 | T01-N02B1A | T01-N02B1C | T01-N02B1G | T01-N02B2B | T01-N03B2 | W01-A06F | G06F001214 | G06F001130 | H04L001258 | H04L002906 | H04L000906 | H04L002912 | H04L00631416 | H04L0051212 | H04L00614511 | H04L0063145 | H04L00090643 | H04W001263 | 726024 | 713188 | NaN | One embodiment relates to an apparatus for in-the-cloud identification of spam and/or malware. The apparatus includes computer-readable code configured to be executed by the processor so as to receive queries, the queries including hash values embedded therein. The apparatus further includes computer-readable code configured to be executed by the processor so as to detect a group of hash codes which are similar and to identify the group as corresponding to an undesirable network outbreak. Another embodiment relates to an apparatus for in-the-cloud detection of spam and/or malware. The apparatus includes computer-readable code configured to be executed by the processor so as to receive an electronic message, calculate a locality-sensitive hash based on the message, embed the locality-sensitive hash into a query, and send the query to a central analysis system via a network interface. Other embodiments, aspects and features are also disclosed. | Apparatus and methods for in-the-cloud identification of spam and/or malware | What is claimed is: \n1. A system for detecting undesirable network outbreaks, the system comprising a plurality of domain name servers, each domain name server in the plurality of domain name servers comprising: \na data storage system configured to store computer-readable code and data; \na network interface communicatively connected to a network and configured to receive and send data via the network; \na processor configured to access the data storage system and to execute said computer-readable code; and \ncomputer-readable code stored in the data storage system and configured to be executed by the processor so as to: \nreceive a plurality of domain name system queries via the network interface, said plurality of domain name system queries including locality-sensitive hash codes embedded therein, wherein the locality-sensitive hash codes are generated from a message in hypertext markup language format by removing plain text and leaving hypertext markup language tags before applying a hashing algorithm; \ndetect, from said plurality of domain name system queries, a group of the locality-sensitive hash codes which are similar to each other in that the group of the locality-sensitive hash codes has a number of bits in common that is greater than a threshold number of bits; \nidentify said group of locality-sensitive hash codes as corresponding to a cluster based on a distribution of internet protocol addresses of sources of said plurality of domain name system queries; \ndetermine a signature and associated bitmask for said group of the locality-sensitive hash codes identified as corresponding to the cluster; \nadd the signature and associated bitmask for the cluster to an undesirable identifier data structure; and \nforward the signature and associated bitmask to other domain name servers of the plurality of domain name servers via the network. \n2. The system for detecting undesirable network outbreaks of claim 1, wherein the locality-sensitive hash codes comprise Nilsimsa codes.\n3. A method for detecting undesirable network outbreaks performed by executing computer-readable code in a domain name server which includes a data storage system configured to store the computer-readable code and data, a network interface communicatively connected to a network and configured to receive and send data via the network, and a processor configured to access the data storage system and to execute said computer-readable code, the method comprising: \nreceiving a plurality of domain name system queries via the network interface, the plurality of domain name system queries including hash values embedded therein, wherein the hash values are generated by removing a first predetermined portion of electronic mail messages and leaving a second predetermined portion of the electronic mail messages before applying a hashing algorithm, wherein the first predetermined portion comprises plain text and the second predetermined portion comprises hypertext markup language tags; \ndetecting a group of the hash values from within said plurality of domain name system queries with a similarity measure above a configurable threshold; \nidentifying said group of the hash values as corresponding to an undesirable network outbreak; and \ndetermining a signature and an associated bitmask for said group of the hash values. \n4. The method of claim 3, wherein the hash values are generated by a Nilsimsa code generator.\n5. The method of claim 3, wherein the group of the hash values has a number of bits in common which is greater than a configurable threshold number.\n6. The method of claim 3, further comprising adding said signature and associated bitmask as an entry in a data structure stored in the data storage system.\n7. The method of claim 6, further comprising: searching the data structure to determine whether a hash value from a newly-received query matches any entry in the data structure; and responding to the newly-received query with an answer via the network interface.\n8. A computer host comprising: \na data storage system configured to store computer-readable code and data; \na network interface communicatively connected to a network and configured to receive and send data via the network; \na processor configured to access the data storage system and to execute said computer-readable code; \ncomputer-readable code stored in the data storage system and configured to be executed by the processor so as to receive an electronic message via the network interface; \ncomputer-readable code stored in the data storage system and configured to be executed by the processor so as to remove a first predetermined portion of the electronic message and leave a second predetermined portion of the electronic message before calculating a locality-sensitive hash code, wherein the first predetermined portion comprises plain text and the second predetermined portion comprises hypertext markup language tags; \ncomputer-readable code stored in the data storage system and configured to be executed by the processor so as to calculate the locality-sensitive hash code based on the second predetermined portion of the electronic message; \ncomputer-readable code stored in the data storage system and configured to be executed by the processor so as to embed the locality-sensitive hash code into a domain name system query; and \ncomputer-readable code stored in the data storage system and configured to be executed by the processor so as to send the domain name system query to a domain name server via the network interface, wherein the domain name server receives the domain name system query having the locality-sensitive hash code embedded therein and includes an analysis system to detect a group of locality-sensitive hash codes embedded in domain name system queries which are similar to each other using an associated bitmask and identify said group as corresponding to a cluster. | 8 | 1. A system for detecting undesirable network outbreaks, the system comprising a plurality of domain name servers, each domain name server in the plurality of domain name servers comprising: \na data storage system configured to store computer-readable code and data; \na network interface communicatively connected to a network and configured to receive and send data via the network; \na processor configured to access the data storage system and to execute said computer-readable code; and \ncomputer-readable code stored in the data storage system and configured to be executed by the processor so as to: \nreceive a plurality of domain name system queries via the network interface, said plurality of domain name system queries including locality-sensitive hash codes embedded therein, wherein the locality-sensitive hash codes are generated from a message in hypertext markup language format by removing plain text and leaving hypertext markup language tags before applying a hashing algorithm; \ndetect, from said plurality of domain name system queries, a group of the locality-sensitive hash codes which are similar to each other in that the group of the locality-sensitive hash codes has a number of bits in common that is greater than a threshold number of bits; \nidentify said group of locality-sensitive hash codes as corresponding to a cluster based on a distribution of internet protocol addresses of sources of said plurality of domain name system queries; \ndetermine a signature and associated bitmask for said group of the locality-sensitive hash codes identified as corresponding to the cluster; \nadd the signature and associated bitmask for the cluster to an undesirable identifier data structure; and \nforward the signature and associated bitmask to other domain name servers of the plurality of domain name servers via the network. | 1. A system for detecting undesirable network outbreaks, the system comprising a plurality of domain name servers, each domain name server in the plurality of domain name servers comprising: a data storage system configured to store computer-readable code and data; a network interface communicatively connected to a network and configured to receive and send data via the network; a processor configured to access the data storage system and to execute said computer-readable code; and computer-readable code stored in the data storage system and configured to be executed by the processor so as to: receive a plurality of domain name system queries via the network interface, said plurality of domain name system queries including locality-sensitive hash codes embedded therein, wherein the locality-sensitive hash codes are generated from a message in hypertext markup language format by removing plain text and leaving hypertext markup language tags before applying a hashing algorithm; detect, from said plurality of domain name system queries, a group of the locality-sensitive hash codes which are similar to each other in that the group of the locality-sensitive hash codes has a number of bits in common that is greater than a threshold number of bits; identify said group of locality-sensitive hash codes as corresponding to a cluster based on a distribution of internet protocol addresses of sources of said plurality of domain name system queries; determine a signature and associated bitmask for said group of the locality-sensitive hash codes identified as corresponding to the cluster; add the signature and associated bitmask for the cluster to an undesirable identifier data structure; and forward the signature and associated bitmask to other domain name servers of the plurality of domain name servers via the network. | 3. A method for detecting undesirable network outbreaks performed by executing computer-readable code in a domain name server which includes a data storage system configured to store the computer-readable code and data, a network interface communicatively connected to a network and configured to receive and send data via the network, and a processor configured to access the data storage system and to execute said computer-readable code, the method comprising: receiving a plurality of domain name system queries via the network interface, the plurality of domain name system queries including hash values embedded therein, wherein the hash values are generated by removing a first predetermined portion of electronic mail messages and leaving a second predetermined portion of the electronic mail messages before applying a hashing algorithm, wherein the first predetermined portion comprises plain text and the second predetermined portion comprises hypertext markup language tags; detecting a group of the hash values from within said plurality of domain name system queries with a similarity measure above a configurable threshold; identifying said group of the hash values as corresponding to an undesirable network outbreak; and determining a signature and an associated bitmask for said group of the hash values. | 8. A computer host comprising: a data storage system configured to store computer-readable code and data; a network interface communicatively connected to a network and configured to receive and send data via the network; a processor configured to access the data storage system and to execute said computer-readable code; computer-readable code stored in the data storage system and configured to be executed by the processor so as to receive an electronic message via the network interface; computer-readable code stored in the data storage system and configured to be executed by the processor so as to remove a first predetermined portion of the electronic message and leave a second predetermined portion of the electronic message before calculating a locality-sensitive hash code, wherein the first predetermined portion comprises plain text and the second predetermined portion comprises hypertext markup language tags; computer-readable code stored in the data storage system and configured to be executed by the processor so as to calculate the locality-sensitive hash code based on the second predetermined portion of the electronic message; computer-readable code stored in the data storage system and configured to be executed by the processor so as to embed the locality-sensitive hash code into a domain name system query; and computer-readable code stored in the data storage system and configured to be executed by the processor so as to send the domain name system query to a domain name server via the network interface, wherein the domain name server receives the domain name system query having the locality-sensitive hash code embedded therein and includes an analysis system to detect a group of locality-sensitive hash codes embedded in domain name system queries which are similar to each other using an associated bitmask and identify said group as corresponding to a cluster. | BRIEF DESCRIPTION OF THE DRAWINGS \n\nFIG. 1 is a schematic diagram depicting a data communication system in which an embodiment of the invention may be utilized.\n\nFIG. 2 is a schematic diagram depicting a computer apparatus which may be configured as a component in the implementation of in-the-cloud identification of spam and/or malware in accordance with an embodiment of the invention.\n\nFIG. 3 is a flow chart depicting a method performed by a host engine at a host computer in accordance with an embodiment of the invention.\n\nFIG. 4A shows html tags of a first example of an image-based spam.\n\nFIG. 4B shows html tags of a second example of an image-based spam.\n\nFIG. 5A shows a locality-sensitive hash of the html tags from the first example of an image-based spam (shown in FIG. 4A).\n\nFIG. 5B shows a locality-sensitive hash of the html tags from the second example of an image-based spam (shown in FIG. 4B).\n\nFIG. 6 is a flow chart depicting a method performed by an analysis system at a server to identify a group of messages as spam or malware in accordance with an embodiment of the invention.\n\nFIG. 7 is a table showing an example group of messages identified as spam by an analysis system at a server in accordance with an embodiment of the invention.\n\nFIG. 8 is a flow chart depicting a method performed by an analysis system to check whether or not a message is considered to be spam or malware in accordance with an embodiment of the invention.\n\nBACKGROUND \n\n1. Field of the Invention \n\nThe present invention relates generally to communication networks, and more particularly, but not exclusively, to techniques for identifying spam and/or malware. \n\n2. Description of the Background Art \n\nProblems associated with unsolicited messages in electronic mail systems and malware in computer systems are well documented. Unsolicited messages, also referred to as spam, are mass mailed by spammers to e-mail accounts over the Internet. Malware includes computer viruses, worms, phishing messages, and malicious scripts. \n\nVarious anti-spam and anti-malware techniques have been developed to combat spam and malware. For example, anti-spam software has been deployed in host computers to detect and block spam, and anti-virus software is commonly deployed in personal computers. \n\nThe domain name system (DNS) is a hierarchical naming system for resources on the Internet. A DNS blacklist (DNSBL) is a published list of known untrustworthy IP addresses (for example, those IP addresses linked to spamming) which may be checked to determine if an electronic mail (email) message is from an address known for sending out spam. Conversely, a DNS whitelist is a published list of known trustworthy IP addresses which may be used to avoid unnecessary false positive identifications of spam. \n\nSUMMARY \n\nOne embodiment relates to an apparatus for in-the-cloud identification of spam and/or malware. The apparatus includes computer-readable code configured to be executed by the processor so as to receive queries, said queries including hash codes embedded therein. The apparatus further includes computer-readable code configured to be executed by the processor so as to detect a group of hash codes which are considered similar and to identify said group as corresponding to spam or malware. \n\nAnother embodiment relates to a method performed by executing computer-readable code on an apparatus. The apparatus receives queries that include hash codes embedded therein. The apparatus also detects a group of hash codes which are considered similar and identifies said group as corresponding to spam or malware. \n\nAnother embodiment relates to an apparatus for in-the-cloud detection of spam and/or malware. The apparatus includes computer-readable code configured to be executed by the processor so as to receive an electronic message, calculate a locality-sensitive hash based on the message, embed the locality-sensitive hash into a query, and send the query to an analysis system via a network interface. \n\nIn accordance with another embodiment of the invention, tangible computer-readable media may store computer-readable code described herein for use at a host and/or server. \n\nThese and other features of the present invention will be readily apparent to persons of ordinary skill in the art upon reading the entirety of this disclosure, which includes the accompanying drawings and claims. \n\nThe use of the same reference label in different drawings indicates the same or like components. \n\nDETAILED DESCRIPTION \n\nApplicants have determined that prior technologies to identify unsolicited messages or spam have certain disadvantages and inefficiencies. The present application discloses apparatus and methods for in-the-cloud identification of spam and/or malware, such as computer viruses, worms, phishing messages, or malicious scripts. In the present application, such spam and/or malware may be referred to jointly as undesirable network outbreaks. Advantageously, these apparatus and methods provide for the centralized monitoring of outbreaks of spam and/or malware and enable central control over the level of variants (of spam and/or malware) to be identified. \n\nReferring to FIG. 1, a data communication system 10 according to an embodiment of the invention is shown generally. The system includes a Wide Area Network (WAN) 12, such as an intranet or Internet, multiple Local Area Networks (LANs) (wired or wireless) 14, and gateways 16 connecting the LANs to the WAN. Two LANs are shown interconnected via the WAN, but the WAN may interconnect any number of LANs.\n\nA plurality of personal computers (PCs) or other computer hosts 20 may be connected to each LAN 14. In accordance with an embodiment of the invention, one or more of the hosts 20 may be configured with a host engine (HE) 21.\n\nA domain name system (DNS) server 30 may be connected to the WAN 12. The domain name system or DNS is a hierarchical naming system for resources on the Internet. In accordance with an embodiment of the invention, the DNS server 30 may be configured with an analysis system 31 and an undesirable ID data structure 32.\n\nReferring now to FIG. 2, there is shown a schematic diagram of a computer apparatus 200 which may be configured as a component in the implementation of in-the-cloud identification of spam in accordance with an embodiment of the invention. The computer apparatus 200 may be employed as a host computer 20, a gateway 16, or a DNS server 30, for example. The computer 200 may have fewer or more components to meet the needs of a particular application. The computer 200 may include a processor 201, such as those from the Intel Corporation of Santa Clara, Calif., or Advanced Micro Devices of Sunnyvale, Calif., for example. The computer 200 may have one or more buses 203 coupling its various components. The computer 200 may include one or more user input devices 202 (e.g., keyboard, mouse), one or more data storage devices 206 (e.g., hard drive, optical disk, USB memory), a display monitor 204 (e.g., LCD, flat panel monitor, CRT), a computer network interface 205 (e.g., network adapter, modem), and a main memory 208 (e.g., RAM). The data storage system of the computer apparatus includes the data storage devices 206 and the main memory 208. The computer network interface 205 may be coupled to one or more data communication networks 209, which in this example may be a LAN 14 and/or a WAN 12.\n\nIn the example of FIG. 2, the main memory 208 includes software modules 210. The software modules 210 may comprise computer-readable program code (i.e., software) components of a host computer 20, a gateway 16, or a DNS server 30, for example.\n\nThe software modules 210 may be loaded from the data storage device 206 to the main memory 208 for execution by the processor 201. In accordance with an embodiment of the invention, the software modules 210 on a host computer 20 may include a host engine (HE) 21, and the software modules 210 on a DNS server 30 may include an analysis system 31. In addition, the data storage device 206 on the DNS server 30 may include an undesirable ID data structure 32.\n\nFIG. 3 is a flow chart depicting a method performed by a host engine (HE) 21 at a host computer 20 in accordance with an embodiment of the invention. For example, the host computer 20 may be a personal computer (desktop or laptop) connected via a LAN 14 to the Internet. As another example, the host computer may be a cellular phone configured to communicate over a telecommunication network to the Internet.\n\nAs seen in FIG. 3, an electronic message arrives 302 at the host computer. For example, the message may be an electronic mail (email) message. Alternatively, the message may be a text message.\n\nThe HE (which may be configured as a software module running on the host computer) may then process 304 the message that was received. For example, if the message is an email in hypertext markup language (HTML) format, then the HE may be configured to process the message by removing the plain text and leaving the HTML tags, or, alternatively, by removing the HTML tags and leaving the plain text. Such processing may be done before the hashing algorithm to be applied.\n\nThe HE then calculates 306 a locality-sensitive hash by applying an appropriate hashing algorithm to the message (after post processing, if any). In accordance with an embodiment of the invention, the hashing algorithm may comprise a Nilsimsa code generator. The Nilsimsa code generator may be configured to generate Nilsimsa codes which have a fixed length of 256 bits. Nilsimsa codes are locality sensitive in that a relatively small change in the message results in a relatively small change in the corresponding Nilsimsa code.\n\nThe locality-sensitive hash may then be embedded 308 in a query, and the query may be sent 310 to an analysis system. For example, a domain name system (DNS) query may be embedded with the locality-sensitive hash, and the DNS query sent out by the host computer to be received by a DNS server configured with the analysis system. Subsequently, an answer to the query may be received 312 by the HE from the analysis system.\n\nFIG. 4A shows html code of a first example of an image-based spam. This first spam is an unsolicited electronic mail message which may be received by a user and which displays an unsolicited advertisement in an image. Similarly, FIG. 4B shows html code of a second example of an image-based spam. This second spam is an unsolicited electronic mail message which may be received by another user and may actually display the same image as the first spam.\n\nFIG. 5A shows a locality-sensitive hash of the html code from the first example of an image-based spam (shown in FIG. 4A). Similarly, FIG. 5B shows a locality-sensitive hash of the html tags from the second example of an image-based spam (given in FIG. 4B). Each locality-sensitive hash is shown as 64 hexadecimal digits which represents 256 bits. In this example, the locality-sensitive hashes comprise Nilsimsa codes (which are 256 bits in length). Performing a difference function over the two locality-sensitive hashes indicates that the two hashes agree in 235 out of 256 bits, which is a high level of agreement. This characteristic of the locality-sensitive hashes (that similar content results in similar hash codes) allows similar spam to be grouped and identified in accordance with an embodiment of the invention.\n\nFIG. 6 is a flow chart depicting a method performed by an analysis system 31 to identify a group of messages as spam or malware in accordance with an embodiment of the invention. For example, the analysis system 31 may be an in-the-cloud system which may be accessed by communicating with a server which is connected to the Internet. In one embodiment, the server may be a DNS server 30.\n\nAs seen in FIG. 6, the server configured with the analysis system 31 receives 602 queries which include locality-sensitive hashes. These queries may be received from host engines 21 at multiple hosts. For example, the hosts may comprise computers or electronic devices that are configured to receive emails or text messages from the Internet.\n\nThe analysis system 31 (which may be configured as a software module running on the server) may then determine or detect 604 a group of hash codes which are considered similar. For example, if the locally sensitive hash algorithm being used in 602 is a Nilsimsa hash, then determining that two hash codes are similar would be done by determining whether two hash codes have a number of common bits greater than a configurable threshold. The similarity measure may be configured so that less or more similarity is needed before multiple hash codes are identified as being members of a common group.\n\nA lower similarity threshold (for example, fewer common bits in the case of using a Nilsimsa hash as the locality sensitive hash) would detect more spam messages and/or malware but may lead to more false positive identifications. On the other hand, a higher similarity threshold would lead to fewer false positive identifications but may leave more spam messages and/or malware as undetected. \n\nThe analysis system 31 may then identify 606 the group of similar locality-sensitive hashes (with a similarity measure sufficient to pass a threshold) as corresponding to spam or malware. This identification of the group of hashes as corresponding to spam may rely on other characteristics beyond the cluster of hash codes. Examples of approaches for associating this as a spam cluster may be to (i) have a spam sample from a spam trap which belongs to this group, or (ii) to look at the distribution of IP numbers which were the sources of the spam.\n\nOnce a group of similar locality-sensitive hashes is identified as spam, the analysis system 31 may determine 608 a signature for the spam or malware. One approach would be to identify a central representative hash code for the cluster. The representative samples could be in a data structure such as a KD tree for fast identification of similar hash codes. A kd (k-dimensional) tree is a space-partitioning data structure for organizing points in a k-dimensional space. A kd tree is a type of binary search tree. Another approach would involve calculation of an associated bitmask for the spam or malware cluster. Such a bitmask may be configured such that the bits which are not common are not compared against the signature, while the bits which are common are compared against the signature. An example of this approach is discussed below in relation to FIG. 7.\n\nThe analysis system 31 may then add 610 the signature (and possibly the associated bitmask) to an undesirable ID data structure 32. For example, the undesirable ID data structure 32 may be configured as a binary search tree, such as a KD tree, or other efficiently searchable data structure. Such an undesirable ID data structure 32 may be searched to determine if a newly received locality-sensitive hash value matches a signature/mask for a spam. The analysis system 31 may also forward 612 the update (new addition) to the undesirable ID data structure 32 to other servers configured with the analysis system 31.\n\nFIG. 7 is a table showing an example group of messages identified as spam by an analysis system at a server in accordance with an embodiment of the invention which uses a bitmask in association with the spam signature. The table shows a sample series of bits of a locality-sensitive hash for ten variants of an example spam. The actual hash codes would generally be longer, but only seventeen bits are shown for purposes of illustration.\n\nBelow the ten variants of the example spam are shown bits for a signature and corresponding mask for the spam. As seen, the bits with common values amongst the spam variants are made part of the signature, and the bits that do not have common values amongst the spam variants are masked off so that they are not part of the signature. \n\nFIG. 8 is a flow chart depicting a method performed by an analysis system 31 to check whether or not a message or file is considered to be spam or malware in accordance with an embodiment of the invention. For example, the analysis system 31 may be at a server which is connected to the Internet. In one embodiment, the server may be a DNS server 30.\n\nAs seen in FIG. 8, the server configured with the analysis system 31 receives 802 a query which includes a locality-sensitive hash code. The query may be received from a computer or other electronic device that is configured with a host engine 21.\n\nThe analysis system 31 (which may be configured as a software module running on the server) may then search 804 the undesirable ID data structure 32 to determine 806 whether or not the locality-sensitive hash matches any signature/mask entry in the data structure. The analysis system 31 may then respond 808 to the query by returning an answer to the inquiring HE 21. The answer may indicate whether or not the hash code indicates that the corresponding message or file is spam or malware.\n\nImproved apparatus and methods for identification of spam have been disclosed herein. While specific embodiments of the present invention have been provided, it is to be understood that these embodiments are for illustration purposes and not limiting. Many additional embodiments will be apparent to persons of ordinary skill in the art reading this disclosure. | Trend Micro Incorporated,Tokyo,JP | Oliver Jonathan James,Kew,AU | Liang Yifun,Milpitas,CA,US | Trend Micro Incorporated | Oliver Jonathan James | Liang Yifun | TREND MICRO INCORPORATED | TREND MICRO INCORPORATED | Oliver, Jonathan James | Liang, Yifun | 2 | Okamoto & Benedicto LLP | NaN | Davis, Zachary A | US | Alive | 12 | 2014 | US | 6 | 2009 | 2009-06-19 | 2009 | G06, H04 | H04 | 726024 | 713188 | US7406454B1 | US20050015626A1 | US7328349B2 | US7367056B1 | US7574409B2 | US7617231B2 | US8578484B2 | US20060075048A1 | US20060101334A1 | US20070033645A1 | US7865561B2 | US20080059590A1 | US20100192222A1 | US7409708B2 | US20030225841A1 | US20060095966A1 | US20110093426A1 | US6732149B1 | US6732157B1 | US7716297B1 | US20050108340A1 | US20070038709A1 | US20050188032A1 | US6993660B1 | US7483947B2 | US8205258B1 | 26 | Damiani et al. An Open Digest-based Technique for Spam Detection in Proceedings of the 2004 International Workshop on Security in Parallel and Distributed Systems. 2004. 6 pgs. 4 | Bentley, J. Multidimensional Binary Search Trees Used for Associative Searching, Communications of the ACM, vol. 18, No. 9. Sep. 1975. 509-517. DOI:10.1145/361002.361007 93 | nilsimsa What's a nilsimsa code?, 2 sheets [retrieved on Sep. 24, 2009], retrieved from the internet: http://ixazon.dynip.com/cmeclax/nilsimsa.html. | Bloom filterWikipedia, the free encyclopedia, 10 sheets [retrieved on Sep. 24, 2009], retrieved from the internet: http://en.wikipedia.org/wiki/Bloomfilter. | 4 | CN111629027A | EP3270549A1 | JP06322240B2 | JP2017123142A | US10162967B1 | US10498679B2 | US10657182B2 | US10686814B2 | US10778707B1 | US10826934B2 | US11068595B1 | US11151250B1 | US11157620B2 | US11164156B1 | US11182481B1 | US11270000B1 | US11487876B1 | US11544673B2 | US20150081563A1 | US20150081564A1 | US20150193503A1 | US20220351143A1 | WO2018011264A1 | WO2018080857A1 | 24 | 2022-06-30 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 8TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1552); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY FEE PAYMENT YEAR 8 | 2018-06-04 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) FEE PAYMENT YEAR 4 | 2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE | 2009-11-13 AS ASSIGNMENT TREND MICRO INCORPORATED, JAPAN ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:OLIVER, JONATHAN JAMES;LIANG, YIFUN;REEL/FRAME:023514/0536 2009-06-19 | US8925087B1 | 20141230US8925087B1 |
| 2775 | US8925092B1 | Risk assessment for software applications | US13414929A | 2012-03-08 | US13414929A | 2012-03-08 | B1 | 2014-12-30 | Johansson Jesper M.|Redmond, WA, US | Hamer Kenneth L.|Seattle, WA, US | Hunter Beau J.|Shoreline, WA, US | Busch Jeffrey Joseph|Issaquah, WA, US | Amazon Technologies Inc.,Seattle,WA,US | Johansson Jesper M.,Redmond,WA,US | Hamer Kenneth L.,Seattle,WA,US | Hunter Beau J.,Shoreline,WA,US | Busch Jeffrey Joseph,Issaquah,WA,US | AMAZON TECHNOLOGIES INC. | T01 E | T01-J05B2 | T01-J12C | T01-M06A3 | T01-N02A3 | T01-N02B1B | T01-N02B3 | T01-N03 | T01-S03 | H04L002906 | G06F002157 | G06F0021577 | G06F000861 | H04L00630876 | H04L00631433 | H04W000402 | G06F2221033 | G06F22212101 | G06F22212117 | G06F22212141 | 726025 | NaN | Disclosed are various embodiments for assessing risk associated with different software applications which are installed on user computing devices in an enterprise networked environment. Ratings are generated for the different software applications based at least in part on respective characteristics of the different software applications. Risk profiles are generated for the installations of the different software applications on the user computing devices in the networked environment. The risk profiles are generated based at least in part on the respective ratings, the respective user computing devices, and the respective end users associated with the respective user computing devices. | Risk assessment for software applications | Therefore, the following is claimed: \n1. A non-transitory computer-readable medium embodying a program executable in a computing device, the program comprising: \ncode that identifies a plurality of different software applications installed in a user computing device of a plurality of user computing devices in a networked environment, the user computing device being associated with an end user, the end user having software installation access to the user computing device, the networked environment being associated with an enterprise entity, and the plurality of different software applications being installed on individual ones of the plurality of user computing devices; \ncode that identifies a current version of a corresponding software application of the plurality of different software applications based at least in part on version data that includes information about a plurality of versions of the corresponding software application installed on the plurality of user computing devices in the networked environment, the current version being a latest version of the plurality of versions of the corresponding software application that is installed on at least one of the plurality of user computing devices; and \ncode that, in response to receiving data indicating respective characteristics for individual ones of the plurality of different software applications, generates respective software application ratings for the individual ones of the plurality of different software applications based at least in part on the respective characteristics and a comparison of the current version of the corresponding software application with a respective installed version of the corresponding software application, wherein at least one of the respective characteristics includes the respective installed version; \ncode that, in response to receiving data indicating a relationship of the user computing device to the networked environment and receiving data indicating a relationship of the end user to the enterprise entity, generates respective risk profiles for respective installations of the individual ones of the plurality of different software applications on the user computing device in the networked environment, the respective risk profiles being generated based at least in part on the respective software application ratings, the relationship of the user computing device to the networked environment, and the relationship of the end user associated with the user computing device to the enterprise entity, wherein the data indicating the relationship of the user computing device to the networked environment comprises at least one of whether the user computing device stores protected information, whether the user computing device stores local data, or whether the user computing device hosts at least one unmanaged application; and \ncode that performs at least one action in response to at least one of the respective risk profiles meeting at least one predefined criterion. \n2. The non-transitory computer-readable medium of claim 1, wherein the at least one action comprises disabling access of the end user to the user computing device.\n3. The non-transitory computer-readable medium of claim 1, wherein the at least one action comprises automatically initiating a removal of the respective installation from the user computing device.\n4. The non-transitory computer-readable medium of claim 1, wherein the comparison of the current version with the respective installed version is based at least in part on whether a difference between the current version and the respective installed version of the corresponding software application meets a predefined threshold.\n5. A system, comprising: \nat least one computing device; and \nat least one application executable in the at least one computing device, the at least one application comprising: \nlogic that identifies a plurality of different software applications installed in a networked environment including a plurality of user computing devices, individual ones of the plurality of user computing devices being associated with respective end users; \nlogic that identifies a current version of a corresponding software application of the plurality of different software applications based at least in part on version data that includes information about a plurality of versions of the corresponding software application installed on the plurality of user computing devices in the networked environment, the current version being a latest version of the plurality of versions of the corresponding software application that is installed on at least one of the plurality of user computing devices; \nlogic that generates respective ratings for individual ones of the plurality of different software applications based at least in part on at least one corresponding characteristic of the individual ones of the plurality of different software applications and a comparison of the current version with a respective installed version associated with the corresponding software application; and \nlogic that generates respective risk profiles for the individual ones of the plurality of different software applications installed on the individual ones of the plurality of user computing devices in the networked environment, the respective risk profiles being generated based at least in part on the respective ratings, information associated with corresponding ones of the plurality of user computing devices, corresponding end users associated with the corresponding ones of the plurality of user computing devices, wherein the information associated with the corresponding ones of the plurality of user computing devices comprises at least one of whether corresponding ones of the plurality of user computing devices store protected information, whether the corresponding ones of the plurality of user computing devices store local data, or whether the corresponding ones of the plurality of user computing devices host at least one unmanaged application. \n6. The system of claim 5, wherein the respective risk profiles are generated based at least in part on respective job functions of the corresponding end users associated with the corresponding ones of the plurality of user computing devices.\n7. The system of claim 5, wherein the respective risk profiles are generated based at least in part on respective background information for the corresponding end users associated with the corresponding ones of the plurality of user computing devices.\n8. The system of claim 5, wherein the respective risk profiles are generated based at least in part on respective physical locations of the corresponding ones of the plurality of user computing devices.\n9. The system of claim 5, wherein the respective risk profiles are generated based at least in part on respective logical locations of the corresponding ones of the plurality of user computing devices in the networked environment.\n10. The system of claim 5, wherein the at least one corresponding characteristic includes a threat classification supplied by a local security application.\n11. The system of claim 5, wherein the at least one corresponding characteristic includes whether the corresponding software application communicates over a network.\n12. The system of claim 5, wherein the at least one corresponding characteristic includes whether the corresponding software application accesses a protected resource.\n13. The system of claim 5, wherein the comparison of the current version with the respective installed version is based at least in part on whether the respective installed version corresponds to the current version.\n14. The system of claim 5, wherein the comparison of the current version with the respective installed version is based at least in part on whether a difference between the current version and the respective installed version associated with the corresponding software application meets a predefined threshold.\n15. The system of claim 5, wherein the at least one corresponding characteristic includes whether the respective version associated with the corresponding software application corresponds to a disallowed version.\n16. The system of claim 5, wherein the at least one application further comprises logic that performs at least one action in response to a particular risk profile meeting at least one predefined criterion.\n17. A method, comprising: \ndetermining, via at least one of one or more computing devices, that an installation of a software application exists in a user computing device of a plurality of user computing devices in a networked environment, wherein at least one end user has access to the user computing device in the networked environment, and wherein the software application is installed on individual ones of the plurality of user computing devices; \nidentifying, via at least one of the one or more computing devices, a current version of the software application based at least in part on version data that includes information about a plurality of installed versions of the software application that are installed on the plurality of user computing devices in the networked environment, the current version being a latest version of the plurality of installed versions of the software application that is installed on at least one of the plurality of user computing devices; and \ngenerating, via at least one of the one or more computing devices, a risk profile for the installation based at least in part on at least one characteristic of the software application, a comparison of the current version of the software application with a respective installed version of the software application installed on the user computing device, data associated with the user computing device on which the installation is installed, and the at least one end user who has access to the user computing device, wherein the data associated with the user computing device comprises at least one of whether the user computing device stores protected information, whether the user computing device stores local data, or whether the user computing device hosts at least one unmanaged application; and \nperforming, via at least one of the one or more computing devices, at least one action in response to the risk profile meeting at least one predefined criterion. \n18. The method of claim 17, wherein performing the at least one action further comprises limiting, via at least one of the one or more computing devices, a user login capability of the user computing device.\n19. The method of claim 17, wherein performing the at least one action further comprises initiating, via at least one of the one or more computing devices, a removal of the software application from the user computing device.\n20. The method of claim 17, wherein performing the at least one action further comprises initiating, via at least one of the one or more computing devices, an upgrade of the software application on the user computing device.\n21. The method of claim 17, wherein performing the at least one action further comprises initiating, via at least one of the one or more computing devices, a display of information by the user computing device.\n22. The method of claim 17, wherein performing the at least one action further comprises submitting, by at least one of the one or more computing devices, a review task for the risk profile to a manual review system.\n23. The method of claim 17, wherein the at least one action further comprises limiting, via at least one of the one or more computing devices, access to the networked environment for the at least one end user who has access to the user computing device. | 23 | 1. A non-transitory computer-readable medium embodying a program executable in a computing device, the program comprising: \ncode that identifies a plurality of different software applications installed in a user computing device of a plurality of user computing devices in a networked environment, the user computing device being associated with an end user, the end user having software installation access to the user computing device, the networked environment being associated with an enterprise entity, and the plurality of different software applications being installed on individual ones of the plurality of user computing devices; \ncode that identifies a current version of a corresponding software application of the plurality of different software applications based at least in part on version data that includes information about a plurality of versions of the corresponding software application installed on the plurality of user computing devices in the networked environment, the current version being a latest version of the plurality of versions of the corresponding software application that is installed on at least one of the plurality of user computing devices; and \ncode that, in response to receiving data indicating respective characteristics for individual ones of the plurality of different software applications, generates respective software application ratings for the individual ones of the plurality of different software applications based at least in part on the respective characteristics and a comparison of the current version of the corresponding software application with a respective installed version of the corresponding software application, wherein at least one of the respective characteristics includes the respective installed version; \ncode that, in response to receiving data indicating a relationship of the user computing device to the networked environment and receiving data indicating a relationship of the end user to the enterprise entity, generates respective risk profiles for respective installations of the individual ones of the plurality of different software applications on the user computing device in the networked environment, the respective risk profiles being generated based at least in part on the respective software application ratings, the relationship of the user computing device to the networked environment, and the relationship of the end user associated with the user computing device to the enterprise entity, wherein the data indicating the relationship of the user computing device to the networked environment comprises at least one of whether the user computing device stores protected information, whether the user computing device stores local data, or whether the user computing device hosts at least one unmanaged application; and \ncode that performs at least one action in response to at least one of the respective risk profiles meeting at least one predefined criterion. | 1. A non-transitory computer-readable medium embodying a program executable in a computing device, the program comprising: code that identifies a plurality of different software applications installed in a user computing device of a plurality of user computing devices in a networked environment, the user computing device being associated with an end user, the end user having software installation access to the user computing device, the networked environment being associated with an enterprise entity, and the plurality of different software applications being installed on individual ones of the plurality of user computing devices; code that identifies a current version of a corresponding software application of the plurality of different software applications based at least in part on version data that includes information about a plurality of versions of the corresponding software application installed on the plurality of user computing devices in the networked environment, the current version being a latest version of the plurality of versions of the corresponding software application that is installed on at least one of the plurality of user computing devices; and code that, in response to receiving data indicating respective characteristics for individual ones of the plurality of different software applications, generates respective software application ratings for the individual ones of the plurality of different software applications based at least in part on the respective characteristics and a comparison of the current version of the corresponding software application with a respective installed version of the corresponding software application, wherein at least one of the respective characteristics includes the respective installed version; code that, in response to receiving data indicating a relationship of the user computing device to the networked environment and receiving data indicating a relationship of the end user to the enterprise entity, generates respective risk profiles for respective installations of the individual ones of the plurality of different software applications on the user computing device in the networked environment, the respective risk profiles being generated based at least in part on the respective software application ratings, the relationship of the user computing device to the networked environment, and the relationship of the end user associated with the user computing device to the enterprise entity, wherein the data indicating the relationship of the user computing device to the networked environment comprises at least one of whether the user computing device stores protected information, whether the user computing device stores local data, or whether the user computing device hosts at least one unmanaged application; and code that performs at least one action in response to at least one of the respective risk profiles meeting at least one predefined criterion. | 5. A system, comprising: at least one computing device; and at least one application executable in the at least one computing device, the at least one application comprising: logic that identifies a plurality of different software applications installed in a networked environment including a plurality of user computing devices, individual ones of the plurality of user computing devices being associated with respective end users; logic that identifies a current version of a corresponding software application of the plurality of different software applications based at least in part on version data that includes information about a plurality of versions of the corresponding software application installed on the plurality of user computing devices in the networked environment, the current version being a latest version of the plurality of versions of the corresponding software application that is installed on at least one of the plurality of user computing devices; logic that generates respective ratings for individual ones of the plurality of different software applications based at least in part on at least one corresponding characteristic of the individual ones of the plurality of different software applications and a comparison of the current version with a respective installed version associated with the corresponding software application; and logic that generates respective risk profiles for the individual ones of the plurality of different software applications installed on the individual ones of the plurality of user computing devices in the networked environment, the respective risk profiles being generated based at least in part on the respective ratings, information associated with corresponding ones of the plurality of user computing devices, corresponding end users associated with the corresponding ones of the plurality of user computing devices, wherein the information associated with the corresponding ones of the plurality of user computing devices comprises at least one of whether corresponding ones of the plurality of user computing devices store protected information, whether the corresponding ones of the plurality of user computing devices store local data, or whether the corresponding ones of the plurality of user computing devices host at least one unmanaged application. | 17. A method, comprising: determining, via at least one of one or more computing devices, that an installation of a software application exists in a user computing device of a plurality of user computing devices in a networked environment, wherein at least one end user has access to the user computing device in the networked environment, and wherein the software application is installed on individual ones of the plurality of user computing devices; identifying, via at least one of the one or more computing devices, a current version of the software application based at least in part on version data that includes information about a plurality of installed versions of the software application that are installed on the plurality of user computing devices in the networked environment, the current version being a latest version of the plurality of installed versions of the software application that is installed on at least one of the plurality of user computing devices; and generating, via at least one of the one or more computing devices, a risk profile for the installation based at least in part on at least one characteristic of the software application, a comparison of the current version of the software application with a respective installed version of the software application installed on the user computing device, data associated with the user computing device on which the installation is installed, and the at least one end user who has access to the user computing device, wherein the data associated with the user computing device comprises at least one of whether the user computing device stores protected information, whether the user computing device stores local data, or whether the user computing device hosts at least one unmanaged application; and performing, via at least one of the one or more computing devices, at least one action in response to the risk profile meeting at least one predefined criterion. | BACKGROUND \n\nNetwork security is of paramount concern for enterprise computing environments. Security vulnerabilities in software are continually discovered, and software updates to correct the vulnerabilities are regularly distributed. Further, harmful software such as viruses, malware, adware, and so on may be inadvertently installed by users. For network security, software updates should be regularly applied, installation of harmful software should be prevented, and previously installed harmful software should be removed. \n\nBRIEF DESCRIPTION OF THE DRAWINGS \n\nMany aspects of the present disclosure can be better understood with reference to the following drawings. The components in the drawings are not necessarily to scale, emphasis instead being placed upon clearly illustrating the principles of the disclosure. Moreover, in the drawings, like reference numerals designate corresponding parts throughout the several views. \n\nFIG. 1 is a drawing of a networked environment according to various embodiments of the present disclosure.\n\nFIG. 2 is a flowchart illustrating one example of functionality implemented as portions of a risk profile engine executed in a computing environment in the networked environment of FIG. 1 according to various embodiments of the present disclosure.\n\nFIG. 3 is a flowchart illustrating one example of functionality implemented as portions of an application information service executed in a computing environment in the networked environment of FIG. 1 according to various embodiments of the present disclosure.\n\nFIG. 4 is a flowchart illustrating one example of functionality implemented as portions of a user information service executed in a computing environment in the networked environment of FIG. 1 according to various embodiments of the present disclosure.\n\nFIG. 5 is a flowchart illustrating one example of functionality implemented as portions of a device information service executed in a computing environment in the networked environment of FIG. 1 according to various embodiments of the present disclosure.\n\nFIG. 6 is a flowchart illustrating one example of functionality implemented as portions of an automated action system executed in a computing environment in the networked environment of FIG. 1 according to various embodiments of the present disclosure.\n\nFIG. 7 is a schematic block diagram that provides one example illustration of a computing environment employed in the networked environment of FIG. 1 according to various embodiments of the present disclosure.\n\nFIG. 8 is a schematic block diagram that provides one example illustration of a user computing device employed in the networked environment of FIG. 1 according to various embodiments of the present disclosure.\n\nDETAILED DESCRIPTION \n\nThe present disclosure relates to risk assessment for users and computing devices in enterprise networks of computing resources. System administrators are tasked with ensuring that the enterprise is not exposed to excess liability due to malicious, unpatched, or otherwise vulnerable software in use by end users of computing devices. In a typical large-scale enterprise environment, this task may be performed through the use of aggressive lock down mechanisms, limiting user privileges, and tightly controlling software that is installed on each computing device. This may pose challenges where end users require administrative rights to their computing devices, where end users attach their own computing devices to the network, and in other situations where it is deemed that aggressive management policies may be detrimental to the end-user experience or productivity. \n\nVarious embodiments of the present disclosure automate risk assessment and compliance reporting by creating a risk profile for each computing device on which a given software application is installed. This may be especially useful for enterprise networks where some or all users have access to install applications on their respective computing devices. Information for this risk assessment may be aggregated from many systems to determine the overall threat prospect for a given software application. Risk is assessed with respect to different users who may be given different levels of access. Risk is also assessed with respect to different computing devices, which may be used to perform tasks having different security concerns. In the following discussion, a general description of the system and its components is provided, followed by a discussion of the operation of the same. \n\nWith reference to FIG. 1, shown is a networked environment 100 according to various embodiments. The networked environment 100 includes a computing environment 103 in data communication with a plurality of user computing devices 106 by way of a network 109. The network 109 includes, for example, the Internet, intranets, extranets, wide area networks (WANs), local area networks (LANs), wired networks, wireless networks, or other suitable networks, etc., or any combination of two or more such networks. In one example, the networked environment 100 corresponds to an internal network of computing devices operated by an enterprise entity.\n\nThe computing environment 103 may comprise, for example, a server computer or any other system providing computing capability. A plurality of computing devices may be employed in the computing environment 103 that are arranged, for example, in one or more server banks or computer banks or other arrangements. For example, a plurality of computing devices together may comprise a cloud computing resource, a grid computing resource, and/or any other distributed computing arrangement. Such computing devices may be located in a single installation or may be distributed among many different geographical locations.\n\nVarious applications and/or other functionality may be executed in the computing environment 103 according to various embodiments. Also, various data is stored in a data store 112 that is accessible to the computing environment 103. The data store 112 may be representative of a plurality of data stores 112 as can be appreciated. The data stored in the data store 112, for example, is associated with the operation of the various applications and/or functional entities described below.\n\nThe components executed on the computing environment 103, for example, include a risk profile engine 115, a device information service 118, a user information service 121, an application information service 124, an automated action system 127, a manual review system 130, and other applications, services, processes, systems, engines, or functionality not discussed in detail herein. The risk profile engine 115 is executed to generate a risk profile for each installation of a software application in the user computing devices 106 of the networked environment 100. The risk profile is generated based at least in part on a core rating of the software application, information about the user computing device 106 on which it is installed, information about one or more end users of the user computing device 106, and/or other information. In response to the risk profile meeting one or more predefined criteria, the risk profile engine 115 may cause one or more actions to be performed.\n\nThe device information service 118 is executed to obtain information about the various user computing devices 106 in the networked environment 100. Such information may include, but is not limited to, whether the user computing device 106 stores protected information (e.g., personally identifiable information, payment instrument information, security credentials, etc.), whether the user computing device 106 stores and persists local data, the physical location of the user computing device 106, the logical location of the user computing device 106 in the networked environment 100, whether the user computing device 106 hosts other unmanaged applications, and/or other information. Such information may be described as indicating a relationship of the user computing device 106 to the networked environment 100.\n\nThe user information service 121 is executed to obtain information about various end users of the user computing devices 106. Such information may include, but is not limited to, the job functions of the user, the access levels and privileges of the user, an overall risk compliance rating for the user, the background information for the user, and/or other information. Such information may be described as indicating a relationship of the user to the enterprise entity associated with the networked environment 100.\n\nThe application information service 124 is executed to obtain information about characteristics of the software applications which are installed in the user computing devices 106 of the networked environment 100. Such characteristics may include, but is not limited to, whether the application communicates over the network 109, whether the application uses escalated privileges, whether the application accesses protected or sensitive data resources, whether the application uses virtualization protections, whether the application uses mandatory access control requirements, whether the application is flagged as malicious by anti-virus software, the number of installations of the application across the user computing devices 106, whether the application corresponds to a latest known version, whether the application is significantly out of date (e.g., the difference between the version of the application and the latest known version meets a predefined threshold), whether the application is an otherwise unknown application that is quickly propagating throughout the user computing devices 106, and/or other characteristics. The characteristics of the application may be employed by the risk profile engine 115 to generate a software application risk rating, or core rating, for the software application.\n\nThe automated action system 127 is executed to perform one or more actions in response to the risk profile of an application installation meeting one or more criteria. Such actions may include, but are not limited to, disabling or limiting logins to a user computing device 106, disabling or limiting login capability for a specific user or group of users, disabling or limiting the account of a user, suggesting employee termination of a user, disabling or limiting connectivity to the network 109 for a user computing device 106, initiating an uninstallation or removal of a software application from a user computing device 106, initiating an upgrade of a software application on a user computing device 106, displaying information to the end user informing them that a software application is out of date or otherwise out of compliance, displaying a dialog to the user requesting information regarding an unknown software application, and/or other actions.\n\nThe manual review system 130 is configured to submit a risk profile of an application installation for manual review. In one embodiment, the risk profile may be manually reviewed by a network administrator of the enterprise entity associated with the networked environment. In another embodiment, the risk profile may be reviewed by outside contractors who are compensated on a per-task basis. For example, the risk profile may be sent to a network site where various tasks are provided for completion by a group of outside contractors. The outside contractors can select tasks and perform the task in exchange for compensation. In some cases, the outside contractors may be prequalified by completing a certain number of tasks successfully, by earning recommendations of others, and/or by other approaches. The results of the outside contractors may be verified, for example, by having multiple outside contractors perform each task, or by having multiple outside contractors perform selected tasks for spot-checking reasons.\n\nThe data stored in the data store 112 includes, for example, user information 133, device information 136, application information 139, application characteristics 142, local security application classification data 145, manual review data 148, version data 151, rating rules 154, application ratings 157, risk profile rules 160, risk profiles 163, action rules 166, report data 169, and potentially other data. The user information 133 includes various information about the user that may be aggregated by the user information service 121. Such information may include data from human resources systems, lightweight directory access protocol (LDAP) servers, portable operating system interface (POSIX) user groups, and/or other user-related or employee-related data.\n\nThe device information 136 includes various information about the user computing devices 106 that may be aggregated by the device information service 118. Such information may include the types of data stored on a user computing device 106, the end users who have access to the user computing device 106, the applications which are installed on the user computing device 106, the physical and logical locations of the user computing device 106, and/or other data. The application information 139 includes various information about the software applications which are deployed on user computing devices 106. The application information 139 may include a list of all of the applications and the latest versions of each. By examining all of the applications installed on the user computing devices 106, it is possible to crowd source information such as a latest available version in order to identify out-of-date software.\n\nThe application characteristics 142 include various characteristics that are employed in generating application ratings 157. The application characteristics 142 may be determined from the application information 139, local security application classification data 145, and/or from other sources by the application information service 124. The local security application classification data 145 indicates whether a software application is flagged as being malicious by anti-virus software or other local security software. The manual review data 148 includes data relating to a manual review of a risk profile 163 by way of the manual review system 130. The manual review data 148 may indicate possible actions to be performed in response to the risk profile 163 based at least in part on the manual review.\n\nThe version data 151 may indicate the various versions of software applications which are installed on the user computing devices 106, including which version is determined to be the latest version. The rating rules 154 include rules that are used by the risk profile engine 115 in determining the application ratings 157. Such rules may include thresholds and/or other predefined criteria relative to the application characteristics 142 and other data. The application ratings 157 correspond to core ratings of the software applications according to the application characteristics 142 rather than the user computing device 106 or the end users associated with the user computing device 106.\n\nThe risk profile rules 160 include rules that are used by the risk profile engine 115 in determining the risk profiles 163. Such rules may include thresholds and/or other predefined criteria relative to the application ratings 157, the device information 136, the user information 133, and other data. The risk profiles 163 indicate a degree of security risk associated with a user-installed application on a user computing device 106. Various corrective actions may be undertaken in response to the risk profiles 163 indicating, for example, a certain type of risk, a risk having a certain magnitude, and so on. These actions may be determined by evaluation of action rules 166 which may indicate various thresholds or criteria for performing an action in response to a risk profile 163. The report data 169 includes various reports about risk profiles 163 and potential corrective actions for a networked environment 100.\n\nThe user computing devices 106a, 106b . . . 106N are representative of a plurality of client devices that may be coupled to the network 109. Each of the user computing devices 106 may comprise, for example, a processor-based system such as a computer system. Such a computer system may be embodied in the form of a desktop computer, a laptop computer, personal digital assistants, cellular telephones, smartphones, set-top boxes, music players, web pads, tablet computer systems, game consoles, electronic book readers, or other devices with like capability. Each of the user computing devices 106 is associated with one or more end users that have login access. In one scenario, at least some of the end users have access to download and install software onto their user computing devices 106.\n\nEach user computing device 106 may be configured to execute various applications 172, which may correspond to user-installed software applications. A management service 175 may be executed to perform various management functions for the user computing device 106, e.g., uninstall applications, display notifications, obtain input from users regarding self-installed unknown applications, and/or other management functions. A local security application 178, such as anti-virus software, may be present to scan the user computing device 106 for any potentially malicious software. Other software may be present in other embodiments. Various local data 181 may be stored on at least some of the user computing devices 106. In some cases, the user computing devices 106 may be mere terminals and not persist local data 181.\n\nNext, a general description of the operation of the various components of the networked environment 100 is provided. To begin, the risk profile engine 115 gathers various forms of data to begin an examination of the user computing devices 106 in the networked environment 100. The examination may be performed in response to a request by a system administrator, periodically, or at some other time.\n\nThe device information service 118 gathers information and makes determinations regarding the risk conditions of the user computing devices 106 in the networked environment 100. The user information service 121 gathers information and makes determinations regarding the risk conditions of the end users of the user computing devices 106. The application information service 124 gathers various information and evaluates various application characteristics 142 of the applications 172 which are installed on the user computing devices 106.\n\nThe risk profile engine 115 generates an application rating 157 for each of the applications 172 according to the rating rules 154. The risk profile engine 115 then generates a risk profile 163 for each installation of each of the applications 172. Each risk profile 163 is generated using the risk profile rules 160 based at least in part on various factors including the application ratings 157, the device information 136 regarding the user computing device 106 on which the application 172 is installed, the user information 133 regarding the end users of the user computing device 106 on which the application 172 is installed, and/or other factors. The risk profile engine 115 may generate various reports in the report data 169 for manual review by the system administrators.\n\nAlso, the risk profile engine 115 may perform one or more actions in response to the risk profile 163 meeting a threshold or meeting predefined criteria as defined by the action rules 166. Such actions may be performed automatically by the automated action system 127. Alternatively, the risk profile 163 may be referred for further review to the manual review system 130.\n\nReferring next to FIG. 2, shown is a flowchart that provides one example of the operation of a portion of the risk profile engine 115 according to various embodiments. It is understood that the flowchart of FIG. 2 provides merely an example of the many different types of functional arrangements that may be employed to implement the operation of the portion of the risk profile engine 115 as described herein. As an alternative, the flowchart of FIG. 2 may be viewed as depicting an example of steps of a method implemented in the computing environment 103 (FIG. 1) according to one or more embodiments.\n\nBeginning with box 203, the risk profile engine 115 obtains state information indicating installations of software applications 172 (FIG. 1) in the networked environment 100 (FIG. 1) of user computing devices 106 (FIG. 1). The state information may correspond to the application information 139 (FIG. 1), the local security application classification data 145 (FIG. 1), version data 151 (FIG. 1), and/or other data. In box 206, the risk profile engine 115 obtains the application characteristics 142 (FIG. 1) for the applications 172 from the application information service 124 (FIG. 1). In box 209, the risk profile engine 115 generates the application ratings 157 (FIG. 1), or core ratings, for the applications 172.\n\nIn box 212, the risk profile engine 115 obtains device information 136 (FIG. 1) about the user computing devices 106 from the device information service 118 (FIG. 1). In box 215, the risk profile engine 115 obtains user information 133 (FIG. 1) about the end users of the user computing devices 106 from the user information service 121 (FIG. 1). In box 218, the risk profile engine 115 generates a risk profile 163 (FIG. 1) for each installation of the software applications 172. The risk profile engine 115 generates the risk profile 163 based at least in part on the application ratings 157, the device information 136 for the respective user computing devices 106, and the user information 133 for the end users of the respective user computing devices 106.\n\nIn box 221, for each risk profile 163, the risk profile engine 115 determines whether the risk profile 163 meets predetermined criteria for magnitude of risk or type of risk. If the risk profile 163 does not meet the predetermined criteria, the portion of the risk profile engine 115 ends. If the risk profile 163 does meet the predetermined criteria, the risk profile engine 115 moves to box 224 and determines whether the risk profile 163 is to be manually reviewed.\n\nIf the risk profile 163 is to be manually reviewed, the risk profile engine 115 moves to box 227 and submits the risk profile 163 to the manual review system 130 (FIG. 1) for manual review. Thereafter, the portion of the risk profile engine 115 ends. If the risk profile 163 is not to be manually reviewed, the risk profile engine 115 instead moves from box 224 to box 230 and performs one or more actions automatically by the automated action system 127 (FIG. 1) in response to the risk profile 163. Thereafter, the portion of the risk profile engine 115 ends.\n\nTurning now to FIG. 3, shown is a flowchart that provides one example of the operation of a portion of the application information service 124 according to various embodiments. It is understood that the flowchart of FIG. 3 provides merely an example of the many different types of functional arrangements that may be employed to implement the operation of the portion of the application information service 124 as described herein. As an alternative, the flowchart of FIG. 3 may be viewed as depicting an example of steps of a method implemented in the computing environment 103 (FIG. 1) according to one or more embodiments.\n\nBeginning with box 303, the application information service 124 determines the threat classification of each software application 172 (FIG. 1) from the local security applications 178 (FIG. 1) executed on the user computing devices 106 (FIG. 1) and/or from another source of threat classifications. The risk profile 163 (FIG. 1) may indicate a high level of risk for an application 172 which is already classified as potentially malicious or a threat. The application information service 124 may also obtain information indicating whether the application 172 has a long history of security vulnerabilities, which may be a greater risk. In box 306, the application information service 124 determines whether the software application 172 communicates over a network 109 (FIG. 1). The risk profile 163 may indicate a greater level of risk for an application 172 that is network enabled versus one that is not.\n\nIn box 309, the application information service 124 determines whether the application 172 is configured to access a protected resource, e.g., personally identifying information, payment instrument data, passwords, and so on. The risk profile 163 may indicate a greater level of risk for an application 172 that accesses protected resources compared with one that does not access protected resources. In box 312, the application information service 124 determines the latest version of the software application 172 from the version data 151 (FIG. 1). The version data 151 may be populated by examining the installed versions of the application 172 in the networked environment 100.\n\nIn box 315, the application information service 124 determines whether the application 172 is a latest version. In box 318, the application information service 124 determines whether a difference between the version of the application 172 and the latest version meets a threshold. The risk profile 163 may indicate a greater risk for applications 172 that are out-of-date or not current. The application information service 124 may also aggregate information indicating the number of installations of this application 172 across the user computing devices 106, whether the application 172 is an otherwise unknown application that is quickly propagating throughout the user computing devices 106, and/or other information.\n\nIn box 319, the application information service 124 determines whether the version of the application 172 is disallowed. For example, the rating rules 154 (FIG. 1) may indicate that a particular version or versions of an application 172 (or all versions of the application 172) are disallowed on the user computing devices 106, leading to a relatively high risk profile 163 and/or automatic remedial action. In box 321, the application information service 124 returns the application characteristics 142 (FIG. 1) according to the determinations made in boxes 303-319. Thereafter, the portion of the application information service 124 ends.\n\nContinuing to FIG. 4, shown is a flowchart that provides one example of the operation of a portion of the user information service 121 according to various embodiments. It is understood that the flowchart of FIG. 4 provides merely an example of the many different types of functional arrangements that may be employed to implement the operation of the portion of the user information service 121 as described herein. As an alternative, the flowchart of FIG. 4 may be viewed as depicting an example of steps of a method implemented in the computing environment 103 (FIG. 1) according to one or more embodiments.\n\nBeginning with box 403, the user information service 121 determines the job functions of the users. A risk profile 163 (FIG. 1) associated with an installation used by a relatively important user may indicate a relatively greater risk. More important users may, for example, be offered a higher service level by the networked environment 100, thus downtime may be required to be especially minimized. Also, a low-level employee logging into a relatively high level user computing device 106 (FIG. 1) may be associated with a relatively high risk. In box 406, the user information service 121 determines access levels associated with the end users. A risk profile 163 associated with a user having a relatively high level of access (e.g., domain administrators, etc.) may indicate a relatively greater risk.\n\nIn box 409, the user information service 121 determines an overall compliance for each end user. In other words, the user information service 121 determines whether the end user is prone to operate on user computing devices 106 associated with a relatively high risk profile 163. Risk profiles 163 associated with such an end user may indicate relatively high levels of risk. In box 412, the user information service 121 determines background information for the end user. To this end, the user information service 121 may perform a background check, a credit check, and/or obtain other data from an external provider. The user information service 121 may determine whether the end user is bonded, has a security clearance, or meets other risk-affecting criteria. The user information service 121 may also examine data from internal systems, such as, for example, data indicating employee performance and/or other data. It may be the case that a poor credit score or poor employee performance may be indicators of risk. In box 415, the user information service 121 returns the user information 133 (FIG. 1) according to the determinations made in box 403-412. Thereafter, the portion of the user information service 121 ends.\n\nMoving on to FIG. 5, shown is a flowchart that provides one example of the operation of a portion of the device information service 118 according to various embodiments. It is understood that the flowchart of FIG. 5 provides merely an example of the many different types of functional arrangements that may be employed to implement the operation of the portion of the device information service 118 as described herein. As an alternative, the flowchart of FIG. 5 may be viewed as depicting an example of steps of a method implemented in the computing environment 103 (FIG. 1) according to one or more embodiments.\n\nBeginning with box 503, the device information service 118 determines the physical location of the user computing device 106 (FIG. 1). For example, if a user computing device 106 is located in a foreign country, it may be associated with a greater level of risk. In box 506, the device information service 118 determines the logical location of the user computing device 106 in the networked environment 100 (FIG. 1). For example, a user computing device 106 in a secured location of the network 109 (e.g., behind a firewall, etc.) may be associated with a greater level of risk than a user computing device 106 accessing a public portion of the network 109.\n\nIn box 509, the device information service 118 determines whether the user computing device 106 stores protected data, e.g., personally identifiable information, payment instrument data, etc. For example, a user computing device 106 that stores protected data may be associated with a greater level of risk than one that does not. In box 512, the device information service 118 determines whether the user computing device 106 persists local data 181 (FIG. 1). For example, a user computing device 106 that persists local data 181 may be a greater risk than a user computing device 106 that is merely a terminal.\n\nIn box 513, the device information service 118 determines whether the user computing device 106 is capable of exporting local data 181 to external media. For example, the user computing device 106 may be connected to a printer, have an external storage drive, have open universal serial bus (USB) ports, and so on. Such a device may be associated with a greater level of risk than a user computing device 106 having no USB ports, restricted USB ports, and/or otherwise limited approaches to exporting local data 181 to external media. In box 515, the device information service 118 returns the user inform... | Amazon Technologies Inc.,Seattle,WA,US | Johansson Jesper M.,Redmond,WA,US | Hamer Kenneth L.,Seattle,WA,US | Hunter Beau J.,Shoreline,WA,US | Busch Jeffrey Joseph,Issaquah,WA,US | Amazon Technologies Inc. | Johansson Jesper M. | Hamer Kenneth L. | Hunter Beau J. | Busch Jeffrey Joseph | AMAZON.COM INC. | AMAZON.COM INC. | Johansson, Jesper M. | Hamer, Kenneth L. | Hunter, Beau J. | Busch, Jeffrey Joseph | 4 | Thomas | Horstemeyer, LLP | NaN | Williams, Jeffery / Harris, Christopher C | US | Dead | 12 | 2014 | US | 3 | 2012 | 2012-03-08 | 2012 | H04, G06 | G06, H04 | 726025 | US7752125B1 | US20090119501A1 | US20030233438A1 | US20080209567A1 | US20130111592A1 | US20130179833A1 | US20060031679A1 | US20120304300A1 | US7536724B1 | US20100095235A1 | US20110047620A1 | US20130097709A1 | 12 | NaN | 0 | EP3258375A1 | US10185924B1 | US10324985B2 | US10366127B2 | US10373167B2 | US10409984B1 | US10496993B1 | US10523679B2 | US10546302B2 | US10552308B1 | US10642633B1 | US10664380B2 | US10715536B2 | US10733594B1 | US10820205B1 | US10872026B2 | US11080434B2 | US11169903B2 | US11373194B2 | US11374949B2 | US11494762B1 | US11507958B1 | US11539705B2 | US20160179498A1 | US20160179955A1 | US20190310929A1 | US9417870B2 | US9569196B2 | US9652610B1 | WO2019139913A1 | 30 | 2023-02-28 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - 2022-12-30 | 2023-02-06 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | 2022-08-22 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | 2018-07-02 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) FEE PAYMENT YEAR 4 | 2016-02-16 CC CERTIFICATE OF CORRECTION | 2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE | 2012-04-10 AS ASSIGNMENT AMAZON TECHNOLOGIES, INC., NEVADA ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:JOHANSSON, JESPER M.;HAMER, KENNETH L.;HUNTER, BEAU J.;AND OTHERS;SIGNING DATES FROM 20120313 TO 20120319;REEL/FRAME:028019/0701 | US8925092B1 | US20150143528A1 | US9934384B2 | 20141230US8925092B1 |
| 2776 | US8923293B2 | Adaptive multi-interface use for content networking | US2009603336A | 2009-10-21 | US2009603336A | 2009-10-21 | B2 | 2014-12-30 | Jacobson Van L.|Woodside, CA, US | Thornton James D.|Redwood City, CA, US | Palo Alto Research Center Incorporated,Palo Alto,CA,US | Jacobson Van L.,Woodside,CA,US | Thornton James D.,Redwood City,CA,US | CISCO TECHNOLOGY INC. | T01 E | W01 E | W06 E | T01-C03C | T01-F03B | T01-F05B2 | T01-J05B4P | T01-N01B3 | T01-N01D2 | T01-N02A2D | W01-A02A | W01-A06B5A | W01-A06C4E | W06-B | G06F0015173 | G06F001730 | H04L004574 | H04L0045748 | H04L0045745 | G06F001600 | G06F001695 | H04L004512 | H04L004554 | H04L004570 | H04L0045748 | H04L006763 | H04L006900 | H04L00614511 | H04L006922 | 370392 | NaN | One embodiment provides a system that forwards a packet with a hierarchically structured variable-length identifier (HSVLI) in a network. An HSVLI indicates a piece of content and indicates a hierarchical structure of contiguous components ordered from a most general level to a most specific level. The length of the HSVLI is not fixed. During operation, the system receives a packet which contains an interest for a piece of content with an HSVLI. Subsequently, the system determines forwarding information for the HSVLI based on one or more of: knowledge of content which matches the HSVLI, a forwarding policy, and contextual information about the network. Next, the system configures a forwarding engine with the forwarding information. The system then forwards the packet based on the forwarding information. | Adaptive multi-interface use for content networking | What is claimed is: \n1. A computer-implemented method for forwarding a packet with a hierarchically structured variable-length identifier (HSVLI) in a network, wherein the computer includes a processor, the method comprising: \nreceiving a packet which contains an interest for a piece of content, wherein the interest includes an address-independent HSVLI; \nwherein the HSVLI identifies a specific piece of content without identifying a network address or a storage location for the piece of content, and wherein the HSVLI is hierarchically structured and comprises contiguous name components ordered from a most general level to a most specific level; and \ndetermining forwarding information for the packet based on the HSVLI, wherein determining the forwarding information involves: \nidentifying a forwarding information entry that has the longest prefix match with the HSVLI by matching the name components of the HSVLI with the name components of the forwarding information entries, wherein the longest prefix match has the largest number of matched name components; and \ndetermining, from the identified forwarding information entry, one or more interfaces for forwarding the interest; and \nforwarding the packet to one or more of the determined interfaces. \n2. The method of claim 1, wherein determining the forwarding information for the HSVLI further involves selecting the forwarding information based on knowledge of content which matches the HSVLI, and wherein knowledge of content which matches the HSVLI comprises one or more of: \nlocation of content which matches the HSVLI; \navailability of content which matches the HSVLI; and \nimportance or priority of content which matches the HSVLI. \n3. The method of claim 2, \nwherein one or more components of the HSVLI comprise a domain name system (DNS) name; and \nwherein determining the forwarding information comprises determining an output interface based on the DNS name in the HSVLI. \n4. The method of claim 1, wherein determining the forwarding information for the HSVLI further involves selecting the forwarding information based on a forwarding policy, and wherein the forwarding policy comprises one or more of: \na policy rule on content which matches the HSVLI; \na security constraint on content which matches the HSVLI; and \na strategy rule to discover a source of content which matches the HSVLI. \n5. The method of claim 1, wherein determining the forwarding information for the HSVLI further involves selecting the forwarding information based on contextual information, and wherein the contextual information comprises information about one or more of: \nphysical layer connectivity, which includes one or more of: a local-area network (LAN) connectivity, a wireless LAN connectivity, a wide-area network (WAN) connectivity, and other wired or wireless connectivity; \na peer node which is likely to store content which matches the HSVLI; \nnetwork costs; \nnetwork latency; and \nbattery status. \n6. The method of claim 1, wherein determining the forwarding information for the HSVLI further involves configuring a forwarding engine with the forwarding information, and wherein the configuration of the forwarding engine is in response to one or more of: \na status change of the local network; \nexecution of a routing protocol based on information received from another node in the network; and \nreceiving statistical information indicating delay associated with one or more output interfaces. \n7. The method of claim 1, further comprising: \nperiodically or continually updating a database used to determine forwarding information by discovering nodes in the network; and \nestablishing a secure tunnel with a discovered node to receive the content. \n8. The method of claim 1, wherein a component in the contiguous components comprises one or more of: \na globally routable name; \nan organizational name; \na version identifier; and \na digest. \n9. The method of claim 1, further comprising forwarding a packet through multiple output interfaces simultaneously.\n10. The method of claim 1, further comprising receiving contextual and policy information from a node and virally propagating the contextual and policy information to another node.\n11. An apparatus for forwarding a packet with a hierarchically structured variable-length identifier (HSVLI) in a network comprising: \na processor; \na memory; \na receiving mechanism configured to receive a packet which contains an interest for a piece of content, wherein the interest includes an address-independent HSVLI; \nwherein the HSVLI identifies a specific piece of content without identifying a network address or a storage location for the piece of content, and wherein the HSVLI is hierarchically structured and comprises contiguous name components associated with the piece of content ordered from a most general level to a most specific level; and \na determining mechanism configured to determine forwarding information for the packet based on the HSVLI, wherein determining the forwarding information involves: \nconfiguring a forwarding engine to identify a forwarding information entry that has the longest prefix match with the HSVLI by matching the name components of the HSVLI with the name components of the forwarding information entries, wherein the longest prefix match has the largest number of matched named components; and \ndetermining, from the identified forwarding information entry, one or more interfaces for forwarding the interest; and \na forwarding mechanism configured to forward the packet to one or more of the determined interfaces. \n12. The apparatus of claim 11, wherein the determining mechanism is further configured to select the forwarding information based on knowledge of content which matches the HSVLI, and wherein knowledge of content which matches the HSVLI comprises one or more of: \nlocation of content which matches the HSVLI; \navailability of content which matches the HSVLI; and \nimportance or priority of content which matches the HSVLI. \n13. The apparatus of claim 12, \nwherein one or more components of the HSVLI comprise a domain name system (DNS) name; and \nwherein determining the forwarding information comprises determining an output interface based on the DNS name in the HSVLI. \n14. The apparatus of claim 11, wherein the determining mechanism is further configured to select the forwarding information based on a forwarding policy, and wherein the forwarding policy comprises one or more of: \na policy rule on content which matches the HSVLI; \na security constraint on content which matches the HSVLI; and \na strategy rule to discover a source of content which matches the HSVLI. \n15. The apparatus of claim 11, wherein the determining mechanism is further configured to select the forwarding information based on contextual information, and wherein the contextual information comprises information about one or more of: \nphysical layer connectivity, which includes one or more of: a local-area network (LAN) connectivity, a wireless LAN connectivity, a wide-area network (WAN) connectivity, and other wired or wireless connectivity; \na peer node which is likely to store content which matches the HSVLI; \nnetwork costs; \nnetwork latency; and \nbattery status. \n16. The apparatus of claim 11, wherein the configuration of the forwarding engine with the forwarding information is in response to one or more of: \na status change of the local network; \nexecution of a routing protocol based on information received from another node in the network; and \nreceiving statistical information indicating delay associated with one or more output interfaces. \n17. The apparatus of claim 11 further configured to: \nperiodically or continually update a database used to determine forwarding information by discovering nodes in the network; and \nestablish a secure tunnel with a discovered node to receive the content. \n18. The apparatus of claim 11, wherein a component in the contiguous components comprises one or more of: \na globally routable name; \nan organizational name; \na version identifier; and \na digest. \n19. The apparatus of claim 11, further configured to forward a packet through multiple output interfaces simultaneously.\n20. The apparatus of claim 11, further configured to receive contextual and policy information from a node and virally propagate the contextual and policy information to another node.\n21. A non-transitory computer-readable storage medium storing instructions that when executed by a computer cause the computer to perform a method for forwarding a packet with a hierarchically structured variable-length identifier (HSVLI) in a network, the method comprising: \nreceiving a packet which contains an interest for a piece of content, wherein the interest includes an address-independent HSVLI; \nwherein the HSVLI identifies a specific piece of content without identifying a network address or a storage location for the piece of content, and wherein the HSVLI is hierarchically structured and comprises contiguous name components associated with the piece of content ordered from a most general level to a most specific level; and \ndetermining forwarding information for the packet based on the HSVLI, wherein determining the forwarding information involves: \nidentifying a forwarding information entry that has the longest prefix match with the HSVLI by matching the name components of the HSVLI with the name components of the forwarding information entries, wherein the longest prefix match has the largest number of matched name components; and \ndetermining, from the identified forwarding information entry, one or more interfaces for forwarding the interest; and \nforwarding the packet to one or more of the determined interfaces. \n22. The storage medium of claim 21, wherein determining the forwarding information for the HSVLI further involves selecting the forwarding information based on knowledge of content which matches the HSVLI, and wherein knowledge of content which matches the HSVLI comprises one or more of: \nlocation of content which matches the HSVLI; \navailability of content which matches the HSVLI; and \nimportance or priority of content which matches the HSVLI. \n23. The storage medium of claim 22, \nwherein one or more components of the HSVLI comprise a domain name system (DNS) name; and \nwherein determining the forwarding information comprises determining an output interface based on the DNS name in the HSVLI. \n24. The storage medium of claim 21, wherein determining the forwarding information for the HSVLI further involves selecting the forwarding information based on a forwarding policy, and wherein the forwarding policy comprises one or more of: \na policy rule on content which matches the HSVLI; \na security constraint on content which matches the HSVLI; and \na strategy rule to discover a source of content which matches the HSVLI. | 24 | 1. A computer-implemented method for forwarding a packet with a hierarchically structured variable-length identifier (HSVLI) in a network, wherein the computer includes a processor, the method comprising: \nreceiving a packet which contains an interest for a piece of content, wherein the interest includes an address-independent HSVLI; \nwherein the HSVLI identifies a specific piece of content without identifying a network address or a storage location for the piece of content, and wherein the HSVLI is hierarchically structured and comprises contiguous name components ordered from a most general level to a most specific level; and \ndetermining forwarding information for the packet based on the HSVLI, wherein determining the forwarding information involves: \nidentifying a forwarding information entry that has the longest prefix match with the HSVLI by matching the name components of the HSVLI with the name components of the forwarding information entries, wherein the longest prefix match has the largest number of matched name components; and \ndetermining, from the identified forwarding information entry, one or more interfaces for forwarding the interest; and \nforwarding the packet to one or more of the determined interfaces. | 1. A computer-implemented method for forwarding a packet with a hierarchically structured variable-length identifier (HSVLI) in a network, wherein the computer includes a processor, the method comprising: receiving a packet which contains an interest for a piece of content, wherein the interest includes an address-independent HSVLI; wherein the HSVLI identifies a specific piece of content without identifying a network address or a storage location for the piece of content, and wherein the HSVLI is hierarchically structured and comprises contiguous name components ordered from a most general level to a most specific level; and determining forwarding information for the packet based on the HSVLI, wherein determining the forwarding information involves: identifying a forwarding information entry that has the longest prefix match with the HSVLI by matching the name components of the HSVLI with the name components of the forwarding information entries, wherein the longest prefix match has the largest number of matched name components; and determining, from the identified forwarding information entry, one or more interfaces for forwarding the interest; and forwarding the packet to one or more of the determined interfaces. | 11. An apparatus for forwarding a packet with a hierarchically structured variable-length identifier (HSVLI) in a network comprising: a processor; a memory; a receiving mechanism configured to receive a packet which contains an interest for a piece of content, wherein the interest includes an address-independent HSVLI; wherein the HSVLI identifies a specific piece of content without identifying a network address or a storage location for the piece of content, and wherein the HSVLI is hierarchically structured and comprises contiguous name components associated with the piece of content ordered from a most general level to a most specific level; and a determining mechanism configured to determine forwarding information for the packet based on the HSVLI, wherein determining the forwarding information involves: configuring a forwarding engine to identify a forwarding information entry that has the longest prefix match with the HSVLI by matching the name components of the HSVLI with the name components of the forwarding information entries, wherein the longest prefix match has the largest number of matched named components; and determining, from the identified forwarding information entry, one or more interfaces for forwarding the interest; and a forwarding mechanism configured to forward the packet to one or more of the determined interfaces. | 21. A non-transitory computer-readable storage medium storing instructions that when executed by a computer cause the computer to perform a method for forwarding a packet with a hierarchically structured variable-length identifier (HSVLI) in a network, the method comprising: receiving a packet which contains an interest for a piece of content, wherein the interest includes an address-independent HSVLI; wherein the HSVLI identifies a specific piece of content without identifying a network address or a storage location for the piece of content, and wherein the HSVLI is hierarchically structured and comprises contiguous name components associated with the piece of content ordered from a most general level to a most specific level; and determining forwarding information for the packet based on the HSVLI, wherein determining the forwarding information involves: identifying a forwarding information entry that has the longest prefix match with the HSVLI by matching the name components of the HSVLI with the name components of the forwarding information entries, wherein the longest prefix match has the largest number of matched name components; and determining, from the identified forwarding information entry, one or more interfaces for forwarding the interest; and forwarding the packet to one or more of the determined interfaces. | BRIEF DESCRIPTION OF THE FIGURES \n\nFIG. 1 illustrates an exemplary network where packets have HSVLIs in accordance with an embodiment.\n\nFIG. 2 illustrates an exemplary system for forwarding a packet with an HSVLI via two different routes to the same network in accordance with an embodiment.\n\nFIG. 3 illustrates an exemplary system for forwarding packets corresponding to two different interests in content in accordance with an embodiment.\n\nFIG. 4 presents an exemplary high-level architecture for forwarding a packet with an HSVLI in accordance with an embodiment.\n\nFIG. 5 presents a flow chart illustrating the process of forwarding a packet with an HSVLI in accordance with an embodiment.\n\nFIG. 6 presents a flow chart illustrating the process of running a discovery protocol to identify a node that provides content and establishes a tunnel thereto, in accordance with an embodiment\n\nFIG. 7 presents an apparatus for forwarding a packet with an HSVLI in accordance with an embodiment.\n\nRELATED APPLICATION \n\nThe subject matter of this application is related to the subject matter in the following applications: \n * U.S. patent application Ser. No. 12/123,344, entitled VOICE OVER CONTENT-CENTRIC NETWORKS, by inventors Paul Stewart, Van Jacobson, Michael Plass, and Diana Smetters, filed May 19, 2008;\n * U.S. patent application Ser. No. 12/332,560, entitled METHOD AND APPARATUS FOR FACILITATING COMMUNICATION IN A CONTENT-CENTRIC NETWORK, by inventor Van Jacobson, filed Dec. 11, 2008; and\n * U.S. patent application Ser. No. 12/565,005, entitled SYSTEM FOR FORWARDING A PACKET WITH A VARIABLE-LENGTH IDENTIFIER, by inventor Van Jacobson, filed Sep. 23, 2009; \n the disclosures of which are incorporated by reference in their entirety herein. \n\nBACKGROUND \n\n1. Field \n\nThe present disclosure relates generally to facilitating communication over a data network. More specifically, the present disclosure relates to adaptive use of multi-interface forwarding equipment in content-centric networking. \n\n2. Related Art \n\nThe proliferation of the Internet and e-commerce continues to fuel revolutionary changes in the network industry. Today, a significant number of information exchanges, from online movie viewing to daily news delivery, retail sales, and instant messaging, are conducted online. An increasing number of Internet applications are also becoming mobile. However, the current Internet operates on a largely location-based addressing scheme. That is, a consumer of content can only receive the content by explicitly requesting the content from an address (e.g., IP address) closely associated with a physical object or location. This restrictive addressing scheme is becoming progressively inadequate for meeting the ever-changing network demands. \n\nThe current architecture of the Internet revolves around a conversation model, which was created in the 1970s for the ARPAnet to allow geographically distributed users to use a few big, immobile computers. This architecture was designed under the influence of the telephone network, where a telephone number is essentially a program that configures the switches along a path from the source to the destination. Not surprisingly, the designers of the ARPAnet never expected it to evolve into today's ubiquitous, relentlessly growing Internet. People now expect a lot more from the Internet than the ARPAnet was designed for. Ideally, an Internet user should have access to any content, anywhere, at any time. Such access is difficult to guarantee with the current location/device-binding IP protocol. \n\nUnder current web-based naming structures, an idea of the host is implicit in the name which contains the corresponding content. For example, http://www.amazon.com/index.html can be found by contacting the machine www.amazon.com. However, this contact requires a domain name system (DNS) to translate a human-readable host name into an IP address (e.g., 209.34.123.178). In current computer systems, there is no way to refer to a piece of content without knowing what host that file is stored on, and even then the contents associated with that file might change. \n\nIn the current technology, forwarding is the process by which a node in a packet-switched network transmits a packet from a source to a destination. An Internet Protocol (IP) router typically receives a packet at one of its input ports (e.g., a network interface). Next, the router performs a lookup to identify an output port to which the packet should be forwarded based on the packet's destination address. However, existing routers do not provide a way to configure the forwarding engine to forward content interests that do not use conventional IP addresses. \n\nSUMMARY \n\nOne embodiment provides a system that forwards a packet with a hierarchically structured variable-length identifier (HSVLI) in a network. An HSVLI indicates a piece of content and indicates a hierarchical structure of contiguous components ordered from a most general level to a most specific level. The length of the HSVLI is not fixed. During operation, the system receives a packet which contains an interest for a piece of content with an HSVLI. Subsequently, the system determines forwarding information for the HSVLI based on one or more of: knowledge of content which matches the HSVLI, a forwarding policy, and contextual information about the network. Next, the system configures a forwarding engine with the forwarding information. The system then forwards the packet based on the forwarding information. \n\nIn some embodiments, knowledge of content which matches the HSVLI includes one or more of: location of content which matches the HSVLI, availability of content which matches the HSVLI, and importance or priority of content which matches the HSVLI. \n\nIn some embodiments, one or more components of the HSVLI include a domain name system (DNS) name, and determining the forwarding information includes determining an output interface based on the DNS name in the HSVLI. \n\nIn some embodiments, the policy includes one or more of: a policy rule on content which matches the HSVLI, a security constraint on content which matches the HSVLI, and a strategy rule to discover a source of content which matches the HSVLI. \n\nIn some embodiments, contextual information includes information about one or more of: physical layer connectivity, which includes a WiFi connectivity, a local-area network (LAN) connectivity, a wide-area network (WAN) connectivity, and other wired or wireless connectivity; a peer node which is likely to store content which matches the HSVLI; network costs; network latency; and battery status. \n\nIn some embodiments, the configuration of the forwarding engine with the forwarding information is in response to one or more of: a status change of the local network, execution of a routing protocol based on information received from another node in the network, and receiving statistical information indicating delay associated with one or more output interfaces. \n\nIn some embodiments, the system periodically or continually updates a database used to determine forwarding information by discovering nodes in the network, and establishing a secure tunnel with a discovered node to receive the content. \n\nIn some embodiments, the hierarchical structure includes one or more of: a globally routable name, an organizational name, a version identifier, and a digest. \n\nIn some embodiments, the system forwards a packet through multiple output interfaces simultaneously. \n\nIn some embodiments, the system receives contextual and policy information from a node and virally propagates the contextual and policy information to another node. \n\nIn the figures, like reference numerals refer to the same figure elements. \n\nThe following description is presented to enable any person skilled in the art to make and use the embodiments, and is provided in the context of a particular application and its requirements. Various modifications to the disclosed embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be applied to other embodiments and applications without departing from the spirit and scope of the present disclosure. Thus, the present invention is not limited to the embodiments shown, but is to be accorded the widest scope consistent with the principles and features disclosed herein. \n\nDETAILED DESCRIPTION \n\nOverview \n\nEmbodiments of the present invention integrate different information flows to make decisions about how to configure forwarding of interests in particular content collections given multiple simultaneous connectivity options. Specifically, embodiments of the present invention facilitate configuring a forwarding engine that receives interests in content rather than addresses, where the configuration can be based on knowledge of the content, forwarding policies, and contextual information about the network. Embodiments of the present invention also facilitate finer-grained decision-making among multiple forwarding options. \n\nContent centric networkswhere routing is based on interests rather than addressesbring a new approach to content transport. Instead of having network traffic viewed at the application level as end-to-end conversations over which content travels, content is requested or returned based in part on the name given to it, and the network is responsible for routing content from the provider to the consumer. Content includes data that can be transported in the communication system, and can be any form of data such as text, images, video, and/or audio. A consumer and a provider can be a person at a computer or an automated process inside or outside the network. In such a network, a piece of content can refer to the entire content or a respective portion of the content. For example, a newspaper article might be represented by multiple pieces of content embodied as data packets. A piece of content can also be associated with metadata describing or augmenting the piece of content with information such as authentication data, creation date, content owner, etc. \n\nIn content-centric networks, unlike a conventional IP network, a packet may be identified by an HSVLI. For example, abcd/bob/papers/ccn/news could be the name of the content and identifies the corresponding packet(s); i.e., the news article from the ccn collection of papers for a user named Bob at the organization named ABCD. \n\nTo request a piece of content, a node expresses (e.g., broadcasts) an interest in that content by the content's name. An interest in a piece of content can be a query for the content according to the content's name or identifier. The content, if available in the network, is routed back to it from any node that stores the content. The routing infrastructure intelligently propagates the interest to the prospective nodes that are likely to have the information and then carries available content back along the path which the interest traversed. \n\nFIG. 1 illustrates an exemplary architecture of a network, in accordance with an embodiment of the present invention. In this example, a network 180 comprises nodes 100-145. Each node in the network is coupled to one or more other nodes. Network connection 185 is an example of such a connection. The network connection is shown as a solid line, but each line could also represent sub-networks or super-networks which can couple one node to another node. Network 180 can be a local network, a super-network or a sub-network. Each of these networks can be interconnected so that a node in one network can reach a node in other networks. The network connection can be broadband, wireless, telephonic, satellite, or any type of network connection. A node can be a computer system, an end-point representing users, and/or a device that can generate interests or originate content.\n\nIn accordance with an embodiment of the present invention, a consumer can generate an interest in a piece of content and then send that interest to a node in network 180. The piece of content can be stored at a node in network 180 by a publisher or content provider, who can be located inside or outside the network. For example, in FIG. 1, the interest in a piece of content originates at node 105. If the content is not available at the node, the interest flows to one or more nodes coupled to the first node. For example, in FIG. 1, the interest flows (interest flow 150) to node 115, which does not have the content available. Next, the interest flows (interest flow 155) from node 105 to node 125, which again does not have the content. The interest then flows (interest flow 160) to node 130, which does have the content available. The flow of the content then retraces its path in reverse (content flows 165, 170, and 175) until it reaches node 105, where the content is delivered. Other processes such as authentication can be involved in the flow of content.\n\nIn network 180, any number of intermediate nodes (nodes 100-145) in the path between a content holder (node 130) and the interest generation node (node 105) can participate in caching local copies of the content as it travels across the network. Caching reduces the network load for a second subscriber located in proximity to other subscribers by implicitly sharing access to the locally cached content\n\nConventional packet forwarding is based on addresses assigned to nodes (or interfaces of nodes). In IP addressing, a hierarchical division of addresses is used so that the first portion of an address identifies a network, later portions identify a sub-network within that network, and the end of the address identifies a particular host within a sub-network. This arrangement allows the responsibility for assigning unique addresses to be delegated and thereby distributed so that the Internet can scale to worldwide size. It also enables scaling by limiting the amount of information an IP router needs to process when forwarding a packet to an output port. \n\nIn one embodiment, a packet is identified by an HSVLI with a hierarchical structure. The hierarchical structure of this HSVLI offers several advantages over the hierarchical structure of an IP address. Such an identifier can describe the structure explicitly through the name rather than implicitly through an IP routing table entry, which includes a subnet mask. Thus, in an HSVLI a naming mistake in the hierarchy can be detected through inspection, whereas an IP-based subnet mask mistake might route a packet to the wrong address and is more difficult to detect. \n\nThe forwarding engine can use various methods for matching the interest against an entry associated with forwarding information. For example, embodiments of the present invention can use a longest-prefix match lookup, which can be beneficial to the forwarding of packets with HSVLIs. For example, an interest in /parc/home/smetters will match both /parc/home/smetters/test.txt and /parc/home/smetters/bar.txt (that is, the packets identified by both these names). The longest match, in terms of the number of name components, is considered the best because it is the most specific. \n\nEmbodiments of the present invention use HSVLI-based routing process described above, with content retracing the interest path in reverse and caching at nodes. This novel routing mechanism can effectively prevent packet looping. A node can determine when a duplicate packet arrives by an alternate path and refuse to forward it. Thus it is not necessary to have the restriction of forwarding only based on a spanning tree, because multiple and possibly circular paths cannot cause packet looping and hence cost little. A node may identify and use multiple possible paths towards potential sources of content at once, which enables a variety of strategies that are not possible with conventional IP routing, where multicast-like routing or flooding is prohibited. For any particular content collection, there may be not just one but several possible options of interfaces over which to forward interests in the collection and they may have different properties. Embodiments of the present invention provide a means for configuring the forwarding engine to implement the best strategies for different situations. \n\nIn some embodiments of the present invention, the system can identify and simultaneously forward a packet along multiple paths toward potential sources of content. This simultaneous forwarding enables the system to accomplish a variety of strategies that are not possible with IP. For example, each path toward the content may have different properties, which the system can subsequently use for configuring the forwarding engine. \n\nMulti-Interface Connectivity Model \n\nFIG. 2 illustrates an exemplary system for forwarding a packet with an HSVLI via two different routes to the same network in accordance with an embodiment. In this example, a mobile device 200 is coupled to a wireless router 210 through an interface 230. Note that an interface can correspond to a port from which interests are sent and content is received. In turn, wireless router 210 is coupled to a network 220, which can be a content centric network, through a network connection 240. Mobile device 200 expresses an interest 250 in a piece of available content. Mobile device 200 can broadcast interest 250 over all available connectivity including but not limited to Wi-Fi, Bluetooth® and wireless carrier connections (i.e., cellular network connections). Any network node receiving the interest and having the content which matches the interest can respond. FIG. 2 shows that network 220 responds with content 260, which is forwarded through wireless router 210, back to mobile device 200.\n\nOne example of the criteria used in choosing an interface is the responsiveness to previous similar interests over that same interface. For example, in FIG. 2, interest 250 may initially be broadcast simultaneously on both interfaces 230 and 270. The system may then discover that content matching the interest is received faster through interface 270. The system will further forward subsequent interests 280-1, 2, 3, . . . only through interface 270 but not on interface 230. This example illustrates that the system can change its forwarding information based on the time it takes to receive matching content.\n\nThe system can also change its forwarding for an interest based on the cost of forwarding. An example of a policy leading to such a forwarding decision is a user preferring to access a large file over an available Wi-Fi hot spot connection instead of a more expensive carrier network. \n\nFIG. 2 also illustrates a sequence of interests 280-1, 2, 3, . . . . Although the system broadcasts interest 250 through interfaces 230 and 270, the system decides to forward subsequent interests 280-1, 2, 3, . . . through interface 270. In addition, the system may also decide to forward these interests to interface 230 because of a better network condition such as lower latency. The system may determine this lower latency based on the content returned in response to interest 250 which is previously broadcast on interfaces 230 and 270. The system can also forward individual interests alternately on one interface or the other, or send them simultaneously over multiple interfaces using various multicast suppression techniques. For example, the system can continuously probe for better connectivity and forward interests according to the result of that probe. Note that in response to interests 280-1, 2, 3, . . . , the network returns content 290-1, 2, 3, . . . via interface 270 back to mobile device 200.\n\nFIG. 3 illustrates an exemplary system for forwarding packets corresponding to two different interests in content in accordance with an embodiment. In this example, mobile device 200 expresses an interest in content from two different namespaces (parc.com and /photo/ca/baybridge) and pulls content from those two different namespaces over interface 230 and an interface with secure link 340 simultaneously. Such an example might arise if a user needs a secure tunnel to access /parc.com/jim while pulling pictures of the San Francisco Bay Bridge over a public Wi-Fi connection. A web server 310 for namespace /photo/ca/baybridge returns content matching an interest in pictures of the San Francisco Bay Bridge. A secure server 350 for namespace parc.com returns content matching an interest in /parc.com/jim.\n\nEmbodiments of the present invention can configure the forwarding engine to forward interest packets over single or multiple interfaces, permitting fine-grained dynamic choices among multiple interfaces at a low level. \n\nArchitecture for Forwarding Interest Packets \n\nFIG. 4 presents a high-level architecture illustrating the process of forwarding interest packets with an HSVLI in accordance with an embodiment. In this example, a packet forwarding system includes a forwarding engine 400 and a connectivity agent 405. Forwarding engine 400 includes a forwarding information base (FIB) 410, a strategy layer 415, and ports 420-A to 420-D, which are coupled respectively to an application 430, a wireless router 435, a mobile device 440, and a locked mobile device 445. In FIG. 4, bi-directional arrows between components denote two-way communication, programmable capabilities between a source and a destination arrow, or statistical feedback. Note that a port has an input side (i.e., an input port) and an output side (e.g., an output port).\n\nFIB 410 is a database that can facilitate a lookup by a longest-match name prefix to determine which interface(s) an interest can be forwarded to. A strategy layer 415, which can be hardware or software, makes the fine-grained, packet-by-packet decision among multiple interfaces when the lookup produces multiple interfaces. Note that ports can communicate with individual applications, local networks, or with channels or tunnels, such as secure encrypted links.\n\nConsider an interest arriving at port 420-A in forwarding engine 400. Typically, forwarding engine 400 includes a content store (CS, not shown) which is a local cache of previously received content. Assuming that the new interest arriving on port 420-A does not match any content in the CS, the interest is sent to FIB 410 for lookup. The system can use various lookup methods such as a longest-prefix match or an exact match. If the system does not find a match in FIB 410, the interest is sent to connectivity agent 405. Connectivity agent 405 can configure FIB 410 with forwarding information about a new content collection, assuming that the connectivity agent is able to identify a direction (e.g. interface/tunnel) toward that content collection.\n\nIn one embodiment, connectivity agent 405 determines one or more entries to be inserted into FIB 410, which indicate how to forward the interest based on the interest, content, and/or forwarding policy. The system can then re-inject the interest to forwarding engine 400, which can ensure a match for the interest.\n\nIf connectivity agent 405 cannot determine a way to forward the interest and reach the content collection, the interest can be discarded. Note that if the system is unable to match an interest in FIB 410, the system does not immediately discard the interest. Instead, the system transfers the interest to connectivity agent 405, which permits dynamic actions to identify a path that is not previously configured in FIB 410. For example, connectivity agent 405 can perform a domain name system (DNS) lookup on a prefix of the HSVLI associated with the interest for dynamic overlay routing in the public Internet. Forwarding engine 400 can still be configured to discard unmatched interests, for example, when the connectivity agent is not running.\n\nIf the system identifies a match for the interest in FIB 410, the interest and the corresponding one or more output port(s) can be sent to strategy layer 415. Strategy layer 415 uses the results of a successful lookup in FIB 410 to determine which output ports to use for the interest. Note that the system can still send the interest to the connectivity agent 405 despite a match being found in FIB 410. This operation facilitates opportunistic local broadcast to find content as well as dynamic configuration of specific paths to the content collection.\n\nConnectivity agent 405 can control the implemented policy by configuring strategy layer 415 without having to process each individual packet. In one embodiment, connectivity agent 405 can configure strategy layer 415 with rules for choosing among multiple interfaces. For example, such rules can specify priority-based interface selection, a round-robin-sequence-based interface selection, or interface priorities based on fine-grained response timing. In another embodiment, configuration agent 405 can install an executable program in strategy layer 415 so that strategy layer 415 can execute the program to handle packets. Executable programs enable strategy layer 415 to have fine-grained control over where to forward packets.\n\nVarious methods can be used to configure forwarding engine 400 to transfer an interest to connectivity agent 405. For example, using longest-prefix matching, a zero-length prefix entry in FIB 410 will match any interest that does not match a longer regular entry. An interest that matches the zero-length prefix will cause the interest to be forwarded to the connectivity agent using normal processing (i.e., forwarding through an output port). Similarly, an interface associated with connectivity agent 405 can be added to the list for any entry in FIB 410. Adding this entry can allow configuration for specific paths as well as opportunistic broadcasts. In short, transfer of an interest from forwarding engine 400 to connectivity agent 405 can be through special-case handling in FIB 410 (as when there is no match at all) or through normal entries in FIB 410.\n\nConnectivity Agent \n\nContinuing with FIG. 4, connectivity agent 405 includes a decision layer 450, which sets forwarding rules based on database 455. Database 455 includes knowledge of content 460 which matches the interest (i.e., the HSVLI), forwarding policy 465, and contextual information 470 about the network. Embodiments of the present invention can use connectivity agent 405 to integrate information in database 455 and configure forwarding information base 410 to find content in a dynamic network environment.\n\nKnowledge of content 460 which matches the interest includes information about the content, such the location(s) of the content as may be learned through a routing protocol, availability of content, and immediate importance or priority of content to an end user. There are many different ways to do routing to propagate and discover information about locations and availability of content.\n\nForwarding policy 465 can include policy rules, security constraints on specific collections of content (such as personal information), and generic strategy rules (e.g., try all output ports to discover the fastest source of content in a collection). The system can identifying particular collections based on the prefix of the HSVLI and can associate a policy rule, a constraint, and a strategy with that prefix.\n\nContextual information 470 about the network can include information about available physical layer connections (Wi-Fi, LAN, carrier network, etc.), knowledge of peers, network costs, network latency, and battery status. For interests sent from forwarding engine 400 to decision layer 450, decision layer 450 can interact with database 455 to determine how to configure FIB 410 to control the forwarding of the outgoing interest toward content that can match the interest.\n\nDecision layer 450 can aggregate information from knowledge of content 460, forwarding policy 465, and contextual information 470. Based on the information available in database 455, connectivity agent 405 can set up the configuration for a new port, for example by creating a tunnel connection over the public Internet.\n\nAs an example, consider the arrival of an interest in www.google.com/michaeljackson/photo/ on port 420-A. The system can perform the following operation to create a new port. The system first receives the interest, which cannot be satisfied by any content in the CS. The system then looks up the interest in FIB 410. If the system does not find a match in FIB 410, the system sends the interest to connectivity agent 405. Within connectivity agent 405, decision layer 450 aggregates information about the content, policy, and available networks from database 455. Specifically, connectivity agent 405 uses knowledge of content 460 (e.g., when the prefix of the identifier associated with the interest's HSVLI is a DNS name), forwarding policy 465 (e.g., try local, use shortest delay or least round trip time, or no constraints on the given collection), and contextual information 470 (e.g., Wi-Fi and adjacent network nodes) from database 455 to determine how to forward the interest.\n\nIf the interest's HSVLI contains a domain name, connectivity agent 405 then performs a DNS lookup to discover an IP address to which a tunnel may be created for a network overlay transport. Decision layer 450 then configures forwarding engine 400 to create the new tunnel connection via a respective output port. Decision layer 450 further configures the forwarding information base 410 so that an interest in www.google.com will be broadcast first over all available local network ports (to find local copies, if available) and then forwarded (if not already satisfied) on the port corresponding to the overlay tunnel. Subsequently, connectivity agent 405 can re-inject the interest to forwarding engine 400 so that it may be forwarded according to the newly established configuration.\n\nAs a second example, consider an interest in obtaining personal financial reports from www.bankofamerica.com/account/report. Below are the matching criteria within each group that decision layer 450 can use to determine forwarding information. Knowledge of content 480 can use the prefix associated with the interest is a DNS name with content reachable via tunnel. Forwarding policy 465 can determine whether an outside home Wi-Fi network should use a secure encrypted tunnel for a prefix matching www.bankofamerica.com/account/report. Contextual information 470 can determine an available airport Wi-Fi and/or a carrier network. Connectivity agent 405 can now configure forwarding engine 400 to use a secure tunnel over port 420-c and adding a FIB entry so that these interests are forwarded port 420-c to ensure that no information about the requests is revealed.\n\nOverall System Operation \n\nFIG. 5 presents a flow chart illustrating the process of forwarding a packet with an HSVLI in accordance with an embodiment. During operation, the system receives a packet which contains an interest for a piece of content with an HSVLI (operation 500). For example, the system can receive the packet at connectivity agent 405 from the forwarding engine 400 or from any port associated with the system. Subsequently, the system determines forwarding information for the HSVLI based on one or more of: knowledge of content 460 which matches the HSVLI, forwarding policy 465, and contextual information 470 about the network (operation 510). Next, the system configures a forwarding engine with the forwarding information (operation 520).\n\nConfiguring th... | Palo Alto Research Center Incorporated,Palo Alto,CA,US | Jacobson Van L.,Woodside,CA,US | Thornton James D.,Redwood City,CA,US | Palo Alto Research Center Incorporated | Jacobson Van L. | Thornton James D. | CISCO SYSTEMS INC. | CISCO SYSTEMS INC. | Jacobson, Van L. | Thornton, James D. | 2 | Yao, Shun | Park, Vaughan, Fleming & Dowler LLP | NaN | Smith, Marcus R | US | Dead | 12 | 2014 | US | 10 | 2009 | 2009-10-21 | 2009 | G06, H04 | H04, G06 | 370392 | US20070239892A1 | US20110016307A1 | US20050198351A1 | US6981029B1 | US20100169503A1 | US20100281051A1 | 6 | Fall, K. et al., DTN: an architectural retrospective, Selected areas in communications, IEEE Journal on, vol. 28, No. 5, Jun. 1, 2008, pp. 828-835. DOI:10.1109/JSAC.2008.080609 49 | Gritter, M. et al., An Architecture for content routing support in the Internet, Proceedings of 3rd Usenix Symposium on Internet Technologies and Systems, 2001, pp. 37-48. 7 | 2 | US10003507B2 | US10003520B2 | US10009266B2 | US10027578B2 | US10033639B2 | US10033642B2 | US10038633B2 | US10043016B2 | US10051071B2 | US10063414B2 | US10063476B2 | US10067948B2 | US10069729B2 | US10069933B2 | US10075401B2 | US10075402B2 | US10084764B2 | US10091012B2 | US10091330B2 | US10097346B2 | US10098051B2 | US10103989B2 | US10104041B2 | US10122624B2 | US10122632B2 | US10129368B2 | US10135948B2 | US10148572B2 | US10158656B2 | US10212196B2 | US10212205B2 | US10212248B2 | US10237075B2 | US10237189B2 | US10243851B2 | US10257271B2 | US10263965B2 | US10305864B2 | US10305865B2 | US10305968B2 | US10313227B2 | US10320675B2 | US10320760B2 | US10333840B2 | US10348865B2 | US10355999B2 | US10367871B2 | US10404450B2 | US10404537B2 | US10419345B2 | US10425503B2 | US10440161B2 | US10445380B2 | US10447805B2 | US10454820B2 | US10469378B2 | US10547589B2 | US10547661B2 | US10554553B2 | US10581741B2 | US10581967B2 | US10693852B2 | US10701038B2 | US10715634B2 | US10721332B2 | US10742596B2 | US10841212B2 | US10897518B2 | US10956412B2 | US11190446B2 | US11436656B2 | US20150039681A1 | US20150222424A1 | US20150270957A1 | US20150281083A1 | US20150304380A1 | US9407432B2 | US9473576B2 | US9590887B2 | US9590948B2 | US9609014B2 | US9621354B2 | US9626413B2 | US9660825B2 | US9686194B2 | US9699198B2 | US9716622B2 | US9729616B2 | US9729662B2 | US9749384B2 | US9800637B2 | US9832116B2 | US9832123B2 | US9832291B2 | US9836540B2 | US9882964B2 | US9912776B2 | US9916457B2 | US9917918B2 | US9929935B2 | US9930146B2 | US9946743B2 | US9954678B2 | US9954795B2 | US9977809B2 | US9986034B2 | US9992097B2 | US9992281B2 | 108 | 2023-02-28 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - 2022-12-30 | 2023-02-06 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | 2022-08-22 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | 2018-07-02 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) FEE PAYMENT YEAR 4 | 2017-02-14 AS ASSIGNMENT CISCO SYSTEMS, INC., CALIFORNIA ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:PALO ALTO RESEARCH CENTER INCORPORATED;REEL/FRAME:041714/0373 2017-01-10 | 2017-02-14 AS ASSIGNMENT CISCO TECHNOLOGY, INC., CALIFORNIA ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:CISCO SYSTEMS, INC.;REEL/FRAME:041715/0001 2017-02-10 | 2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE | 2009-10-21 AS ASSIGNMENT PALO ALTO RESEARCH CENTER INCORPORATED, CALIFORNIA ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:JACOBSON, VAN L.;THORNTON, JAMES D.;REEL/FRAME:023405/0243 2009-10-21 | US8923293B2 | CN102045252A | CN102045252B | EP2323346A1 | EP2323346B1 | JP05855817B2 | JP2011091802A | KR1607879B1 | KR2011043476A | US20110090908A1 | US20150113163A1 | US9686194B2 | 20110421US20110090908A1 |
| 2777 | US8924092B2 | Down and/or up force adjustment system | US2011479543P | US2011479537P | US2011479540P | WO2012US35518A | US13457577A | US13458012A | 2011-04-27 | 2011-04-27 | 2011-04-27 | 2012-04-27 | 2012-04-27 | 2012-04-27 | US13457815A | 2012-04-27 | B2 | 2014-12-30 | Achen Courtney N.|Iowa City, IA, US | Bachman Marvin L.|Marengo, IA, US | Stevenson Vaughan G.|Williamsburg, IA, US | Kinze Manufacturing Inc.,Williamsburg,IA,US | Achen Courtney N.,Iowa City,IA,US | Bachman Marvin L.,Marengo,IA,US | Stevenson Vaughan G.,Williamsburg,IA,US | KINZE MANUFACTURING INC. | P11 N | NaN | A01B004904 | A01B0063111 | A01B006300 | A01C000506 | A01C000720 | A01C002100 | A01B0063008 | A01B004904 | A01B004906 | A01B007102 | A01B007600 | A01B0079005 | A01C0005062 | A01C0005064 | A01C0007203 | A01C0007205 | A01C002100 | Y10S011190 | Y10S0111903 | 701050 | 111069 | 111200 | 111903 | NaN | An agricultural device includes a number of row units that each includes a seed furrow opener that creates a furrow in the soil for seed placement. Each row unit is mounted to a toolbar of the device by a four-bar linkage which allows each row unit to move vertically to adjust to the contour of the soil independently of the other row units on the same toolbar. The four-bar linkages include one or more springs which work to transfer weight from the toolbar to the row unit. An actuator varies the tension in the spring thereby adjusting the down or up force applied to the row unit. | Down and/or up force adjustment system | What is claimed is: \n1. An agricultural device comprising: \na toolbar; \na row unit; \na linkage coupling the row unit to the toolbar, wherein the linkage includes a first arm and a second arm, and wherein each of the first arm and the second arm includes a first end coupled to the toolbar and a second end coupled to the row unit; \nan actuator coupled to the toolbar; \na biasing member coupled to the linkage and the actuator, wherein the actuator is adapted to move the biasing member to vary an amount of force applied to the row unit; \na first sensor adapted to sense a force applied to the row unit; and \na second sensor adapted to sense a characteristic of a soil upon which the row unit travels. \n2. The agricultural device of claim 1, wherein the actuator moves the biasing member in a first direction to apply a down force to the row unit and moves the biasing member in a second direction to apply an up force to the row unit, and wherein the first and second directions are different directions.\n3. The agricultural device of claim 1, wherein the actuator is one of: \nan electric actuator; \na hydraulic actuator; \na pneumatic actuator; and \na screw drive actuator. \n4. The agricultural device of claim 1, further comprising a sensor adapted to sense a position of the biasing member.\n5. The agricultural device of claim 4, wherein the sensor generates a signal associated with the position of the biasing member, and the agricultural device further comprising a processing unit in communication with the sensor to receive the signal and determine whether adjustment of the biasing member is necessary based on the signal.\n6. The agricultural device of claim 5, further comprising a user interface in communication with the processing unit, and wherein any necessary adjustment required is communicated to the user interface by the processing unit and is displayed on the user interface.\n7. The agricultural device of claim 5, wherein the processing unit communicates with the actuator to adjust the biasing member based on the signal.\n8. The agricultural device of claim 1, wherein the first sensor adapted to sense a force applied to the row unit comprises a load cell, a pressure sensor, a potentiometer, or some combination thereof.\n9. The agricultural device of claim 8, wherein the first sensor generates a signal associated with the force applied to the row unit, and the agricultural device further comprising a processing unit in communication with the first sensor to receive the signal and determine whether adjustment of the biasing member is necessary based on the signal.\n10. The agricultural device of claim 8, further comprising a gauge wheel, and wherein the first sensor senses a force applied to a gauge wheel.\n11. The agricultural device of claim 1, wherein the second sensor adapted to sense a characteristic of a soil upon which the row unit travels comprises an ultrasonic sensor, laser sensor, video camera, infra-red sensor, infra-red camera, infra-red scanner, microwave sensor, or some combination thereof.\n12. The agricultural device of claim 11, wherein the second sensor generates a signal associated with the characteristic of the soil, and the agricultural device further comprising a processing unit in communication with the second sensor to receive the signal and determine whether adjustment of the biasing member is necessary based on the signal.\n13. The agricultural device of claim 12, wherein the characteristic of the soil is one of soil temperature, moisture content of soil, depth of a furrow, and soil type.\n14. The agricultural device of claim 11, wherein the second sensor is positioned at least partially behind a pair of furrow-opening discs.\n15. The agricultural device of claim 1, wherein the first arm is a top arm and the second arm is a bottom arm of the linkage, and wherein the first arm and second arm are vertically spaced apart and positioned substantially parallel to each other relative to their longitudinal extents.\n16. The agricultural device of claim 15, wherein the biasing member is a spring and includes a first end coupled to the bottom arm and a second end coupled to the actuator.\n17. A row unit adjustment system for use with an agricultural planter for planting seeds, the agricultural planter including a toolbar, a row unit coupled to the toolbar by a linkage, the row unit adjustment system comprising: \nan actuator including an adjustment member; \na biasing member coupled to the linkage and the adjustment member; \na plurality of sensors each adapted to sense a separate characteristic associated with planting seeds and to generate a signal associated with each of the sensed characteristics; and \na processing unit receiving the signals associated with the sensed characteristics and determining whether adjustment of the biasing member is necessary based on the signals. \n18. The row unit adjustment system of claim 17, wherein a first characteristic is a position of the biasing member and the signal is associated with the position of the biasing member.\n19. The row unit adjustment system of claim 18, wherein a second characteristic is a characteristic of a soil upon which the agricultural planter travels.\n20. The row unit adjustment system of claim 19, wherein the second characteristic of the soil is one of soil temperature, moisture content of soil, depth of a furrow, and soil type.\n21. The row unit adjustment system of claim 20, wherein a third characteristic is a force applied to the row unit.\n22. A method of adjusting a force applied to a row unit of an agricultural planter, the agricultural planter including a toolbar and the row unit including a linkage coupling the row unit to the agricultural planter, the method comprising: \nproviding an actuator including an adjustment member; \ncoupling a biasing member at a first end to the linkage and at a second end to the adjustment member; \nsensing a plurality of characteristics associated with planting with a plurality of sensors; \ngenerating a signal associated with the characteristics with the sensors; \ncommunicating the signal to a processing unit; and \nadjusting a position of the biasing member with the actuator based on the signal received by the processing unit in order to adjust a force applied to the row unit. \n23. The method of claim 22, wherein sensing a plurality of characteristics includes sensing multiple of a position of the biasing member, a characteristic of a soil upon which the agricultural planter travels, and a force applied to the row unit.\n24. The method of claim 22, wherein adjusting a position of the biasing member further includes manually adjusting a position of the biasing member after displaying information associated with the signal on a user interface.\n25. The method of claim 22, wherein adjusting a position of the biasing member further includes automatically adjusting a position of the biasing member with the processing unit based on the signal received by the processing unit. | 25 | 1. An agricultural device comprising: \na toolbar; \na row unit; \na linkage coupling the row unit to the toolbar, wherein the linkage includes a first arm and a second arm, and wherein each of the first arm and the second arm includes a first end coupled to the toolbar and a second end coupled to the row unit; \nan actuator coupled to the toolbar; \na biasing member coupled to the linkage and the actuator, wherein the actuator is adapted to move the biasing member to vary an amount of force applied to the row unit; \na first sensor adapted to sense a force applied to the row unit; and \na second sensor adapted to sense a characteristic of a soil upon which the row unit travels. | 1. An agricultural device comprising: a toolbar; a row unit; a linkage coupling the row unit to the toolbar, wherein the linkage includes a first arm and a second arm, and wherein each of the first arm and the second arm includes a first end coupled to the toolbar and a second end coupled to the row unit; an actuator coupled to the toolbar; a biasing member coupled to the linkage and the actuator, wherein the actuator is adapted to move the biasing member to vary an amount of force applied to the row unit; a first sensor adapted to sense a force applied to the row unit; and a second sensor adapted to sense a characteristic of a soil upon which the row unit travels. | 17. A row unit adjustment system for use with an agricultural planter for planting seeds, the agricultural planter including a toolbar, a row unit coupled to the toolbar by a linkage, the row unit adjustment system comprising: an actuator including an adjustment member; a biasing member coupled to the linkage and the adjustment member; a plurality of sensors each adapted to sense a separate characteristic associated with planting seeds and to generate a signal associated with each of the sensed characteristics; and a processing unit receiving the signals associated with the sensed characteristics and determining whether adjustment of the biasing member is necessary based on the signals. | 22. A method of adjusting a force applied to a row unit of an agricultural planter, the agricultural planter including a toolbar and the row unit including a linkage coupling the row unit to the agricultural planter, the method comprising: providing an actuator including an adjustment member; coupling a biasing member at a first end to the linkage and at a second end to the adjustment member; sensing a plurality of characteristics associated with planting with a plurality of sensors; generating a signal associated with the characteristics with the sensors; communicating the signal to a processing unit; and adjusting a position of the biasing member with the actuator based on the signal received by the processing unit in order to adjust a force applied to the row unit. | RELATED APPLICATIONS \n\nThe present application claims the benefit of U.S. Provisional Patent Application Nos. 61/479,540, filed Apr. 27, 2011, 61/479,537, filed Apr. 27, 2011, and 61/479,543, filed Apr. 27, 2011, the contents of all are hereby incorporated herein by reference. \n\nBRIEF DESCRIPTION OF THE DRAWINGS \n\nThe appended claims set forth those novel features which characterize the invention. However, the invention itself, as well as further objects and advantages thereof, will best be understood by reference to the following detailed description of an exemplary embodiment, taken in conjunction with the accompanying drawings, where like reference characters identify the elements throughout the various figures in which: \n\nFIG. 1 is a side elevation view of a portion of an exemplary planter row unit, the exemplary row unit including an exemplary down force adjustment system;\n\nFIG. 2 is a side elevation view similar to FIG. 1 showing a down force spring of an exemplary down force adjustment system adjusted to provide a negative down force on the row unit;\n\nFIG. 3 is a side elevation view similar to FIGS. 1 and 2 showing a down force spring of an exemplary down force adjustment system adjusted to provide a positive down force on the row unit;\n\nFIG. 4 is an exemplary system diagram of the present invention; and\n\nFIG. 5 is a side elevation view of a portion of an exemplary planter row unit including an exemplary soil characteristic sensor.\n\nFIELD OF THE INVENTION \n\nThis invention relates generally to agricultural devices and, more particularly, to down force adjustment of a row unit of an agricultural device. \n\nBACKGROUND \n\nImplements for planting row crops, such as corn and soybeans, (planters) typically include row units laterally spaced along a frame, or toolbar. The row units generally include a seed channel opener that creates a channel or furrow in the soil for seed placement. Each row unit is mounted to the toolbar by means of a four-bar linkage or its equivalent which allows each row unit to move vertically to adjust to the contour of the soil independently of the other row units on the same toolbar. Some planters have springs in the four-bar linkage which work to transfer weight from the planter's frame to the row unit creating down force to help the seed channel opener penetrate the soil and to minimize row unit bounce in rough soil conditions. Insufficient down force can result in a seed furrow of inadequate depth or a seed furrow simply not formed, which in turn results in shallow seed placement or seed placement on the soil surface. However, too much down force could overly compact the seed bed or form the seed furrow too deep, which could negatively affect early plant development. Furthermore, excessive down force could accelerate wear on the row units' soil-engaging components. The springs can be adjusted to adjust the down force of the row unit. This adjustment usually is made by manually changing the position of the springs in the four-bar linkage. \n\nIn other planters, airbags are employed in the four-bar linkage which are similarly adapted to transfer weight from the planter's frame to the row unit creating down force to help the seed channel opener penetrate the soil and to minimize row unit bounce. In both of these conventional biasing meanssprings and airbagsthe system lacks accuracy and predictability. For instance, when the biasing means is an airbag, it can be difficult to precisely determine the volume of air in the airbag at a given time and, subsequently, determine needed supplemental down force. \n\nIt is desirable to be able to adjust down force on a row unit quickly and accurately so that a consistent seed depth is maintained. It is also desirable to be able to lift the row unit if its own weight is applying too much down force to the soil. \n\nSUMMARY \n\nAccordingly, it is an object of the present invention to provide for a quick and accurate adjustment of the down force on a row unit during planting. \n\nIt is another object of the present invention to provide the capability to put both positive and negative pressure on the row unit. \n\nThese and other objects are achieved by the present invention. In some exemplary aspects of the present invention, a row unit of a planter is provided. The row unit is mounted to a toolbar of a planter by means of a four-bar linkage having a set of top and bottom parallel arms. At least one spring is provided between the top and bottom arms and connected at one end to the bottom arm in a fixed manner at a connection point. The other end of the spring is connected to a spring mount that is disposed on the top arm and coupled to an electric actuator. The spring mount is longitudinally movable in both directions of the top arm. The electric actuator moves the spring mount forward and backward along the top arm, which adjusts the down or up force placed on the row unit, which in turn can increase or decrease the soil penetration of a seed channel opener component of the row unit, and keep the row unit from bouncing in rough soil conditions. \n\nIn other exemplary aspects, an agricultural device is provided and includes a toolbar, a row unit, a linkage coupling the row unit to the toolbar, wherein the linkage includes a first arm and a second arm, and wherein each of the first arm and the second arm includes a first end coupled to the toolbar and a second end coupled to the row unit, an actuator coupled to the toolbar, and a biasing member coupled to the linkage and the actuator, wherein the actuator is adapted to move the biasing member to vary an amount of force applied to the row unit. \n\nIn further exemplary aspects, a row unit adjustment system for use in an agricultural planter for planting seeds is provided. The agricultural planter includes a toolbar and a row unit coupled to the toolbar by a linkage. The row unit adjustment system includes an actuator including an adjustment member, a biasing member coupled to the linkage and the adjustment member, a sensor adapted to sense a characteristic associated with planting seeds and generate a signal associated with the sensed characteristic, and a processing unit receiving the signal associated with the sensed characteristic and determining whether adjustment of the biasing member is necessary based on the signal. \n\nIn still other exemplary aspects, a method for adjusting a force applied to a row unit of an agricultural planter is provided. The agricultural planter includes a toolbar and the row unit includes a linkage coupling the row unit to the agricultural planter. The method includes providing an actuator including an adjustment member, coupling a biasing member at a first end to the linkage and at a second end to the adjustment member, sensing a characteristic associated with planting with a sensor, generating a signal associated with the characteristic with the sensor, communicating the signal to a processing unit, and adjusting a position of the biasing member with the actuator based on the signal received by the processing unit in order to adjust a force applied to the row unit. \n\nBefore any independent features and embodiments of the invention are explained in detail, it is to be understood that the invention is not limited in its application to the details of the construction and the arrangement of the components set forth in the following description or illustrated in the drawings. The invention is capable of other embodiments and of being practiced or of being carried out in various ways. Also, it is understood that the phraseology and terminology used herein is for the purpose of description and should not be regarded as limiting. \n\nDETAILED DESCRIPTION \n\nThe contents of U.S. patent application Ser. No. 13/458,012, filed Apr. 27, 2012, entitled AGRICULTURAL DEVICES, SYSTEMS, AND METHODS FOR DETERMINING SOIL AND SEED CHARACTERISTICS AND ANALYZING THE SAME, and U.S. patent application Ser. No. 13/457,577, filed Apr. 27, 2012, entitled REMOTE ADJUSTMENT OF A ROW UNIT OF AN AGRICULTURAL DEVICE, are both incorporated herein by reference. \n\nReferring to FIG. 1, there is shown a side elevation view of an exemplary planter row unit 10 in accordance with the principles of the present invention. A single row unit 10 is depicted in the figures and described herein for simplicity, but it is understood that a typical planter 36 (see FIG. 4) includes multiple row units 10. Row unit 10 includes a frame 12. Mounted to the lower section of frame 12 are a pair of furrow-opening discs 14 (one of which is seen in FIGS. 1-3), a pair of depth gauge wheels 16 (one of which is seen in FIGS. 1-3) and a pair of furrow closing wheels (not shown). As is known, seed is stored in a hopper (not shown), fed to and singulated by a meter (not shown) and deposited at desired spacing in the furrow formed by the furrow-opening discs 14. The furrow is then closed and soil is packed about the seed by the closing wheels.\n\nThe row unit 10 is mounted to a toolbar (not shown) by a conventional four-bar linkage 18. Four-bar linkage 18 includes parallel top arms 20 (one of which is seen in FIGS. 1-3) and parallel bottom arms 22 (one of which is seen in FIGS. 1-3) on each side of the row unit 10. The forward ends of the top arms 20 are pivotally connected to an upper portion of a mounting plate 24. Likewise, the forward ends of the bottom arms 22 are pivotally connected to a lower portion of the mounting plate 24. Mounting plate 24 is in turn coupled to the toolbar. A conventional mounting arrangement for attaching the mounting plate 24 to the toolbar would typically include threaded U-shaped bolts and mounting nuts which are not shown in the drawing for simplicity. The rear ends of top and bottom arms 20 and 22 are pivotally connected to row unit frame 12.\n\nThe top and bottom arms 20 and 22 are connected to both the mounting plate 24 and row unit frame 12 by means of a nut and bolt combination which allows the top and bottom arms 20 and 22 to pivot at both ends. The four-bar linkage 18 permits the row unit 10 to move vertically, independently of adjacent row units, while remaining laterally in place on the toolbar.\n\nAt least one linear actuator 26 is mounted to the mounting plate 24 above a top arm 20 of the linkage 18. In other exemplary embodiments, a linear actuator 26 may be provided above each top arm 20 of the linkage 18. Linear actuator 26 can be of an electric, hydraulic or air type, having a shaft 28 that extends longitudinally parallel to the top arm 20. A mounting bracket 30 is provided on top arm 20 and coupled to the shaft 28. The mounting bracket 30 engages and is supported by a top surface of top arm 20 and may slide, roll, or otherwise move along the top surface of the top arm 20. During up and down movement of the row unit 10, shaft 28 pivots about pin or pivot 29 to maintain the shaft 28 substantially parallel to the top arm 20. At least one biasing member 32 under tension is provided between top and bottom arms 20, 22. In the illustrated exemplary embodiment, the biasing member 32 is a spring or coil spring. However, it should be understood that the biasing member 32 may be any type of biasing member and other types of springs and still be within the intended spirit and scope of the present invention. In exemplary embodiments including an actuator 26 above each top arm 20, two tension springs 32 may be included in the linkage 18 with one spring 32 coupled to each actuator 26. In other exemplary embodiments, one actuator 26 and two springs 32 may be included in the linkage 18 with one spring 32 coupled to the actuator 26 and the second spring 32 coupled to and between the top and bottom arms 20, 22. In the illustrated exemplary embodiment, the spring 32 is connected at a lower end to the bottom arm 22 at a fixed point and at an upper end to the mounting bracket 30 on the top arm 20. The tension applied across the tension spring 20 may be varied to adjust the tension on spring 32 and thus the amount of weight transferred from the toolbar to the row unit 10 by extending or retracting the shaft 28 of the actuator 26, which in turn will move the mounting bracket 30 forward or rearward along the top arm 20. Alternatively, the actuator 26 may be a screw-drive type actuator 26, and the shaft 28 and the mounting bracket 30 may have a screw or threaded engagement between the two components, thereby causing the mounting bracket to translate along the shaft 28 as the shaft 28 rotates. The shaft 28 may rotate either direction to enable the mounting bracket 30 to translate in either direction.\n\nWith continued reference to FIG. 1, dt denotes the distance between the proximal pivot point of the top arm 20 and the mounting bracket 30, which is the connection point of the upper end of the spring 32, and db denotes the distance between the proximal pivot point of the bottom arm 22 and the fixed connection point of the lower end of the spring 32. As shown in FIG. 1, when dt and db are the same, the spring 32 is in a neutral position where the net effect on the force applied to the soil Fg is zero. As shown in FIG. 2, when the actuator 26 retracts the shaft 28, the mounting bracket 30 is moved to a position closer to the proximal pivot point of top arm 20. In this position the spring 32 is in a negative, or up force position in which dt is less than db, and where a net negative force will be put on the row unit 10 which decreases the force applied to the soil by the furrow-opening discs 14.\n\nAs shown in FIG. 3, when the actuator 26 extends the shaft 28, the mounting bracket 30 is moved to a position further from the proximal pivot point of top arm 20. In this position, the spring 32 is in a positive, or down force position in which dt is greater than db, and where a net positive force will be applied to the row unit 10. This increases the force that is applied to the soil by the furrow-opening discs 14.\n\nWith continued reference to FIGS. 1-3, an exemplary sensor 34 is provided to sense or determine a position of the biasing member 32. In the illustrated exemplary embodiment, the sensor 34 is coupled to the mounting plate 24. In other exemplary embodiments, the sensor 34 may be coupled to any portion of the toolbar, linkage 18, row unit 10, etc. and still be within the intended spirit and scope of the present invention. The sensor 34 may be any type of sensor for determining a position of the biasing member 32. For example, the sensor 34 may be an ultrasonic sensor, a laser sensor, a potentiometer, a hall effect sensor, or any other type of sensor. In other exemplary embodiments, the sensor 34 may be coupled to or included within the actuator 26 and may be a wide variety of types of sensors such as, for example, a potentiometer, a hall effect sensor, etc.\n\nThe actuator 26 is controlled by conventional means via a user interface 40, which can be in the cab of a tractor 38 that pulls the planter 36 and row units 10 through a field. In this way, a farmer can adjust down force on the row unit 10 quickly and accurately so that furrow-opening discs 14 can maintain a consistent furrow depth, or the farmer can lift the row unit 10 if its own weight is applying too much down force to the soil.\n\nReferring now to FIG. 4, an exemplary system of the present invention is illustrated and includes a tractor 38 and a planter 36. The tractor 38 includes a control system 39 including a user interface 40 with an optional touch screen 42 and associated touch screen capabilities, a processing unit 44, an optional mechanical control panel 46, and a memory 48. The tractor 38 also includes a tractor electrical power source 50. The planter 36 includes multiple row units 10, however, since the row units 10 are substantially identical, only one row unit 10 is illustrated with further detail and described herein. Each row unit 10 includes a down force adjustment assembly including the actuator 26, the biasing member position sensor 34, a down force sensor 52, and a soil characteristic sensor 54 (see FIGS. 4 and 5). Each row unit 10 may include an optional row unit electrical power source 56 and the planter 36 further includes a planter electrical power source 58. In other exemplary embodiments, the planter 36 may include a processing unit and/or the row units 10 may each include a processing unit and the processing unit(s) of the planter 36 and/or the row units 10 may communicate with the processing unit 44 of the tractor 38 via a communication bus.\n\nThe down force sensor 52 may be, for example, a force transducer that is coupled to a depth-adjusting lever mechanism 60 (see FIG. 5) or the gauge wheels 16 for monitoring and/or measuring a down force occurring in the depth-adjusting mechanism 60 or the gauge wheels 16 and applied to the row unit 10 to force the row unit 10 downward toward the soil. The down force sensor 52 may be any type of sensor such as, for example, a load cell, a pressure sensor, a potentiometer, etc., and may be coupled to any portion of the row unit 10 as long as it can operate appropriately to sense a down force. Such a force sensor 52 may be electronically coupled to the processing unit 44 to enable the processing unit 44 to take readings of the down force and display related information to a user via the user interface 40 or to enable the processing unit 44 to communicate with the necessary components to adjust the down force.\n\nWith further reference to FIG. 5, an exemplary soil characteristic sensor 54 is illustrated and may be coupled to the row unit 10 in any manner and at any location as long as the sensor 54 can sense desired soil characteristic(s). The soil characteristic sensor 54 may sense any soil characteristic and operate in any of the manners described in U.S. Provisional Patent Application Nos. 61/479,537 and 61/479,543, both of which were filed Apr. 27, 2011 and both of which are incorporated herein by reference.\n\nAll of the sensors may generate a signal associated with the characteristic they are sensing and communicate with the processing unit so the processing unit may receive the signals, interpret the signals, and react accordingly to perform the desired functions of the system. \n\nIt should be understood that the sensors described and illustrated herein may be any type of sensor and be within the intended spirit and scope of the present invention. Exemplary sensors include, but are not limited to, ultrasonic sensors, laser sensors, video cameras, infra-red sensors, infra-red cameras, infra-red scanners, microwave sensors, potentiometers, hall effect sensors, force transducers, etc. \n\nThe foregoing description has been presented for purposes of illustration and description, and is not intended to be exhaustive or to limit the invention to the precise form disclosed. The descriptions were selected to explain the principles of the invention and their practical application to enable others skilled in the art to utilize the invention in various embodiments and various modifications as are suited to the particular use contemplated. Although particular constructions of the present invention have been shown and described, other alternative constructions will be apparent to those skilled in the art and are within the intended scope of the present invention. \n\nWhile particular embodiments of the present invention have been illustrated and described, it will be obvious to those skilled in the relevant arts that changes and modifications may be made without departing from the invention in its broader aspects. Therefore, the aim in the appended claims is to cover all such changes and modifications that fall within the true spirit and scope of the invention. The matters set forth in the foregoing description and accompanying drawings is offered by way of illustration only and not as a limitation. The actual scope of the invention is intended to be defined in the following claims when viewed in their proper perspective based on the prior art. | Kinze Manufacturing Inc.,Williamsburg,IA,US | Achen Courtney N.,Iowa City,IA,US | Bachman Marvin L.,Marengo,IA,US | Stevenson Vaughan G.,Williamsburg,IA,US | Kinze Manufacturing Inc. | Achen Courtney N. | Bachman Marvin L. | Stevenson Vaughan G. | KINZE MANUFACTURING INC | KINZE MANUFACTURING INC | Achen, Courtney N. | Bachman, Marvin L. | Stevenson, Vaughan G. | 3 | McKee, Voorhees & Sease | NaN | Novosad, Christopher J | US | Dead | 12 | 2014 | US | 4 | 2012 | 2011-04-27 | 2011 | A01 | A01, Y10 | 701050 | 111069 | 111200 | 111903 | US7628218B2 | US7726251B1 | US20070272134A1 | US7316189B2 | US20090112475A1 | US4413685A | US6148747A | US7392754B2 | US7849955B2 | US8365697B2 | US20100023430A1 | US20120042813A1 | US6389999B1 | US4766962A | US5544709A | US6016714A | US20100198529A1 | US3749035A | US8078367B2 | GB2126062A | US6701857B1 | US7025009B2 | US5529128A | US5563340A | US5621666A | US6216794B1 | US8418636B2 | US20120046838A1 | 28 | International Search Report and Written Opinion dated Jul. 10, 2012 for PCT Patent Application No. PCT/US2012/035585, 9 pgs. | International Search Report and Written Opinion dated Jul. 13, 2012 for PCT Patent Application No. PCT/US2012/035563, 11 pgs. | International Search Report and Written Opinion dated Jul. 13, 2012 for PCT Patent Application No. PCT/US2012/035518, 9 pgs. | Noninvasive Diagnosis of Seed Viability Using Infrared Thermography, Kranner et al, Proceedings of the National Academy of Sciences, dated Feb. 23, 2010, vol. 107, No. 8, pp. 3912-3917. DOI:10.1073/pnas.0914197107 3 | 4 | US10091926B2 | US10104830B2 | US10143128B2 | US10219421B2 | US10219430B2 | US10219431B2 | US10271473B2 | US10299422B2 | US10327374B2 | US10462956B2 | US10477753B2 | US10512212B2 | US10548259B2 | US10681862B2 | US10798872B1 | US11122731B2 | US11185010B2 | US11297753B2 | US11457557B2 | US11558991B2 | US11582896B2 | US20150066315A1 | US20150073668A1 | US20150094917A1 | US20150264857A1 | US20150334920A1 | US20170086359A1 | US20170105336A1 | US9485914B2 | US9674999B2 | US9675004B2 | US9686901B2 | US9743578B2 | US9801332B2 | US9814172B2 | 35 | 2019-02-26 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - 2018-12-30 | 2019-02-04 STCH INFORMATION ON STATUS: PATENT DISCONTINUATION - PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362 | 2019-02-04 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | 2018-08-13 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | 2012-06-22 AS ASSIGNMENT KINZE MANUFACTURING, INC., IOWA ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:ACHEN, COURTNEY N.;BACHMAN, MARVIN L.;STEVENSON, VAUGHAN G.;REEL/FRAME:028425/0540 2012-06-18 | US8924092B2 | EP2701481A1 | EP2701481A4 | EP2701481B1 | EP2701482A1 | EP2701482A4 | EP2701482B1 | EP2701483A1 | EP2701483A4 | RU2013152615A | RU2013152617A | RU2013152618A | RU2562211C2 | RU2576457C2 | RU2581217C2 | US10219421B2 | US10219430B2 | US10327374B2 | US11185010B2 | US11297753B2 | US20130104785A1 | US20130112121A1 | US20130112122A1 | US20150066315A1 | US20150073668A1 | US20150094917A1 | US20170238458A1 | US20170290259A1 | US20170339824A1 | US20190191621A1 | US20190274240A1 | US20220046850A1 | US20220192072A1 | US8909436B2 | US8935986B2 | US9674999B2 | US9686901B2 | US9743578B2 | WO2012149367A1 | WO2012149398A1 | WO2012149415A1 | 20121101WO2012149367A1 |
| 2778 | US8923972B2 | Elliptical element for blood pressure reduction | US2005702491P | US2005721728P | WO2006IL856A | 2005-07-25 | 2005-09-28 | 2006-07-25 | US2007881256A | 2007-07-25 | B2 | 2014-12-30 | Gross Yossi|Moshav Mazor, IL | Vascular Dynamics Inc.,Mountain View,CA,US | Gross Yossi,Moshav Mazor,IL | VASCULAR DYNAMICS INC. | B04 C | D16 C | D22 C | S05 E | P32 N | B11-C04 | B11-C04F | B11-C04G | D05-H02 | D05-H08 | D09-C01B | S05-A02B | A61N000105 | A61F000282 | A61N000132 | A61N000136 | A61F000206 | A61F0002856 | A61M002902 | A61F000282 | A61N000105 | A61N0001326 | A61N000136017 | A61N0001375 | A61F0002856 | A61F2002065 | A61F22300008 | A61F22500001 | A61F22500004 | A61N0001056 | A61N000136117 | 607044 | 62300115 | 62300116 | NaN | Apparatus is provided for treating hypertension of a subject. The apparatus includes an implantable element which has a non-circular shape and which is configured to reduce the hypertension by facilitating an assumption of a non-circular shape by a blood vessel in a vicinity of a baroreceptor of the subject, during diastole of the subject. Other embodiments are also described. | Elliptical element for blood pressure reduction | What is claimed is: \n1. A method of reducing hypertension of a subject, comprising: \ncoupling a flexible element having a non-circular cross-section to a carotid artery of the subject in a vicinity of a baroreceptor of the subject, by implanting the flexible element within the carotid artery, the flexible element being configured to flex passively in coordination with the cardiac cycle; and \nfacilitating, with the flexible element, an assumption of a non-circular cross-sectional shape by the carotid artery in the vicinity that is less circular than a shape of the carotid artery in the vicinity when the element is not coupled to the carotid artery, wherein passive flexure of the flexible element in coordination with the cardiac cycle reduces hypertension of the subject. \n2. The method according to claim 1, further comprising facilitating, with the element, an assumption of a cross-sectional shape by the carotid artery in the vicinity, during diastole of the subject, that is less circular than a shape of the carotid artery in the vicinity, during systole of the subject.\n3. The method according to claim 2, wherein implanting the element comprises implanting a stent which has a non-circular cross-section.\n4. The method according to claim 2, wherein implanting the element comprises placing the element inside the carotid artery on a side of the baroreceptor selected from the group consisting of: an upstream side, and a downstream side.\n5. The method according to claim 2, wherein the element includes a spring and implanting the element comprises coupling the spring to the carotid artery.\n6. The method according to claim 2, wherein implanting the element comprises coupling two elements to the carotid artery at a longitudinal separation from each other, the elements having non-circular cross-sections.\n7. The method according to claim 6, wherein coupling the two elements to the carotid artery comprises longitudinally spacing the two elements by between 5 mm and 20 mm.\n8. The method according to claim 2, wherein the element includes first and second elements having non-circular cross-sections, and wherein implanting the elements comprises implanting the first element on a first side of the baroreceptor and implanting the second element on a second side of the baroreceptor, the first and second sides being respective sides selected from the group consisting of: an upstream side and a downstream side.\n9. The method according to claim 8, wherein implanting the first element and the second element comprises implanting the first and second elements, the elements being coupled to each other. | 9 | 1. A method of reducing hypertension of a subject, comprising: \ncoupling a flexible element having a non-circular cross-section to a carotid artery of the subject in a vicinity of a baroreceptor of the subject, by implanting the flexible element within the carotid artery, the flexible element being configured to flex passively in coordination with the cardiac cycle; and \nfacilitating, with the flexible element, an assumption of a non-circular cross-sectional shape by the carotid artery in the vicinity that is less circular than a shape of the carotid artery in the vicinity when the element is not coupled to the carotid artery, wherein passive flexure of the flexible element in coordination with the cardiac cycle reduces hypertension of the subject. | 1. A method of reducing hypertension of a subject, comprising: coupling a flexible element having a non-circular cross-section to a carotid artery of the subject in a vicinity of a baroreceptor of the subject, by implanting the flexible element within the carotid artery, the flexible element being configured to flex passively in coordination with the cardiac cycle; and facilitating, with the flexible element, an assumption of a non-circular cross-sectional shape by the carotid artery in the vicinity that is less circular than a shape of the carotid artery in the vicinity when the element is not coupled to the carotid artery, wherein passive flexure of the flexible element in coordination with the cardiac cycle reduces hypertension of the subject. | CROSS-REFERENCES TO RELATED APPLICATIONS \n\nThe present patent application is a continuation-in-part of International Patent Application PCT/IL2006/000856 to Gross (WO 07/013065), filed Jul. 25, 2006, entitled, Electrical stimulation of blood vessels, which claims the benefit of (a) U.S. Provisional Application 60/702,491, filed Jul. 25, 2005, entitled, Electrical stimulation of blood vessels, and (b) U.S. Provisional Application 60/721,728, filed Sep. 28, 2005, entitled, Electrical stimulation of blood vessels. All of the above applications are incorporated herein by reference. \n\nBRIEF DESCRIPTION OF THE DRAWINGS \n\nFIGS. 1A and 1B are schematic illustrations of a non-circular rigid implant element inside a blood vessel during diastole and during systole, respectively, in accordance with an embodiment of the present invention;\n\nFIGS. 1C and 1D are schematic illustrations of a non-circular flexible implant element inside a blood vessel during diastole and during systole, respectively, in accordance with another embodiment of the present invention;\n\nFIG. 2 is a schematic illustration of two non-circular rings which are coupled to each other, in accordance with an embodiment of the invention;\n\nFIG. 3 is a schematic illustration of two non-circular rings which are coupled to each other, in accordance with another embodiment of the invention;\n\nFIGS. 4A and 4B are schematic illustrations of a balloon inside a non-circular ring, the balloon in deflated and inflated states thereof, respectively, in accordance with an embodiment of the present invention;\n\nFIGS. 5A and 5B are schematic illustrations of apparatus for increasing the rate of firing of a baroreceptor, in accordance with respective embodiments of the invention; and\n\nFIG. 6 is a schematic illustration of an implant element having embolic protection, in accordance with an embodiment of the invention.\n\nDETAILED DESCRIPTION OF EMBODIMENTS \n\nReference is now made to FIGS. 1A and 1B, which are schematic illustrations of a non-circular implant element 20 disposed within a blood vessel 30 of a subject, in accordance with an embodiment of the invention. Typically, the element is implanted into the aorta or the carotid artery of the subject. FIG. 1A shows the blood vessel during diastole and FIG. 1B shows the blood vessel during systole. Typically, the element includes one or more elliptical rigid rings, and/or an elliptical stent. The element is placed within the blood vessel in the vicinity of a baroreceptor and causes an increase in the change in shape which the blood vessel would in any case undergo during the cardiac cycle.\n\nIn some embodiments, the element is placed as close as possible to the baroreceptor, e.g., within 1 cm or 2 cm of the baroreceptor. The implanting is typically performed during minimally-invasive surgery, e.g., using a transcatheter approach. \n\nReference is now made to FIGS. 1C and 1D, which are schematic illustrations of non-circular element 20, in accordance with another embodiment of the present invention. In some embodiments (as shown), non-circular element 20 is flexible and flexes passively in coordination with the cardiac cycle. Blood vessel 30 changes the shape of element 20 from being non-circular during diastole (FIG. 1C), to being more circular during systole (FIG. 1D). For example, element 20 may be generally circular during systole, or generally elliptical, with lower eccentricity than during diastole. In all other aspects element 20 is generally the same as described hereinabove.\n\nReference is now made to FIGS. 2 and 3, which are schematic illustrations of implant element 20, comprising two non-circular rings 22 and 24, which are coupled to each other by a single rod 26 (FIG. 2) or two or more rods 26 and 28 (FIG. 3), in accordance with respective embodiments of the invention. Typically, the width D1 of each of the rings is between 2 mm and 6 mm, e.g., 4 mm, and the rings are implanted at a longitudinal separation D2 from each other, along the blood vessel, which is between about 5 mm and 20 mm, or between about 20 mm and 50 mm. During diastole, the ratio of length D4 of the major axis of the ellipse to length D3 of the minor axis is typically between 1.5:1 and 2.5:1, e.g., 2:1. For some applications, the rings are implanted such that one ring is disposed within the blood vessel on one side of the baroreceptor and the second ring is disposed within the blood vessel on the other side of the baroreceptor. In some embodiments, the two rings are not connected to each other and are implanted in separate implantation steps. In alternative embodiments, the two rings are coupled to each other by three or more rods.\n\nReference is now made to FIGS. 4A and 4B, which are schematic illustrations of a shaping balloon 42, inside non-circular ring 22, in accordance with an embodiment of the present invention. In FIG. 4A, the balloon is deflated, and in FIG. 4B, the balloon is inflated. In some patients, baroreceptors adapt to a ring being deployed within a blood vessel (as described herein) and revert toward their original firing rate. In an embodiment of the invention, periodic measurements are made of the subject's resting blood pressure. If the blood pressure of the subject has increased, the eccentricity of the cross-section of the ring is increased by inflation of shaping balloon 42. Typically, the balloon is inserted transcatheterally into the inside of the ring, and the balloon is inflated. The balloon expands and permanently increases the eccentricity of the cross-section of the implanted ring. Alternatively, if it is determined that the eccentricity of the ring is having too great an effect on resting blood pressure, the balloon is inflated in a manner to decrease eccentricity (e.g., by increasing the minor axis of the ring).\n\nReference is now made to FIGS. 5A and 5B, which are schematic illustrations of apparatus for increasing the rate of firing of a baroreceptor, in accordance with respective embodiments of the invention. The apparatus comprises elliptical ring 22, which is implanted in blood vessel 30, and control unit 52. In FIGS. 5A and 5B, blood vessel 30 is shown during systole. In FIG. 5A the control unit is coupled to the ring, and in FIG. 5B, the control unit is coupled to an electrode 54. In some embodiments, the control unit is configured to detect real-time blood pressure of the subject. The control unit is configured to drive a current into the blood vessel to excite the baroreceptor, in a transient manner, in response to real-time blood pressure measurements. For example, the control unit may detect a transient increase in blood pressure as a result of the subject undergoing a stressful experience. In response, the control unit excites the baroreceptor. The current is typically driven into the blood vessel via the ring (FIG. 5A) and/or via the electrode (FIG. 5B). Alternatively, or additionally, the control unit is configured to transiently modulate the eccentricity of the ring in response to the real-time blood pressure measurements. For example, the ring may comprise mechanical deforming elements (e.g., piezoelectric elements), and the control unit actuates the deforming elements to transiently alter the eccentricity of the ring.\n\nIn some embodiments, the ring is flexible, and the control unit is configured to detect the cardiac cycle of the subject and to flex the ring in coordination with the cardiac cycle, to enhance baroreceptor firing and blood pressure reduction. \n\nReference is now made to FIG. 6, which is a schematic illustration of an embolic protection device 60 disposed within the blood vessel during implantation of element 20, in accordance with an embodiment of the present invention. The implant element and the embolic protection device are placed in blood vessel 30 in the vicinity of a baroreceptor. Typically, the embolic protection device comprises a mesh. During the implanting of the implant element, the embolic protection device is inserted into the blood vessel distal to the implant element. Embolic protection device 60 is typically inserted into the blood vessel via a catheter 40. The protection device prevents embolisms, caused by the implanting of the implant element, from occluding blood vessels of the subject. Following implantation of element 20, embolic protection device 60 is removed.\n\nIt is to be understood that use of a non-circular plurality of rings is described herein by way of illustration and not limitation, and that the scope of the present invention includes the use of a plurality of rings that are circular in cross-section. \n\nIt will be appreciated by persons skilled in the art that the present invention is not limited to what has been particularly shown and described hereinabove. Rather, the scope of the present invention includes both combinations and subcombinations of the various features described hereinabove, as well as variations and modifications thereof that are not in the prior art, which would occur to persons skilled in the art upon reading the foregoing description. \n\nFIELD OF THE INVENTION \n\nThe present invention generally relates to implanted medical apparatus. Specifically, the present invention relates to apparatus and methods for reducing blood pressure. \n\nBACKGROUND OF THE INVENTION \n\nHypertension is a condition from which many people suffer. It describes a constant state of elevated blood pressure which can be caused by a number of factors, for example, genetics, obesity or diet. Baroreceptors located in the walls of blood vessels act to regulate blood pressure. They do so by sending information to the central nervous system (CNS) regarding the extent to which the blood vessel walls are stretched by the pressure of the blood flowing therethrough. In response to these signals, the CNS adjusts certain parameters so as to maintain a stable blood pressure. \n\nUS Patent Application Publication 2003/0060858 to Kieval et al., which is incorporated herein by reference, describes devices, systems and methods by which the blood pressure, nervous system activity, and neurohormonal activity may be selectively and controllably reduced by activating baroreceptors. A baroreceptor activation device is positioned near a baroreceptor, for example a baroreceptor in the carotid sinus. A control system may be used to modulate the baroreceptor activation device. The control system may utilize an algorithm defining a stimulus regimen which promotes long term efficacy and reduces power requirements/consumption. \n\nUS Patent Application Publication 2005/0154418 to Kieval et al., which is incorporated herein by reference, describes systems and methods to provide baroreflex activation to treat or reduce pain and/or to cause or enhance sedation or sleep. Methods involve activating the baroreflex system to provide pain reduction, sedation, improved sleep or some combination thereof. Systems include at least one baroreflex activation device, at least one sensor for sensing physiological activity of the patient, and a processor coupled with the baroreflex activation device(s) and the sensor(s) for processing sensed data received from the sensor and for activating the baroreflex activation device. In some embodiments, the system is described as being fully implantable within a patient, such as in an intravascular, extravascular or intramural location. \n\nUS Patent Application Publication 2006/0074453 to Kieval et al., which is incorporated herein by reference, describes a method for treating heart failure in a patient which involves activating a baroreflex system of the patient with at least one baroreflex activation device and resynchronizing the patient's heart with a cardiac resynchronization device. Activating the baroreflex system and resynchronizing the heart may be performed simultaneously or sequentially, in various embodiments. In some embodiments, one or more patient conditions are sensed and such condition(s) may be used for setting and/or modifying the baroreflex activation and/or heart resynchronization. A device for treating heart failure includes a baroreflex activation member coupled with a cardiac resynchronization member. Some embodiments further include one or more sensors and a processor. In some embodiments, the device is fully implantable. \n\nUS Patent Application Publication 2005/0027346 to Arkusz et al., which is incorporated herein by reference, describes a tubular vascular stent graft with a passively pulsating midsection where the difference between the cross-sectional areas of the lumen under the systolic and diastolic pressures after the implantation is 10% or more. The pulsating stent graft accumulates blood during the systolic pressure wave thus lowering the peak value of the tugging force at the proximal attachment site. \n\nPCT Publication WO 03/076008 to Shalev, which is incorporated herein by reference, describes an implantable device which uses the carotid baroreflex in order to control systemic blood pressure. The implant includes sampling and pulse stimulation electrodes preferably located on the carotid sinus nerve branch of the glossopharyngeal nerve, adjacent and distal to the carotid sinus baroreceptors. The stimulators have an external control unit, which communicates with the implant for determining appropriate operational parameters, and for retrieving telemetry information from the device's data bank. Typically, two internal devices are implanted, one at each side of the patient's neck. \n\nPCT Publication WO 04/073484 to Gross et al., which is incorporated herein by reference, describes apparatus which includes an inflatable bladder, adapted to be coupled to a blood vessel of a subject carrying oxygenated blood, such that an interior of the bladder is in fluid communication with the blood. The apparatus also includes a piston in mechanical communication with the bladder; a motor, adapted to synchronize contraction and expansion of the bladder with a cardiac cycle of the subject by applying a motor force to the piston; and a spring, adapted to apply a spring force to the piston. In some embodiments of the invention, a counterpulsation system comprises one or more springs, which are adapted to be inserted into an artery of a subject, such as a descending aorta. Typically, each of the springs is planar, i.e., flat rather than helical, and has a generally sinusoidal shape. For applications comprising more than one spring, the plurality of springs are arranged in substantially a single plane. The counterpulsation system causes the artery to have a cross-sectional area during diastole that is less than the cross-sectional area would be during diastole without use of the counterpulsation system. For example, the counterpulsation system may cause the artery to have a cross-sectional shape during diastole that generally resembles an ellipse. Use of the counterpulsation system is described as thus typically increasing diastolic blood pressure and decreasing systolic blood pressure, thereby providing counterpulsation treatment to the circulation of the subject. \n\nCVRx (Minneapolis, Minn.) manufactures the CVRx® Rheos Baroreflex Hypertension Therapy System, an implantable medical device for treating patients with high blood pressure. The product, which is under clinical investigation, works by electrically activating the baroreceptors, the sensors that regulate blood pressure. These baroreceptors are located on the carotid artery and in the carotid sinus. CVRx states that when the baroreceptors are activated by the Rheos System, signals are sent to the central nervous system and interpreted as a rise in blood pressure. The brain works to counteract this perceived rise in blood pressure by sending signals to other parts of the body to reduce blood pressure, including the heart, kidneys and blood vessels. \n\nThe following patents and patent applications, which are incorporated herein by reference, may be of interest: \n\nUS Patent Application Publication 2005/0033407 to Weber et al. \n\nEuropean Patent 0,791,341 to Demeyere et al. \n\nPCT Publication WO 06/032902 to Caro et al. \n\nU.S. Pat. No. 7,044,981 to Liu et al. \n\nUS Patent Application Publication 2005/0203610 to Tzeng \n\nUS Patent Application Publication 2004/0193092 to Deal \n\nU.S. Pat. No. 6,575,994 to Marin et al. \n\nUS Patent Application Publication 2005/0232965 to Falotico \n\nUS Patent Application Publication 2004/0106976 to Bailey et al. \n\nU.S. Pat. No. 4,938,766 to Jarvik \n\nU.S. Pat. No. 4,201,219 to Bozal Gonzalez \n\nU.S. Pat. No. 3,650,277 to Sjostrand et al. \n\nU.S. Pat. No. 4,791,931 to Slate \n\nSUMMARY OF THE INVENTION \n\nAs people age, their blood vessels become more rigid, and, as a result, the baroreceptor response to changes in blood pressure decreases. The CNS interprets the low baroreceptor response as resulting from a low blood pressure, and responds by increasing blood pressure. This phenomenon can cause or exacerbate hypertension. Embodiments of the present invention reduce hypertension by increasing the changes in shape of given arteries during the cardiac cycle. Doing so increases the baroreceptor signaling to the CNS, and the CNS interprets the increased baroreceptor signaling as having resulted from elevated blood pressure. In response, the CNS acts to lower blood pressure. \n\nIn some embodiments of the present invention, an element having an elliptical or other non-circular cross-section is placed near a baroreceptor in a blood vessel of a subject who has hypertension. The elliptical element changes the shape of the blood vessel such that the blood vessel is generally elliptical during diastole and less elliptical (e.g., generally circular) during systole. \n\nIn some embodiments of the invention, the non-circular element comprises a stent. Alternatively or additionally, the non-circular element comprises a ring, or a plurality of rings. For some applications, the one or more rings are used as the non-circular element in order to reduce the total surface contact between the element and the blood vessel, which, in turn, limits fibrosis between the element and the blood vessel. Alternatively, as when the element comprises a stent, the contact surface area is not necessarily minimized, and the one or more rings are used as the non-circular element for a different purpose. \n\nIn an embodiment, the ring is flexible and flexes in coordination with the cardiac cycle of the subject. In a further embodiment, a control unit is configured to detect the real-time blood pressure of the subject and to drive current, via the element, toward the baroreceptor, responsively to the detected blood pressure. Alternatively or additionally, the apparatus comprises a dedicated electrode, and current is driven toward the baroreceptor, via the dedicated electrode, responsively to the detected blood pressure. \n\nIn an embodiment, the cross-section of the ring is altered in response to the detection of real-time blood pressure of the subject. For example, if the blood pressure of the subject increases as a result of the subject undergoing a stressful experience, a blood pressure detector detects the increase. The detected increase in blood pressure results in the eccentricity of the ring being increased. \n\nIn some patients, the baroreceptor adapts to the presence of the ring within the blood vessel, and reverts toward its original firing rate. In some embodiments of the invention, the eccentricity of the ring is modified periodically, in response to measurements of resting blood pressure of the subject. For example, a balloon may be transcatheterally inserted into the inside of the ring. The balloon is inflated to modify the cross-section of the ring. \n\nIn some embodiments, an embolic protection device is inserted into the blood vessel during the implantation of the non-circular element. Typically, the embolic protection device comprises a mesh, and the mesh is placed distal to the non-circular element. The mesh is typically inserted into the blood vessel transcatheterally. \n\nThere is therefore provided, in accordance with an embodiment of the invention, apparatus for treating hypertension of a subject, including an implantable element which has a non-circular shape and which is configured to reduce the hypertension by facilitating an assumption of a non-circular shape by a blood vessel in a vicinity of a baroreceptor of the subject, during diastole of the subject. \n\nIn an embodiment, the element includes a non-circular stent. \n\nIn an embodiment, the element includes a single non-circular ring. \n\nIn an embodiment, the element includes a plurality of non-circular rings. \n\nIn an embodiment, the element includes a plurality of non-circular rings which are not connected to each other. \n\nIn an embodiment, the element includes a plurality of non-circular rings which are not rigidly connected to each other. \n\nIn an embodiment, the element is rigid. \n\nIn an embodiment, the apparatus includes a control unit configured to detect real-time blood pressure of the subject. \n\nIn an embodiment, the control unit is configured to be implantable in a body of the subject. \n\nIn an embodiment, the control unit is configured to drive current, via the element, toward the baroreceptor, in response to the detected blood pressure. \n\nIn an embodiment, the apparatus includes an electrode, and the control unit is configured to drive current, via the electrode, toward the baroreceptor, in response to the detected blood pressure. \n\nIn an embodiment, the control unit is configured to change the cross-section of the element in response to the detected blood pressure. \n\nIn an embodiment, the element includes a plurality of rings which are coupled to each other. \n\nIn an embodiment, the apparatus includes a single rod, and the rings are coupled to each other by the single rod. \n\nIn an embodiment, the apparatus includes exactly two rods, and the rings are coupled to each other by the exactly two rods. \n\nIn an embodiment, the apparatus includes three or more rods, and the rings are coupled to each other by the three or more rods. \n\nIn an embodiment, the element includes two rings which are coupled to each other and which are separated from each other by a distance that is between 5 mm and 20 mm. \n\nIn an embodiment, the element includes two rings which are coupled to each other and which are separated from each other by a distance that is between 20 mm and 50 mm. \n\nIn an embodiment, the element is flexible. \n\nIn an embodiment, the element is configured to flex in coordination with a cardiac cycle of the subject. \n\nIn an embodiment, the element is configured to flex passively in coordination with the cardiac cycle of the subject. \n\nIn an embodiment, the apparatus includes a control unit configured to detect the cardiac cycle of the subject and to flex the element in coordination with the cardiac cycle. \n\nIn an embodiment, the apparatus includes a shaping element configured to shape the non-circular element while the non-circular element is in the blood vessel. \n\nIn an embodiment, the shaping element includes a balloon. \n\nIn an embodiment, the shaping element includes an elliptical balloon. \n\nIn an embodiment, the apparatus includes an embolic protection device configured to capture emboli during implanting of the element. \n\nIn an embodiment, the embolic protection device includes a mesh. \n\nThere is additionally provided, in accordance with an embodiment of the invention, a method for reducing hypertension of a subject, including: \n\ncoupling an element having a non-circular cross-section to a blood vessel of the subject in a vicinity of a baroreceptor of the subject, by implanting the element; and \n\nreducing the hypertension by facilitating, with the element, an assumption of a non-circular shape by the blood vessel in the vicinity, during diastole of the subject. \n\nIn an embodiment, implanting the element includes implanting in separate implantation steps, at respective longitudinal sites of the blood vessel in the vicinity of the baroreceptor, a plurality of rings having non-circular cross-sections. \n\nIn an embodiment, implanting the element includes implanting, at respective longitudinal sites of the blood vessel in the vicinity of the baroreceptor, a plurality of rings which are coupled to each other, the rings having non-circular cross-sections. \n\nIn an embodiment, implanting the element includes implanting the element during minimally-invasive surgery. \n\nIn an embodiment, implanting the element includes placing a stent inside the blood vessel on one side of the baroreceptor, the stent having a non-circular cross-section. \n\nIn an embodiment, implanting the element includes placing a ring inside the blood vessel on one side of the baroreceptor, the ring having a non-circular cross-section. \n\nIn an embodiment, the method includes detecting blood pressure of the subject and changing the cross-section of the non-circular element in response to the detected blood pressure. \n\nIn an embodiment, detecting the blood pressure includes detecting the blood pressure of the subject more frequently than once a week. \n\nIn an embodiment, detecting the blood pressure includes detecting the blood pressure of the subject less frequently than once a week. \n\nIn an embodiment, detecting the blood pressure includes detecting real time blood pressure of the subject, and changing the cross-section of the element includes changing the cross-section of the element in response to the detected real time blood pressure. \n\nIn an embodiment, detecting the blood pressure includes detecting resting blood pressure of the subject, and changing the cross-section of the element includes changing the cross-section of the element in response to the detected resting blood pressure. \n\nIn an embodiment, changing the cross-section of the element includes expanding a balloon within the element. \n\nIn an embodiment, changing the cross-section of the element includes expanding an elliptical balloon within the element. \n\nIn an embodiment, changing the cross-section of the element includes driving a current toward the element. \n\nIn an embodiment, the element includes first and second rings having non-circular cross-sections, and implanting the element includes implanting the first ring on one side of the baroreceptor and implanting the second ring on another side of the baroreceptor. \n\nIn an embodiment, implanting the first ring and the second ring includes implanting the first and second rings, the rings not being connected to each other. \n\nIn an embodiment, implanting the first ring and the second ring includes implanting the first and second rings, the rings not being rigidly connected to each other. \n\nIn an embodiment, implanting the first ring and the second ring includes implanting the first and second rings, the rings being coupled to each other. \n\nIn an embodiment, implanting the first ring and the second ring includes implanting the first and second rings at a longitudinal distance from each other that is between 5 mm and 20 mm. \n\nIn an embodiment, implanting the first ring and the second ring includes implanting the first and second rings at a longitudinal distance from each other that is between 20 mm and 50 mm. \n\nThere is additionally provided, in accordance with an embodiment of the invention, a method for reducing hypertension of a subject, including: \n\ncoupling a ring having a non-circular cross-section to a blood vessel of the subject in a vicinity of a baroreceptor of the subject, by implanting the ring; and \n\nreducing the hypertension by facilitating, with the ring, an assumption of a non-circular shape by the blood vessel in the vicinity, during diastole of the subject. \n\nIn some embodiments, implanting the ring includes implanting the ring during minimally-invasive surgery. \n\nIn some embodiments, the ring includes a rigid ring, and implanting the ring includes implanting the rigid ring. \n\nIn some embodiments, the method includes detecting blood pressure of the subject and changing the cross-section of the non-circular ring in response to the detected blood pressure. \n\nIn some embodiments, detecting the blood pressure includes detecting the blood pressure of the subject more frequently than once a week. \n\nIn some embodiments, detecting the blood pressure includes detecting the blood pressure of the subject less frequently than once a week. \n\nIn some embodiments, detecting the blood pressure includes detecting real time blood pressure of the subject, and changing the cross-section of the ring includes changing the cross-section of the ring in response to the detected real time blood pressure. \n\nIn some embodiments, detecting the blood pressure includes detecting resting blood pressure of the subject, and changing the cross-section of the ring includes changing the cross-section of the ring in response to the detected resting blood pressure. \n\nIn some embodiments, changing the cross-section of the ring includes expanding a balloon within the ring. \n\nIn some embodiments, changing the cross-section of the ring includes expanding an elliptical balloon within the ring. \n\nIn some embodiments, changing the cross-section of the ring includes driving a current toward the ring. \n\nIn some embodiments, the ring includes a flexible ring, and implanting the ring includes implanting the flexible ring. \n\nIn some embodiments, the ring is configured to flex in response to a cardiac cycle of the subject, and implanting the ring includes implanting the ring that is configured to flex in response to the cardiac cycle. \n\nIn some embodiments, the ring is configured to flex passively in coordination with the cardiac cycle of the subject, and implanting the ring includes implanting the ring that is configured to flex passively in coordination with the cardiac cycle. \n\nIn some embodiments, the ring is coupled to a control unit, the control unit being configured to detect the cardiac cycle of the subject and to flex the ring in coordination with the cardiac cycle, and implanting the ring includes implanting the ring that is coupled to the control unit. \n\nIn some embodiments, the method includes detecting real-time blood pressure of the subject and driving a current toward the baroreceptor responsively to the detected blood pressure. \n\nIn some embodiments, driving the current includes driving the current via the ring. \n\nIn some embodiments, driving the current includes driving the current via an electrode. \n\nIn some embodiments, the method includes providing embolic protection during the implanting. \n\nIn some embodiments, providing the embolic protection includes placing a mesh within the blood vessel. \n\nThere is additionally provided, in accordance with an embodiment of the invention, apparatus for treating hypertension of a subject, including an implantable ring which has a non-circular shape and which is configured to reduce the hypertension by facilitating an assumption of a non-circular shape by a blood vessel in a vicinity of a baroreceptor of the subject, during diastole of the subject. \n\nIn some embodiments, the ring is rigid. \n\nIn some embodiments, the apparatus includes a control unit configured to detect real-time blood pressure of the subject. \n\nIn some embodiments, the control unit is configured to be implantable in a body of the subject. \n\nIn some embodiments, the control unit is configured to drive current, via the ring, toward the baroreceptor, in response to... | Vascular Dynamics Inc.,Mountain View,CA,US | Gross Yossi,Moshav Mazor,IL | Vascular Dynamics Inc. | Gross Yossi | VASCULAR DYNAMICS INC | VASCULAR DYNAMICS INC | Gross, Yossi | 1 | Wilson Sonsini Goodrich & Rosati | NaN | Layno, Carl H / Ghand, Jennifer | US | Alive | 12 | 2014 | US | 7 | 2007 | 2005-07-25 | 2005 | A61 | A61 | 607044 | 62300115 | 62300116 | US20070021790A1 | US20070021797A1 | US7158832B2 | US20080009917A1 | US20070055296A1 | US5403341A | US6575994B1 | US20080140167A1 | US20080167694A1 | US20070156167A1 | US4791931A | US6442424B1 | US6669686B1 | US7094254B2 | US7300449B2 | US20050090894A1 | US20060265038A1 | US20070185542A1 | US20070276442A1 | WO2001085063A1 | WO2005084389A2 | WO2006012050A2 | WO2006032902A1 | WO2006041664A2 | WO2007047152A3 | WO2007080595A2 | WO2007136850A2 | WO2008083120A2 | WO2008083235A3 | WO2010035271A1 | US20060004417A1 | US6375666B1 | US4830003A | US20050096710A1 | US6899669B2 | US7389149B2 | US20050149128A1 | US20050154418A1 | US20080167690A1 | US6616624B1 | US6957106B2 | US7637937B2 | US20040254616A1 | US20050203610A1 | US20050261257A1 | US20060293712A1 | US20090264914A1 | US20110213408A1 | EP1234554A1 | WO2003082080A2 | WO2004073484A2 | WO2005065771A1 | WO2005097256A2 | WO2006012033A3 | WO2007080595A3 | WO2007114860A2 | US20070021794A1 | US6522926B1 | US20050027346A1 | US20070038262A1 | US20080046054A1 | US6554856B1 | US6423273B1 | US6764498B2 | US20070156201A1 | US20080172104A1 | US20060217588A1 | US5630829A | US6306141B1 | US7128750B1 | US7628803B2 | US20060276852A1 | US20080275539A1 | US20090306756A1 | US20110077729A1 | WO2001005463A1 | WO2002026314A1 | WO2004073484A3 | WO2005021063A2 | WO2006012033A2 | WO2006042280A2 | WO2006125163A2 | WO2009018394A1 | US20060004430A1 | US20070021792A1 | US20070021798A1 | US20080027469A1 | US20070038255A1 | US20080051767A1 | US3650277A | US20030060858A1 | US20050143766A1 | US6413279B1 | US20080167693A1 | US6322553B1 | US7008446B1 | US20050143785A1 | US20070185543A1 | US20070198082A1 | US20070250085A1 | US20110230953A1 | WO2003076008A1 | WO2003077191A1 | WO2006012050A3 | WO2011089601A1 | US5707400A | US20040010303A1 | US7159593B2 | US7491229B2 | US20070060972A1 | US7194313B2 | US20060074453A1 | US7201772B2 | US7044981B2 | US7373204B2 | US20040106976A1 | US20070142879A1 | US4938766A | US20080172101A1 | US7395119B2 | US20040111006A1 | US20010003801A1 | US5437285A | US5458626A | US7270675B2 | US7625400B2 | EP791341A1 | WO2006040647A1 | WO2007047152A2 | US6681136B2 | US6985774B2 | US20070021796A1 | US20070021799A1 | US20080009916A1 | US7647931B2 | US6850801B2 | US5727558A | US20080097540A1 | US4201219A | US20060111626A1 | US20080114439A1 | US7530995B2 | US20050149131A1 | US20050149143A1 | US20070167984A1 | US20080161865A1 | US20080161887A1 | US20080167696A1 | US20080167699A1 | US20080171923A1 | US6086527A | US6974445B2 | US20040193092A1 | US20070276459A1 | US20080033501A1 | US20130172981A1 | WO2006042280A3 | WO2007114860A3 | WO2007136851A2 | US20070038259A1 | US20080082137A1 | US20050143765A1 | US7060080B2 | US20080132966A1 | US20080154349A1 | US20070156198A1 | US5669924A | US6972031B1 | US7381222B2 | US8361140B2 | US20050232965A1 | US20050251212A1 | US20070187255A1 | US20110178416A1 | EP1343112A1 | EP1483730B1 | WO2003082403A2 | WO2005097256A3 | WO2006041664A3 | WO2007013065A3 | WO2007118090A2 | WO2008039982A2 | US20040019364A1 | US20060004420A1 | US20080004673A1 | US20050033407A1 | US20070038260A1 | US20070038261A1 | US20070049989A1 | US20060089678A1 | US20070100433A1 | US20070106340A1 | US7218964B2 | US7238191B2 | US20080181927A1 | US6413273B1 | US6641605B1 | US20020173838A1 | US20030060585A1 | US20030199806A1 | US20040249442A1 | US20060241334A1 | US20070282385A1 | US20080194905A1 | US20080195190A1 | US20080319504A1 | US20090248138A1 | US20090248141A1 | US20090292348A1 | US20100211131A1 | EP1127557A1 | EP1153581A1 | EP1200152A1 | WO2003082080A3 | WO2007013065A2 | WO2008083235A2 | 216 | B. Ziaie, et al., An Implantable Pressure Sensor Cuff for Tonometric Blood Pressure Measurement, IEEE Solid-State Sensor and Actuator Workshop, pp. 216-219, Jun. 1998. | Ascorbic Acid Selectively Improves Large Elastic Artery Compliance in Postmenopausal Women, Moreau K.L., Hypertension 2005;45: 1107. DOI:10.1161/01.HYP.0000165678.63373.8c 4 | Carotid sinus nerve blockade to reduce blood pressure instability following carotid endarterectomy: a systematic review and meta-analysis, Tang T.Y., Eur J Vase Endovasc Surg. Sep. 2007; 34(3):304-11, (an abstract). DOI:10.1016/j.ejvs.2007.02.024 | Coronary artery baroreceptor-mediated changes in arterial pressure: a pilot study in conscious and anaesthetized sheep, Bennetts J.S., Clin Exp Pharmacol Physiol. Sep. 2001; 28(9):768-72, (an abstract). DOI:10.1046/j.1440-1681.2001.03522.x 3 | Effect of increased renal venous pressure on renal function, Doty J. M., The Journal of Trauma: Injury, Infection, and Critical Care: Dec. 1999, vol. 47, Issue 6, p. 1000, (an abstract). DOI:10.1097/00005373-199912000-00002 15 | Glomerular ultrafiltration dynamics during increased renal venous pressure, J.R. Dilley, AJPRenal Physiology, vol. 244, Issue 6 650-F658, (an abstract). | Implantable penile venous compression device: initial experience in the acute canine model, Paick J., The Journal of Urology 1992, vol. 148, No. 1, pp. 188-191, (an abstract). | Theoretical and electrophysiological evidence for axial loading about aortic baroreceptor nerve terminals in rats, Feng B, Am J Physiol Heart Circ Physiol. Dec. 2007; 293(6):H3659-72. DOI:10.1152/ajpheart.00712.2007 | The effects of altering mean pressure, pulse pressure and pulse frequency on the impulse activity in baroreceptor fibres from the aortic arch and right subclavian artery in the rabbit, Angell James JE, J Physiol. Apr. 1971; 214(1):65-88. 1 | International search report and written opinion dated Jan. 24, 2007 for PCT/IL2006/000856. | U.S. Appl. No. 60/702, 491. | U.S. Appl. No. 60/721, 728. | S. Levenberg, et al., Endothelial cells derived from human embryonic stem cells, PNAS Apr. 2, 2002, vol. 99, No. 7 pp. 4391-4396. DOI:10.1073/pnas.032074999 22 | J.H.P. Lardenoye, et al., Inhibition of Accelerated Atherosclerosis in Vein Grafts by Placement of External Stent in ApoE*3-Leiden Transgenic Mice, Arteriosclerosis, Thrombosis, and Vascular Biology. 2002; 22:1433.) © 2002. DOI:10.1161/01.ATV.0000030339.79524.6E 7 | An International Search Report dated Feb. 3, 2010, which issued during the prosecution of Applicant's PCT/IL09/00932. | Mendelsohn (1998) Am J Cardiol 82:1077-1081. DOI:10.1016/S0002-9149(98)00562-1 | Riley, W. A., Barnes, R. W., Evans, G W, Burke, G L, Evans, Gregory W, & Burke, Gregory L. (1992). Ultrasonic measurement of the elastic modulus of the common carotid artery. The Atherosclerosis Risk in Communities (ARIC) Study WA Riley, RW Barnes, GW Evans and GL Burke Stroke 1992;23;952-956. Stroke. | Delfino, A., Stergiopulos, N., & Moore, J. E. (1997) Residual Strain Effects on the Stress Field in a Thick Wall Finite Element Model of the Human Carotid Bifurcation. Science, 30(8), 777-786. DOI:10.1016/S0021-9290(97)00025-0 | Mendelowitz, D., & Scher, A M. (1990). Pulsatile pressure can prevent rapid baroreflex resetting. The American journal of physiology, 258(1 Pt 2), H92-100. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/2301618. | An Office Action dated Mar. 14, 2013, which issued during the prosecution of U.S. Appl. No. 13/030, 384. | An Office Action dated Sep. 27, 2012, which issued during the prosecution of U.S. Appl. No. 13/030, 384. | An Office Action dated Jan. 3, 2013, which issued during the prosecution of U.S. Appl. No. 12/774, 254. | An Office Action dated Apr. 19, 2012, which issued during the prosecution of U.S. Appl. No. 12/774, 254. | An Office Action dated Jan. 29, 2013, which issued during the prosecution of U.S. Appl. No. 12/602, 787. | A Supplementary European Search Report dated Dec. 14, 2012, which issued during the prosecution of European Patent Application No. 06766171. | An International Search Report dated Dec. 5, 2011, which issued during the prosecution of Applicant's PCT/IL11/00356. | Logan, Percutaneous Mitral Valve Therapy, RN Foundation for Cardiovascular Medicine, La Jolla, pp. 20-22, 2008. | Davos, The Effect of Baroreceptor Activity on Cardiovascular Regulation; Hellenic j. Cardiol; 43:145-155; 2002. | Office action dated Oct. 21, 2014 for U.S. Appl. No. 13/116, 370. | 29 | US10384043B2 | US10653513B2 | US10786372B2 | US9125567B2 | US9125732B2 | US9457174B2 | US9550048B2 | US9592136B2 | US9642726B2 | 9 | 2022-06-30 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 8TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1552); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY FEE PAYMENT YEAR 8 | 2022-02-08 FEPP FEE PAYMENT PROCEDURE ENTITY STATUS SET TO UNDISCOUNTED (ORIGINAL EVENT CODE: BIG.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | 2018-07-02 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YR, SMALL ENTITY (ORIGINAL EVENT CODE: M2551) FEE PAYMENT YEAR 4 | 2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE | 2014-07-02 AS ASSIGNMENT ENOPACE BIOMEDICAL LTD, ISRAEL ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:GROSS, YOSSI;REEL/FRAME:033229/0194 2008-12-31 | 2014-07-02 AS ASSIGNMENT RAINBOW MEDICAL LTD., ISRAEL ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:ENOPACE BIOMEDICAL LTD.;REEL/FRAME:033229/0224 2008-03-09 | 2014-07-02 AS ASSIGNMENT RAINBOW MEDICAL LTD., ISRAEL ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:GROSS, YOSSI;REEL/FRAME:033229/0379 2011-06-21 | 2014-07-02 AS ASSIGNMENT VASCULAR DYNAMICS, INC., DELAWARE ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:RAINBOW MEDICAL LTD.;REEL/FRAME:033229/0284 2013-08-19 | 2014-04-11 AS ASSIGNMENT VASCULAR DYNAMICS, INC., CALIFORNIA ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:GROSS, YOSSI;REEL/FRAME:032652/0682 2013-12-12 | 2014-04-09 AS ASSIGNMENT VASCULAR DYNAMICS INC., CALIFORNIA ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:GROSS, YOSSI;REEL/FRAME:032634/0806 2013-12-12 | US8923972B2 | CN102227190A | CN102227190B | CN103338709A | CN103338709B | CN104665796A | CN106037990A | EP1909694A2 | EP1909694A4 | EP1909694B1 | EP2346405A1 | EP2346405A4 | EP2346405B1 | EP2566386A2 | EP2566386A4 | EP2566386B1 | EP3888600A1 | ES2725524T3 | ES2854825T3 | IL189018A0 | IL189018A | JP2009502302A | US10384043B2 | US11197992B2 | US20080033501A1 | US20080215117A1 | US20110077729A1 | US20110118773A1 | US20110178416A1 | US20110213408A1 | US20110230953A1 | US20110238133A1 | US20130172981A1 | US20140135902A1 | US20150005850A1 | US20150119973A1 | US20160058989A1 | US20170135829A1 | US20170196713A1 | US20200384248A1 | US20220296395A1 | US8862243B2 | US9125567B2 | US9125732B2 | US9457174B2 | US9550048B2 | US9592136B2 | US9642726B2 | WO2007013065A2 | WO2007013065A3 | WO2010035271A1 | WO2011138780A2 | WO2011138780A3 | 20070201WO2007013065A2 |
| 2779 | US8921041B2 | Device and method for electroporation-based delivery of molecules into cells and dynamic monitoring of cell responses | US2002397749P | US2002435400P | US2003469572P | US2003705447A | US2003705615A | US2003519567P | US2004542927P | US2004548713P | US2004598609P | US2004598608P | US2004613749P | US2004613872P | US2004614601P | US2004987732A | US2004630071P | US2004630131P | US2004630809P | US2004633019P | US2005647075P | US2005647189P | US2005647159P | US200555639A | US2005653904P | US2005660898P | US2005660829P | US2005673678P | US2005689422P | US2005198831A | US2005197994A | US2005235938A | US2005286882A | 2002-07-20 | 2002-12-20 | 2003-05-09 | 2003-11-10 | 2003-11-10 | 2003-11-12 | 2004-02-09 | 2004-02-27 | 2004-08-04 | 2004-08-04 | 2004-09-27 | 2004-09-27 | 2004-09-29 | 2004-11-12 | 2004-11-22 | 2004-11-22 | 2004-11-24 | 2004-12-03 | 2005-01-26 | 2005-01-26 | 2005-01-26 | 2005-02-09 | 2005-02-17 | 2005-03-10 | 2005-03-10 | 2005-04-21 | 2005-06-10 | 2005-08-04 | 2005-08-04 | 2005-09-27 | 2005-11-23 | US13474355A | 2012-05-17 | B2 | 2014-12-30 | Wang Xiaobo|San Diego, CA, US | Abassi Yama A.|San Diego, CA, US | Atienza Josephine|San Diego, CA, US | Xu Xiao|San Diego, CA, US | Xu Junquan|San Diego, CA, US | ACEA Biosciences Inc.,San Diego,CA,US | Wang Xiaobo,San Diego,CA,US | Abassi Yama A.,San Diego,CA,US | Atienza Josephine,San Diego,CA,US | Xu Xiao,San Diego,CA,US | Xu Junquan,San Diego,CA,US | AGILENT TECHNOLOGIES INC. | B04 C | D16 C | S03 E | T04 E | P75 N | B04-F01 | B04-F02 | B04-F02A | B04-F04 | B05-B02C | B11-C08B | B11-C08C | B11-C08D | B11-C08K | B11-C09 | B12-K04 | B12-K04E | D05-H08 | D05-H09 | D05-H13 | T04-D04 | C12Q000168 | C12M000142 | C12N001587 | C12N001587 | C12M003502 | G01N003348728 | G01N001512 | 4350061 | 4351731 | 4351736 | 4352852 | 4352884 | 435375 | 435456 | 435476 | NaN | The present invention includes devices and methods for transfecting a cell or cell population and dynamic monitoring of cellular events. A variety of microelectronic devices are provide that incorporate functions such as electroporation, modulation of a transmembrane potential and dynamic monitoring of cellular functions and mechanisms. | Device and method for electroporation-based delivery of molecules into cells and dynamic monitoring of cell responses | What is claimed is: \n1. A method of monitoring a cellular response in real time comprising: \na. introducing a cell or cell population to a substrate comprising impedance monitoring electrodes; \nb. transfecting the cell or cell population with a molecule using a transfection method selected from the group consisting of a viral transfection method, a chemical transfection method, and a thermal transfection method; wherein the molecule is capable of effecting at least one selected from the group consisting of a cellular function, cell morphology, a cellular receptor, and a signal transduction pathway activated by a receptor; further wherein the cellular function is selected from the group consisting of cell proliferation cell adhesion and cell spreading; and \nc. monitoring impedance of the cell or cell population when the cell or cell population is in contact with at least one of the impedance monitoring electrodes. \n2. A method of monitoring a cellular response in real time comprising: \na. introducing a cell or cell population to a substrate comprising impedance monitoring electrodes; \nb. transfecting the cell or cell population with a molecule using a viral transfection method, wherein the viral transfection method is an adenovirus transfection method or a vaccinia virus transfection method; and \nc. monitoring impedance of the cell or cell population when the cell or cell population is in contact with at least one of the impedance monitoring electrodes. \n3. A method of monitoring a cellular response in real time comprising: \na. introducing a cell or cell population to a substrate comprising impedance monitoring electrodes; \nb. transfecting the cell or cell population using a chemical transfection method, wherein the chemical transfection method is a lipid-mediated transfection method or an amine-based transfection method; and \nc. monitoring impedance of the cell or cell population when the cell or cell population is in contact with at least one of the impedance monitoring electrodes. \n4. A method of monitoring a cellular response in real time comprising: \na. introducing a cell or cell population to a substrate comprising impedance monitoring electrodes; \nb. transfecting the cell or cell population with a molecule using a transfection method, wherein the transfection method is a thermal transfection method; and \nc. monitoring impedance of the cell or cell population when the cell or cell population is in contact with at least one of the impedance monitoring electrodes. \n5. The method according to claim 1, wherein the cell is a eukaryotic cell or a mammalian cell.\n6. The method according to claim 1, wherein the molecule is selected from the group consisting of a DNA molecule, an RNA molecule, an oligopeptide, a polypeptide, a protein and a compound.\n7. The method according to claim 6, wherein the DNA molecule is selected from the group consisting of a recombinant DNA molecule, a native DNA molecule, a plasmid, a cDNA, an anti-sense DNA strand, and an oligonucleotide.\n8. The method according to claim 6, wherein the RNA molecule is selected from the group consisting of a siRNA molecule, a microRNA molecule, a native RNA molecule, a ribozyme RNA, and an aptamer.\n9. The method according to claim 1, wherein the molecule is a capable of affecting a member selected from the group consisting of transcription, translation, RNA splicing, and RNA editing.\n10. The method according to claim 1, wherein the molecule is capable of affecting the cellular function.\n11. The method according to claim 1, wherein the molecule is capable of affecting cell morphology.\n12. The method according to claim 1, wherein the molecule is capable of affecting the cellular receptor or signal transduction pathway activated by the receptor.\n13. The method according to claim 10, further comprising, \ntransfecting a cell or cell population with a control molecule; \nmonitoring the impedance of the cell or cell population transfected with the control molecule; and \ncomparing monitored impedances between the cell population transfected with the molecule and the cell population transfected with the control molecule; \nwherein the control molecule is a molecule that has no direct effect on cellular function. \n14. The method according to claim 1, wherein the step of monitoring impedance comprises performing a series of impedance measurements.\n15. The method according to claim 1, further comprising monitoring impedance of the cell or cell population before the step of transfecting the cell or cell population.\n16. The method according to claim 15, further comprising determining the cell or cell population is to be transfected if at least one impedance measurement prior transfecting the cell or cell population is within a predetermined range.\n17. The method according to claim 1, wherein the steps of transfecting the cell or cell population and monitoring impedance are performed on a same device.\n18. The method according to claim 1, further comprising visually monitoring the cell or cell population while monitoring impedance of the cell or cell population.\n19. The method according to claim 1, further comprising detecting fluorescence of the cell or cell population.\n20. The method according to claim 1, further comprising determining a cell index or a change in cell index.\n21. The method according to claim 1, further comprising conducting an end point assay selected from the group consisting of a cell viability assay, an apoptosis assay, an enzymatic activity assay, a signal transduction analysis assay, and a reporter assay.\n22. The method according to claim 21, wherein an impedance measurement is used as a guide to determine a time for conducting the end-point assay.\n23. A device for monitoring a cell or cell population comprising: \na) a multi-well plate, each well comprising a nonconductive substrate; \nb) a plurality of electrode arrays positioned on the substrate, wherein each electrode array comprises at least two electrodes, further wherein each electrode is separated from at least one adjacent electrode by an area of non-conductive material; and \nc) at least one set of electroporation or electrostimulation electrodes, the electroporation electrodes capable of electroporating a cell or the electrostimulation electrodes capable of affecting cell membrane potential. \n24. The device according to claim 23, wherein a first half of the set of electroporation or electrostimulation electrodes are in the plane of the substrate and a second half of the set of electrodes are not within the plane of the substrate.\n25. The method according to claim 1, wherein the transfection method is the viral transfection method, and is an adenovirus transfection method or a vaccinia virus transfection method.\n26. The method according to claim 2, further comprising monitoring impedance of the cell or cell population before the step of transfecting the cell or cell population.\n27. The method according to claim 26, further comprising determining the cell or cell population is to be transfected if at least one impedance measurement prior transfecting the cell or cell population is within a predetermined range.\n28. The method according to claim 2, wherein the molecule is capable of affecting a cellular function selected from the group consisting of cell proliferation, cell adhesion, and cell spreading or capable of affecting cell morphology.\n29. The method according to claim 2, further comprising conducting an end point assay selected from the group consisting of a cell viability assay, an apoptosis assay, an enzymatic activity assay, a signal transduction analysis assay, and a reporter assay.\n30. The method according to claim 3, further comprising monitoring impedance of the cell or cell population before the step of transfecting the cell or cell population.\n31. The method according to claim 30, further comprising determining the cell or cell population is to be transfected if at least one impedance measurement prior transfecting the cell or cell population is within a predetermined range.\n32. The method according to claim 3, wherein the molecule is capable of affecting a cellular function selected from the group consisting of cell proliferation, cell adhesion, and cell spreading or capable of affecting cell morphology.\n33. The method according to claim 3, further comprising conducting an end point assay selected from the group consisting of a cell viability assay, an apoptosis assay, an enzymatic activity assay, a signal transduction analysis assay, and a reporter assay.\n34. The method according to claim 4, further comprising monitoring impedance of the cell or cell population before the step of transfecting the cell or cell population.\n35. The method according to claim 34, further comprising determining the cell or cell population is to be transfected if at least one impedance measurement prior transfecting the cell or cell population is within a predetermined range.\n36. The method according to claim 4, wherein the molecule is capable of affecting a cellular function selected from the group consisting of cell proliferation, cell adhesion, and cell spreading or capable of affecting cell morphology.\n37. The method according to claim 4, further comprising conducting an end point assay selected from the group consisting of a cell viability assay, an apoptosis assay, an enzymatic activity assay, a signal transduction analysis assay, and a reporter assay. | 37 | 1. A method of monitoring a cellular response in real time comprising: \na. introducing a cell or cell population to a substrate comprising impedance monitoring electrodes; \nb. transfecting the cell or cell population with a molecule using a transfection method selected from the group consisting of a viral transfection method, a chemical transfection method, and a thermal transfection method; wherein the molecule is capable of effecting at least one selected from the group consisting of a cellular function, cell morphology, a cellular receptor, and a signal transduction pathway activated by a receptor; further wherein the cellular function is selected from the group consisting of cell proliferation cell adhesion and cell spreading; and \nc. monitoring impedance of the cell or cell population when the cell or cell population is in contact with at least one of the impedance monitoring electrodes. | 1. A method of monitoring a cellular response in real time comprising: a. introducing a cell or cell population to a substrate comprising impedance monitoring electrodes; b. transfecting the cell or cell population with a molecule using a transfection method selected from the group consisting of a viral transfection method, a chemical transfection method, and a thermal transfection method; wherein the molecule is capable of effecting at least one selected from the group consisting of a cellular function, cell morphology, a cellular receptor, and a signal transduction pathway activated by a receptor; further wherein the cellular function is selected from the group consisting of cell proliferation cell adhesion and cell spreading; and c. monitoring impedance of the cell or cell population when the cell or cell population is in contact with at least one of the impedance monitoring electrodes. | 2. A method of monitoring a cellular response in real time comprising: a. introducing a cell or cell population to a substrate comprising impedance monitoring electrodes; b. transfecting the cell or cell population with a molecule using a viral transfection method, wherein the viral transfection method is an adenovirus transfection method or a vaccinia virus transfection method; and c. monitoring impedance of the cell or cell population when the cell or cell population is in contact with at least one of the impedance monitoring electrodes. | 3. A method of monitoring a cellular response in real time comprising: a. introducing a cell or cell population to a substrate comprising impedance monitoring electrodes; b. transfecting the cell or cell population using a chemical transfection method, wherein the chemical transfection method is a lipid-mediated transfection method or an amine-based transfection method; and c. monitoring impedance of the cell or cell population when the cell or cell population is in contact with at least one of the impedance monitoring electrodes. | 4. A method of monitoring a cellular response in real time comprising: a. introducing a cell or cell population to a substrate comprising impedance monitoring electrodes; b. transfecting the cell or cell population with a molecule using a transfection method, wherein the transfection method is a thermal transfection method; and c. monitoring impedance of the cell or cell population when the cell or cell population is in contact with at least one of the impedance monitoring electrodes. | 23. A device for monitoring a cell or cell population comprising: a) a multi-well plate, each well comprising a nonconductive substrate; b) a plurality of electrode arrays positioned on the substrate, wherein each electrode array comprises at least two electrodes, further wherein each electrode is separated from at least one adjacent electrode by an area of non-conductive material; and c) at least one set of electroporation or electrostimulation electrodes, the electroporation electrodes capable of electroporating a cell or the electrostimulation electrodes capable of affecting cell membrane potential. | CROSS REFERENCE TO RELATED APPLICATIONS \n\nThis application is a continuation of U.S. patent application Ser. No. 11/286,882, filed Nov. 23, 2005, which is a continuation-in-part of PCT patent application serial number PCT/US05/34561 filed on Sep. 27, 2005, now expired and a continuation-in-part of U.S. patent application Ser. No. 11/235,938 entitled, Dynamic Monitoring of Cell Adhesion and Spreading Using the RT-CES System, filed on Sep. 27, 2005, now U.S. Pat. No. 7,732,127, which is a continuation in part of U.S. patent application Ser. No. 11/197,994 entitled, Method for Assaying for Natural Killer, Cytotoxic T-Lymphocyte and Neutrophil-Mediated Killing of Target Cells Using Real-Time Microelectronic Cell Sensing Technology, filed on Aug. 4, 2005, now U.S. Pat. No. 7,468,255, which is a continuation-in-part of U.S. patent application Ser. No. 11/055,639, entitled Real time electronic cell sensing system and applications for cytotoxicity profiling and compound assays filed on Feb. 9, 2005, now U.S. Pat. No. 7,560,269, which is a continuation-in-part of U.S. patent application Ser. No. 10/987,732, entitled Real time electronic cell sensing system and application for cell based assays filed on Nov. 12, 2004, now U.S. Pat. No. 7,192,752, which claims priority from U.S. provisional application Ser. No. 60/519,567, filed on Nov. 12, 2003. All applications referred to in this paragraph are incorporated by reference in their entireties herein. \n\nParent U.S. patent application Ser. No. 10/987,732 is itself a continuation-in-part of U.S. patent application Ser. No. 10/705,447 filed on Nov. 10, 2003, now U.S. Pat. No. 7,470,533, entitled Impedance Based Devices and Methods for Use in Assays which claims priority to U.S. provisional patent application Ser. No. 60/397,749, filed on Jul. 20, 2002; U.S. provisional patent application Ser. No. 60/435,400, filed on Dec. 20, 2002; U.S. provisional patent application Ser. No. 60/469,572, filed on May 9, 2003; and PCT patent application serial number PCT/US03/22557, filed on Jul. 18, 2003, now expired. All of the applications referred to in this paragraph are incorporated by reference in their entireties herein. \n\nParent U.S. patent application Ser. No. 11/235,938 also claims benefit of priority to U.S. provisional patent application Ser. No. 60/630,131, filed on Nov. 22, 2004; U.S. provisional patent application Ser. No. 60/630,071 filed on Nov. 22, 2004; U.S. provisional patent application Ser. No. 60/613,872 filed on Sep. 27, 2004; U.S. provisional patent application Ser. No. 60/613,749, filed on Sep. 27, 2004; U.S. provisional patent application Ser. No. 60/630,809 filed on Nov. 24, 2004; U.S. provisional patent application Ser. No. 60/633,019 filed on Dec. 3, 2004; U.S. provisional patent application Ser. No. 60/647,159 filed on Jan. 26, 2005; U.S. provisional patent application Ser. No. 60/653,904 filed on Feb. 17, 2005; and U.S. provisional patent application Ser. No. 60/673,678 filed on Apr. 21, 2005; U.S. provisional patent application Ser. No. 60/689,422 filed on Jun. 10, 2005; PCT patent application serial number PCT/US05/27943 filed on Aug. 4, 2005, now expired and PCT patent application serial number PCT/US05/27891 filed on Aug. 4, 2005, now expired. All of which are incorporated by reference in their entirety. \n\nParent U.S. patent application Ser. No. 11/235,938 is also a continuation-in-part of U.S. patent application Ser. No. 11/198,831, entitled, Dynamic Monitoring of Activation of G-Protein Coupled Receptor (GPCR) and Receptor Tyrosine Kinase (RTK) in Living Cells using Real-Time Microelectronic Cell Sensing Technology, filed on Aug. 4, 2005, which is herein incorporated by reference in its entirety. \n\nParent U.S. patent application Ser. No. 10/987,732 is also a continuation-in-part of U.S. patent application Ser. No. 10/705,615, entitled Impedance Based Apparatuses and Methods for Analyzing Cells and Particles, filed on Nov. 10, 2003, now U.S. Pat. No. 7,459,303, which claims priority to U.S. provisional patent application Ser. No. 60/397,749 filed on Jul. 20, 2002; U.S. provisional patent application Ser. No. 60/435,400, filed on Dec. 20, 2002; U.S. provisional patent application Ser. No. 60/469,572, filed on May 9, 2003; and PCT patent application Ser. No. PCT/US03/22537, filed on Jul. 18, 2003, now expired. All of the applications referred to in this paragraph are incorporated by reference in their entireties herein. \n\nParent U.S. patent application Ser. No. 11/055,639 also claims priority to U.S. provisional patent application Ser. No. 60/542,927 filed on Feb. 9, 2004; U.S. provisional patent application Ser. No. 60/548,713, filed on Feb. 27, 2004, and U.S. provisional patent application Ser. No. 60/614,601, filed on Sep. 29, 2004. All of the applications referred to in this paragraph are incorporated by reference in their entireties herein. \n\nParent U.S. patent application Ser. No. 11/197,994 is also a continuation-in-part of PCT patent application serial number PCT/US05/04481, filed on Feb. 9, 2005, now expired. All of the applications referred to in this paragraph are incorporated by reference in their entireties herein. \n\nParent U.S. patent application Ser. No. 11/197,994 also claims priority to U.S. provisional patent application Ser. No. 60/598,608, filed on Aug. 4, 2004, U.S. provisional patent application Ser. No. 60/630,131, filed on Nov. 22, 2004, U.S. provisional patent application Ser. No. 60/689,422, filed on Jun. 10, 2005, U.S. provisional patent application Ser. No. 60/598,609, filed on Aug. 4, 2004, U.S. provisional patent application Ser. No. 60/613,749, filed on Sep. 27, 2004, U.S. provisional patent application Ser. No. 60/647,189, filed on Jan. 26, 2005, U.S. provisional patent application Ser. No. 60/647,075, filed on Jan. 26, 2005, U.S. provisional patent application Ser. No. 60/660,829, filed on Mar. 10, 2005, and U.S. provisional patent application Ser. No. 60/660,898, filed on Mar. 10, 2005. All of the applications referred to in this paragraph are incorporated by reference in their entireties herein. \n\nParent U.S. patent application Ser. No. 11/286,882 also claims benefit of priority to U.S. provisional patent application Ser. No. 60/630,809, filed on Nov. 24, 2004; U.S. provisional patent application Ser. No. 60/633,019 filed on Dec. 3, 2004; U.S. provisional patent application Ser. No. 60/653,904 filed on Feb. 17, 2005; and U.S. provisional patent application Ser. No. 60/673,678 filed on Apr. 21, 2005. All of the applications referred to in this paragraph are incorporated by reference in their entireties herein. \n\nBRIEF DESCRIPTION OF THE DRAWINGS \n\nFIG. 1 depicts a well in a multi-well plate of a device of the present invention for monitoring cell-substrate impedance as well as for cell electroporation or cell electrostimulation. The device comprises electrode structures 110 and 120 on a nonconductive substrate 160, which are used for monitoring cell-substrate impedance with an impedance analyzer Z (180). The device further comprises a set of electroporation or electrostimulation electrodes: (1) the top electrode 130 and (2) the electrode structures 110 and 120 linked together. The set of electroporation or electrostimulation electrodes is connected to a signal source V (100) that can generate appropriate electrical signals for electroporation or electrostimulation of the cells.\n\nFIG. 2 depicts a well in a multi-well plate of a device of the present invention for monitoring cell-substrate impedance as well as for cell electroporation or cell electrostimulation. The device comprises electrode structures 210 and 220 on the nonconductive substrate 260, which are used for monitoring cell-substrate impedance with an impedance analyzer Z (280). The device further comprises a pair or a set of electroporation or electrostimulation electrodes: (1) the sidewall electrode 230 and (2) the electrode structures 210 and 220 linked together. The set of electroporation or electrostimulation electrodes is connected to a signal source V (200) that can generate appropriate electrical signals for electroporation or electrostimulation of the cells.\n\nFIG. 3 depicts a well in a multi-well plate of a device of the present invention for monitoring cell-substarte impedance as well as for cell electroporation or cell electrostimulation. The device comprises electrode structures 310 and 320 on a porous, nonconductive substrate 360, which are used for monitoring cell-substrate impedance with an impedance analyzer Z (380). The device further comprises a pair or a set of electroporation or electrostimulation electrodes: (1) the top electrode 330 and (2) the bottom electrode 340. The set of electroporation or electrostimulation electrodes is connected to a signal source V (300) that can generate appropriate electrical signals for electroporation or electro stimulation of the cells.\n\nFIG. 4A shows fluorescent microscopy images of SKOV3 cells electroporated with siCy3-Luciferase GL2. 5×103 SKOV3 cells were plated on ACEA 16× electronic plate devices. A final concentration of 100 nM siCy3-Luciferase GL2 in Opti-MEM was overlayed on the wells and electroporated by applying electrical voltages to electrodes located at the bottom of the wells. Fluorescent images were taken 2 hours after electroporation. Two representative images are shown for experimental wells (+e/+siRNA), cells electroporated with siCy3-Luciferase GL2, and control wells (+e/?siRNA or ?e/+siRNA), cells electroporated without siCy3-Luciferase GL2 or without electroporation but with siCy3-Luciferase GL2, respectively. For electroporation, the electrical voltages of sinusoidal waveform having 30 kHz frequency and 15 V peak-to-peak amplitude with a 300 msec duration were applied to the electrodes at the bottom of the wells.\n\nFIG. 4B shows fluorescent microscopy images comparing transfection of siCy3-Luciferase GL2 into SKOV3 cells using electroporation by applying electrical voltages to the electrode structures located at the bottom of the well and chemical transfection. Fluorescent images were taken 2 hours after electroporation. First and second columns are representative images of sequential wells (A-H) electroporated using two different electroporation conditions (sinusoidal voltage signals having 30 kHz frequency, 10 V peak-to-peak or 15 V peak-to-peak, duration of 200 ms) with 40 nM siCy3-Luciferase GL2. Third column shows representative images of cells transfected using lipid and amine based transfection reagents with 40 nM siCy3-Luciferase GL2.\n\nFIG. 5 shows dynamic monitoring and comparison of cytotoxicity effects of electroporation and chemical transfection of siCy3-Luciferase GL2 into SKOV3 cells using ACEA Real Time Cell Electronic Sensing system. A) Cell index measurements before and 24 hours after electroporation of SKOV3 cells with 40 nM siCy3-Luciferase GL2 in different wells (E2-H2) and including control wells (+e/?siRNA, ?e/+siRNA), cells electroporated without siCy3-Luciferase GL2 or without electroporation but with siCy3-Luciferase GL2, respectively. For electroporation, the electrical voltages of sinusoidal waveform having 30 kHz frequency and 15 V peak-to-peak amplitude with a 300 msec duration were applied to the electrodes at the bottom of the wells. B) Cell index measurements before and 24 hours after chemical transfection of SKOV3 cells with 40 nM siCy3-Luciferase GL2 using lipid and amine based transfection reagents, and including control wells (+e/?siRNA, ?e/+siRNA), cells electroporated without siCy3-Luciferase GL2 or without electroporation but with siCy3-Luciferase GL2, respectively. For electroporation, the electrical voltages of sinusoidal waveform having 30 kHz frequency and 15 V peak-to-peak amplitude with a 300 msec duration were applied to the electrodes at the bottom of the wells.\n\nFIG. 6 shows dynamic monitoring of BxPC3 cells transfected with siSRC over 4 days. 10×103 BxPC3 cells were plated overnight and transfected with 20 ?M siSRC the following day using standard lipid-mediated transfection procedures. Average cell indices of 4 wells transfected with siSRC duplexes or siControl were plotted over 4 days.\n\nFIG. 7 shows dynamic monitoring of HeLa cells transfected with siTOX siRNA or control siRNA siControl over 3 days after lipofectamine-mediated transfection. HeLa cells were seeded in ACEA 16× E-Plates at a density of 5000 cells per well and the cells were allowed to attach and grow for about 18 hours. The cells were then transfected using standard lipid-mediated transfection procedures with 100 nM siTOX siRNA (Ambion) or 100 nM of siControl siRNA. The siTOX siRNA induces cell death and apoptosis upon uptake by the cells. siTOX transfection leads to an eventual decrease in Cell Index of HeLa cells.\n\nFIG. 8 shows dynamic monitoring of Hela cells transfected with siTOX siRNA or control siRNA siControl over 3 days after electroporation-mediated transfection. HeLa cells were seeded in ACEA 16× E-Plate devices at a density of 5000 cells per well and the cells were allowed to attach and grow for about 18 hours. The E-Plate devices were connected to a voltage signal generator (or electroporator) and the cells were electroporated in the presence of 100 nM of siTOX and siControl siRNAs. The cells were continually monitored after electroporation. siTOX electroporated cells lose cell viability as measured by an eventual decrease in Cell Index.\n\nFIG. 9 shows a schematic drawing of a 384-unit electroporation device with individual unit consists of parallel electrode elements\n\nFIG. 10A shows image of the HT1080 cells that were cultured on an electronic plate overnight and were electroporated with a 10 kHz sine wave signal of 10 V peak-to-peak with pulse duration of 100 ms in the presence of Lucifer yellow dye. The cells show bright fluorescence, reflecting the fact that the cell membranes were electroporated as a result of large induced membrane potential, and that the Lucifer yellow dyes had entered the cells.\n\nFIG. 10B shows the image of the HT1080 cells that were cultured in the wells to which no electric voltages were applied. The Lucifer yellow dye was also added to the wells.\n\nFIG. 11 . shows real-time monitoring of cancer cells treated with paclitaxel. Real-time monitoring in cell-based assays allows the user to determine when is the best time to perform a certain treatment. In addition, real-time monitoring offered by the RT-CES system also allows the user to observe the mode of compound interaction with the target cells.\n\nFIG. 12 shows real-time monitoring of the functional activation of G-protein-coupled muscarinic M2 (A) and M3 (B) receptors in RBL-2H3 cells using the RT-CES system. Real-time monitoring allows profiling and monitoring of receptor-specific responses.\n\nTECHNICAL FIELD \n\nThe present application relates to microelectronic devices and methods of use of to detect changes in impedance of a cell, and more specifically to microelectronic devices for electroporation-based delivery of molecules into cells and dynamic monitoring of cellular responses and microelectronic devices for monitoring the effects of compounds on voltage gated ion channels and methods of use. \n\nBACKGROUND \n\nThe mapping and sequencing of the human genome will probably be one of the most remarkable achievements of the 21 st century. This effort, led by the Human Genome Project has created an unprecedented opportunity to characterize and understand the function of the repertoire of newly discovered genes at the individual gene level and the complexities in the interaction of the gene products at the organism level (Austin, C. P, 2004, Annu. Rev. Med. Vol. 55, pp 1-13). Only when this task is truly achieved and understood can the scientific community deliver on the promise of the Human Genome Project for blockbuster drugs and targeted therapy for different ailments afflicting mankind (Austin, C. P, 2004, Annu. Rev. Med. Vol. 55, pp 1-13).\n\nThe task of functional characterization of newly discovered genes is initiated by the introduction of plasmids containing a copy of the gene of interest into mammalian cells so that its function can be assessed in an appropriate cellular context such as proliferation, viability, gene expression and differentiation amongst others (Kramer, R. and Cohen D., 2004, Nat. Rev. Drug Discov. Vol. 3, pp 965-972). Alternatively, dominant negative versions of the gene of interest which interfere with the function of the wildtype gene or reagents which down regulate gene expression such as anti-sense oligonucleotides or interfering RNA (RNAi) can also be introduced into mammalian cells and its impact assessed in various cell-based assays described above (Kramer, R. and Cohen D., 2004, Nat. Rev. Drug Discov. Vol. 3, pp 965-972). Regardless of the approach taken the main hurdle in introducing these reagents into the cell is the penetration of the plasma membrane lipid bilayer. First of all, the plasma membrane lipid bilayer is fairly impervious to most molecules of biologic and medical interest. Moreover, the fact that the lipid bilayer can vary significantly in terms of its polar lipid, protein, glycoprotein and carbohydrate composition from cell type to cell type poses a significant and arduous challenge in introducing various macromolecules into the cells in a systematic manner. \n\nA number of chemical, physical and biological techniques have been devised for introducing macromolecules such as DNA and RNA into mammalian cells. The most widely used method encompasses lipid-mediated transfection which works well for some cell types but not others in particular primary cells and immune cells (Liu, D., Ren, T., and Gao, X., 2003, Curr. Med. Chem. Vol. 10, pp 1307-1315; Nicolazzi, C., Garinot, M., Mignet, N., Scherman, D. and Bessodes, M. 2003, Curr. Med. Chem., Vol. 10, pp 1263-1277). In addition, a number of cells are extremely sensitive to lipid-mediated transfection and there can be significant degree of cytotoxicity associated with this method. Amine-based transfection is another technique that has been utilized for transfection (Blagbrough, I. S., Geall, A. J. and Neal, A. P., 2003, Biochem. Soc. Trans, Vol. 31, pp 397-406). However, it is also prone to the same challenges as lipid-mediated transfection. Another method for introduction of macromolecules into mammalian cells is based on microinjection where a specially designed microcapillary needles are used in conjunction with a micromanipulator apparatus and a microscope (Lamb, N. J., Gauthier-Rouviere, C, m and Fernandez, A. 1996, Front Biosci. Vol. 1, pp 19-29). While, this method is fairly efficient specially for hard to transfect cells such as primary cells and neurons (Washbourne, P. and McAllister, A. K., 2002, Curr Opin Neurobiol. Vol. 12, pp 566-573), its wide scale use has been restricted due to its technical hurdle as well as its throughput and at this moment in time is certainly not feasible for genome-scale procedures. Viral-mediated gene transfer is another method of introducing DNA and RNA into mammalian cells (Hapala, I., 1997, Crit. Rev. Biotechnol. Vol. 17, pp 105-122). Several different systems such as adenovirus and vaccinia virus systems have been successfully used for efficient transfection of mammalian cells, especially neuronal cells. While viral system may work efficiently at the level of single genes, it utility at genome-wide scale is significantly compromised due to the time it takes for construction of viral vectors and for obtaining optimal viral titers for infection. In summary, while a number of procedures have been optimized for transfection and some have been used for genome-wide introduction of genes and RNAi into mammalian cells, none of the procedures discussed are optimal for high throughput, efficient and reproducible introduction of macromolecules into mammalian cells. There is a need to develop a novel, efficient, and reproducible method that can introduce and deliver molecules to cells. \n\nSubsequent to cellular transfection of macromolecules by various means, the effect of the macromolecule(s) are analyzed in the appropriate cellular context by different end-point assays. These end-point assays can only provide information about the cellular effects of the macromolecul transfected only at a specific time point. In addition, these assays typically are applicable to only a single cellular event that is to be analyzed. \n\nU.S. Pat. No. 6,686,193 disclosed instrumentation and methods for screening drug candidate compounds with activity against ion channel targets. The method included modulating the transmembrane potential of host cells in a plurality of sample wells with a repetitive application of electrical fields so as to set the transmembrane potential to some target levels. A number of devices were disclosed. However, the devices had limitations in delivering effective electrical fields to population of cells in the wells. \n\nIn a publication by Burnett et al (Fluoresence Imaging of Electrically Stimulated Cells, by P Burnett, J K Robertson, J M Palmer, R R Ryan, A E Dubin and R A Zivin, in Journal of Biomolecular Screening, volume 8 (6), 2003, pp 660-667), the authors described some preliminary results obtained from devices that were designed to supply electrical stimuli to population of cells. Using a digital fluorescent microscope, changes in voltage-gated ion channel activity were monitored. As an example, a device with an interdigitated electrode fingers were used to electrically stimulate cells. However, these techniques have not been successfully coupled to a real time electronic cell sensing system. \n\nSUMMARY \n\nIn one aspect of the present invention a method of monitoring a cellular response in real time is provided including transfecting a cell or cell population with a molecule or molecules; and monitoring impedance of said cell or said cell population. Examples of cell transfection may include chemical transfection methods, electroporation, thermal transfection methods and viral transfection methods. Non-limiting examples of chemical transfection methods include lipid-mediated transfection method and amine-based transfection method. Electroporation methods may include applying a sine wave, a square wave or a waveform following an exponential decay. Molecules for electroporation into a cell or cell population include nucleic acid molecules, DNA molecules, RNA molecules, RNAi molecules and siRNA molecules, microRNA molecules, native RNA molecules, ribozyme RNA molecules, aptamers, plasmids, cDNA molecules, anti-sense DNA strands, oligonucleotides, oligopeptides, polypeptides, proteins and organic compounds. The methods will have particular utility to eukaryotic cells including human cells. Also are included molecules capable of affecting transcription, translation, RNA splicing, RNA editing or a cellular function such as cell proliferation, cell adhesion, and cell spreading. The molecule is capable of affecting cell morphology, a cellular receptor or a signal transduction pathway that is activated by a cellular receptor. \n\nImpedance monitoring may be performed by conducting a series of impedance measurements and optionally determining a change in impedance for cells prior to and after transfection with molecules. The impedance of control cells can also be monitored. Control cells may refer to cells that are transfected with control molecules using the same transfection method as that for the test cells. Control molecules are molecules that do not have direct effects on cellular functions that are being tested. Control cells may also refer to cells that are not transfected with any molecules. Control cells may also refer to cells that are transfected with molecules of interest with different transfection method. A cell index or normalized cell index may also be determined. The cell or cell index may be compared at different time points within the same cell or cell population or may be compared between cells or cell populations. \n\nIn the present application, monitoring of impedance of cell or cell population may be performed prior to transfection of cells with molecules, or after transfection of cells with molecules, or prior to and after transfection of cells with molecules. Impedance monitoring is used as a method to assess cell proliferation, cell growth, cell death, cell morphology, cell membrane properties (for example, size, morphology, or composition of the cell membrane) cell adhesion, cell spreading and/or cell motility and to assess the effects of transfected molecules in cells on cell proliferation, cell growth, cell death, cell morphology, cell membrane properties (for example, size, morphology, or composition of the cell membrane) cell adhesion, cell spreading and/or cell motility. Thus the assays in the present application can be cytotoxicity assays, proliferation assays, apoptosis assays, cell adhesion assays, cell activation or stimulation assays, anti-cancer compound efficacy assays, receptor-ligand binding or signal transduction analysis, assays of cytoskeletal changes, assays of cell structural changes (including but not limited to, changes in cell membrane size, morphology, or composition), cell quantification, cell quality control, time-dependent cytotoxicity profiling, assays of cell differentiation or de-differentiation, detection or quantitation of neutralizing antibodies, specific T-cell mediated cytotoxic effect assays, assays of cell adhesion or spreading, assays of cell-cell interactions, analysis of microbial, viral, or environmental toxins, etc. \n\nIn some embodiments, impedance measurements are used in conjunction with an end point assays such as a cell viability assay, apoptosis assay, enzymatic assay, signal transduction analysis assay, or a reporter assay. An impedance measurement may be used as a guide to determine the time for performing an endpoint assay. For example, the end-point assay may not be conducted until the time-dependent impedance of cells meets certain criteria. In some embodiments, such criteria may include that the impedance has to be above certain threshold values, within certain ranges, and below certain threshold values. In some other embodiments, such criteria may refer that the impedance of cells passes a minimum or maximum along the time dependent course. For example, the time-dependent impedance may initially decrease with time until reaching a minimum, then increase with time after the minimum. In this example, the end-point assay may be conducted immediately after the impedance has passed the minimum point. \n\nCells or cell populations may be electroporated and monitored in the same device or a different device. Impedance may be monitored prior to, after or both prior to and after electroporation. Impedance monitoring may include a series of impedance. A predetermined threshold or range of impedance may be required prior to electroporating a cell or cell population. \n\nIn another aspect of the present invention a method of monitoring the effect of a compound on an ion channel is provided including providing a device capable of monitoring impedance of a cell or cell population and capable of inducing a change in a cell membrane potential; adding a cell or cell population comprising a voltage gated ion channel to the device; adding a test compound to the device; inducing a change in a cell membrane potential; and monitoring the impedance. Monitoring the impedance may be conducted before, during, after, or before and during and after adding the test compound the device. Monitoring the impedance may be conducted before and after inducing the change in cell membrane potential. The cell or cell population may further be monitored optically or by other means to measure cell membrane potential or other ion-channel activity associated parameters before and after inducing a change in cell membrane potential. In an exemplary embodiment, monitoring cell membrane potential is performed using an optical detection method after an optically detectable compound is added to the device. For example, a cell or cell population may be observed by detecting a membrane-potential-sensitive fluorescent dye added to the cell or cell population. Assessing or measuring cell membrane potential or other ion-channel activity-associated parameters may be performed at the same time as, or different times from, monitoring the impedance of cell population. The change in membrane potential may open or close a voltage gated ion channel. A cell index or normalized cell index may be determined and may be compared to the same cell or cell population or may be compared between different cells or cell populations. \n\nIn another aspect of the present invention a device for monitoring a cell or cell population is provided including a nonconductive substrate; a plurality of electrode arrays positioned on the substrate, wherein each electrode array includes at least two electrodes, further wherein each electrode is separated from at least one adjacent electrode by an area of non-conductive material; and at least one set of electroporation or electrostimulation electrodes, the electroporation or electrostimulation electrodes are capable of electroporating a cell or cell population or affecting the membrane potential of a cell. The change in membrane potential may result in opening or closing of a voltage gated ion channel. In some embodiments, a first half of the electroporation or electrostimulation electrodes may be in the plane of the substrate and a second half of the set of electrodes may be outside the plane of the substrate. In some embodiments, the nonconductive substrate is a porous substrate that is located above one half of the at least one set of electroporation or electrostimulation electrodes. \n\nIn some embodiments, the device includes a plate including multiple wells, further wherein at least one of the multiple wells includes a top, bottom and sidewall, further wherein the bottom and the sidewall are constructed from the nonconductive substrate, further wherein the plurality of electrode arrays are positioned at the bottom, further wherein a first half of the at least one set of electroporation or electrostimulation electrodes are positioned at the bottom and a second half of the at least one set of electroporation or electrostimulation electrodes are positioned at the top. The electroporation or electrostimulation electrodes at the top may take the form of a disc electrode or an electrical wire. Examples include a device having a 96 well, a 384 well or 1536 well configuration, which may have dimensions and footprint same as those of standard microtiter plates. The multiple wells are capable of electroporating or electrostimulating cells together or separately. In some embodiments, the plate is capable of stacking on top of a second plate. \n\nIn another aspect of the present invention, a method of identifying an ion channel inhibitor is provided including providing a microlectronic cell sensor array operably connected to an impedance analyzer, the microelectronic cell sensor array including a non-conductive substrate, a plurality of electrode arrays positioned on the substrate, each electrode array including at least two electrodes, and each electrode is separated from at least one adjacent electrode by an area of non-conductive material. The device is capable of affecting the membrane potential in a cell or cell population such that a voltage gated ion channel may open or close. A suspected inhibitor is added to a cell or cell population, th... | ACEA Biosciences Inc.,San Diego,CA,US | Wang Xiaobo,San Diego,CA,US | Abassi Yama A.,San Diego,CA,US | Atienza Josephine,San Diego,CA,US | Xu Xiao,San Diego,CA,US | Xu Junquan,San Diego,CA,US | ACEA Biosciences Inc. | Wang Xiaobo | Abassi Yama A. | Atienza Josephine | Xu Xiao | Xu Junquan | AGILENT TECHNOLOGIES INC | AGILENT TECHNOLOGIES INC | Wang, Xiaobo | Abassi, Yama A. | Atienza, Josephine | Xu, Xiao | Xu, Junquan | 5 | Wagenknecht IP Law Group PC | NaN | Ketter, Jim | US | Dead | 12 | 2014 | US | 5 | 2012 | 2002-05-14 | 2002 | C12 | C12, G01 | 4350061 | 435456 | 4351731 | 4351736 | 435476 | 435375 | 4352884 | 4352852 | WO2001038873A2 | US2656508A | US3743581A | US4072578A | US5001048A | US6440662B1 | US6461808B1 | USRE37977E1 | US6626902B1 | US6637257B2 | US20040091397A1 | WO2002042766A3 | WO2003016887A2 | US3259842A | US5278048A | US5514555A | US5601997A | US5810725A | US6051422A | US6280586B1 | US6288527B1 | US6368851B1 | US6448030B1 | US6472144B2 | US7468255B2 | US8206903B2 | US20020090649A1 | US20030072549A1 | US20030157587A1 | EP1195432B1 | US6492175B1 | WO2002004943A2 | US3890201A | US5187096A | US5801055A | US6169394B1 | US6596499B2 | US7192752B2 | US7732127B2 | US20020076690A1 | US20020086280A1 | US20020150886A1 | US20030104512A1 | US20050014130A1 | WO2001038873A3 | WO2003016887A3 | WO2005005979A1 | US4225410A | US4920047A | US6235520B1 | US6630359B1 | US6686193B2 | US6716620B2 | US7459303B2 | US20030166015A1 | EP1138758A1 | WO2000071669A1 | WO2000037628A1 | WO2001025769A2 | US5218312A | US6232062B1 | US6448794B1 | US20020110847A1 | US20040146849A1 | US20060050596A1 | US5981268A | US4686190A | US5284753A | US5626734A | US5766934A | US5851489A | US6132683A | US7560269B2 | US20020032531A1 | WO1999066329A1 | US5134070A | US5247827A | US5643742A | US6376233B1 | US6566079B2 | US6573063B2 | US6627461B2 | USRE38323E1 | US7470533B2 | US20030032000A1 | WO1996001836A1 | WO2002042766A2 | US5563067A | US5622872A | US6368795B1 | US6485905B2 | US6723523B2 | US20030116447A1 | US20030143625A1 | WO2001025769A3 | WO2002004943A3 | 96 | Wegener et al., Experimental Cell Research vol. 259 (2000) pp. 158-166. DOI:10.1006/excr.2000.4919 43 | Blagbrough et al., Polyamines and novel polyamine conjugates interact with DNA in ways that can be exploited in non-viral gene therapy, Biomed. Soc. Trans. 2003;31(2):397-406. DOI:10.1042/BST0310397 9 | Bonetta, The inside scoop-evaluating gene delivery methods, Nature Methods 2005;2(11):875-883. DOI:10.1038/nmeth1105-875 5 | Hapala, Breaking the Barrier: Methods for Reversible Permeabilization of Cellular Membranes 1997;17(2):105-133. DOI:10.3109/07388559709146609 50 | Nicolazzi et al., Cationic Lipids for Transfection, Curr. Med. Chem, 2003;10:1263-1277. DOI:10.2174/0929867033457467 7 | Wegener et al., Electric Cell-Substrate Impedance Sensing (ECIS) as a Noninvasive Means to Monitor the Kinetics of Cell Spreading to Artificial Surfaces. Experimental Cell Research 259, 158-166 (2000). DOI:10.1006/excr.2000.4919 | Mohr et al., Performance of a thin film microelectrode array for monitoring electrogenic cells in vitro, Sensors and Actuators B34:265-269. 1996. DOI:10.1016/S0925-4005(97)80005-6 24 | Aravanis et al., Biosensors & Bioelectronics 16:571-577 (2001). DOI:10.1016/S0956-5663(01)00171-3 15 | Baumann et al., Sensors & Accuators B55:77-89 (1999). | Becker et al., Cell Biology. 92:960-964 (1995). | Berens et al., Clin. Exp. Metastasis 12:405-415 (1994). DOI:10.1007/BF01755884 19 | Bergveld, Biosensors & Bioelectronics. 6:55-72 (1991). DOI:10.1016/0956-5663(91)85009-L 26 | Bieberich and Guiseppi-Elie, Biosensors & Bioelectronics, 19:923-931 (2004). DOI:10.1016/j.bios.2003.08.016 | Burnett et al., J. Biomo. Screening, 8(6):660-667 (2003). DOI:10.1177/1087057103258546 17 | Burns et al., Journal of Immunology 2893-2903 (1997). | Ciambrone et al., J. Biomo. Screening, 9(6):467-480 (2004). DOI:10.1177/1087057104267788 21 | Connolly et al., Biosensors & Bioelectronics 5:223-234 (1990). DOI:10.1016/0956-5663(90)80011-2 27 | Duan et al., Anal. Chem. 66:1369-1377 (1994). DOI:10.1021/ac00081a003 66 | Ehret et al., Biosensors & Bioelectronics 12(1):29-41 (1997). DOI:10.1016/0956-5663(96)89087-7 29 | Falk et al., J. Immunol. Meth. 33:239-247 (1980). DOI:10.1016/0022-1759(80)90211-2 69 | Fuhr et al., Sensors and Materials 7(2):131-146 (1995). | Giaever et al., Proc. Natl. Acad. Sci 81:3761-3764 (1984). DOI:10.1073/pnas.81.12.3761 | Giaever et al., Proc. Natl. Acad. Sci 88:7896-7900 (1991). DOI:10.1073/pnas.88.17.7896 44 | Gutmann et al., Pharmaceutical Research, 16(3):402-407 (1999). DOI:10.1023/A:1018825819249 23 | Hadjout et al., Biotechniques 31:1130-1138 (2001). | Henning et al., Anti-Cancer Drugs 12:21-32 (2001). DOI:10.1097/00001813-200101000-00004 14 | Hidalgo et al., Gastroenterology 96:736-749 (1989). | Huang et al., Anal. Chem. 74:3362-3371 (2002). DOI:10.1021/ac011273v 40 | Hug, Assay and Drug Dev. Tech., 1(3):479-488 (2003). DOI:10.1089/154065803322163795 22 | Keese et al., Biotechniques 33:842-850 (2002). 18 | Kleinmann et al., Biochemistry 26:312-318 (1986). | Kowolenko et al., Journal of Immunological Methods 127:71-77 (1990). DOI:10.1016/0022-1759(90)90342-S | Larsen et al., Micro Total Analysis Systems 103-106 (2000). | Lin and Huang, J. Micromech. Microeng., 11:542-547 (2001). DOI:10.1088/0960-1317/11/5/315 | Lin et al., Min. For Chem., Bio., & Bioeng., 4:104-108 (2004). DOI:10.1039/b312804k | Lo et al., Experimental Cell Research 204:102-109 (1993). DOI:10.1006/excr.1993.1014 | Lo et al., Experimental Cell Research 213:391-397 (1994). DOI:10.1006/excr.1994.1214 | Lo et al., Biophysical Journal 69:2800-2807 (1995). 20 | Loffert et al., QIAGENNews, 4:15-18 (1997). | Luong et al., Analytical Chemistry 73:1844-1848 (2001). DOI:10.1021/ac0011585 | Mitra et al., Biotechniques 11(4):504-510 (1991). | Miyata et al., Jpn. J. Opthalmol. 34:257-266 (1990). | Ong et al., Sensors 2:219-222 (2002). DOI:10.3390/s20600219 16 | Pancrazio et al., Sensors and Actuators B 53:179-185 (1998). DOI:10.1016/S0925-4005(98)00340-2 | Patolsky et al., Nature Biotechnology 19:253-257 (2001). DOI:10.1038/85704 | Pethig et al., Appl. Phys. 24:881-888 (1992). | Rishpon et al., Biosensors & Bioelectronicsd, 12(3):195-204 (1997). DOI:10.1016/S0956-5663(97)85337-7 | Simpson et al., Trends in Biotechnology 19:317-323 (2001). DOI:10.1016/S0167-7799(01)01691-2 | Sohn et al., Proc. Nat. Acad. Sci. 97(20)10687-10690 (2000). | Stenger et al., Trends in Biotechnology 19:304-309 (2001). DOI:10.1016/S0167-7799(01)01690-0 | Svetlicic et al., Bioelectrochemistry 53: 79-86 (2000). | Tiruppathi et al., Proc Natl Acad Sci USA 89:7919-7923 (1992). DOI:10.1073/pnas.89.17.7919 | Wang et al., Appl. Phys. 1649-1660 (1996). | Wang et al., Appl. Phys. 26: 1278-1285 (1993). DOI:10.1088/0022-3727/26/8/019 | Wang et al., Anal. Chem. 72:832-839 (2000). DOI:10.1021/ac990922o 30 | Wang et al., Biophysical Journal 72:1887-1899 (1997). | Wang et al., Biophysical Journal 74:2689-2701 (1998). 38 | Warburg, Ann. Phy. 6:125-135 (1901). 13 | Wegener et al., Eur. J. Physiol., 437:925-934 (1999). DOI:10.1007/s004240050864 | Wolf et al., Biosensors & Bioelectronics 13:501-509 (1998). DOI:10.1016/S0956-5663(97)00136-X | Xiao and Luong, Biotechnol. Prog., 19:1000-1005 (2003). DOI:10.1021/bp025733x | Xiao et al., Anal. Chem., 74:5748-5753 (2002). DOI:10.1021/ac025848f | Xiao et al., Anal. Chem., 74:1333-1339 (2002). DOI:10.1021/ac011104a | Yamauchi et al., Nuc. Acids Res., 32(22):1-8 (2004). | Yang et al., Anal. Chem. 71:911-918 (1999). DOI:10.1021/ac981250p 52 | New Products page. Science 298:2409 (2002). | EP05852157.6 EP Extended Search Report mailed Sep. 13, 2011. | 67 | EP3556845A1 | RU2636890C2 | US10012636B2 | US10067121B2 | US10168318B2 | US10215748B2 | US10239058B2 | US10533985B2 | US10539523B2 | US10551371B2 | US10620188B2 | US10690677B2 | US10725023B2 | US10799865B2 | US11007520B2 | US11103870B2 | US11220671B2 | US11273177B2 | US11346797B2 | US11360072B2 | US11365381B2 | US11604197B2 | US9399787B2 | US9612234B2 | US9625472B2 | USD941488S1 | 26 | 2023-02-28 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - 2022-12-30 | 2023-02-06 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY | 2022-08-22 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: SMALL ENTITY | 2021-02-25 AS ASSIGNMENT AGILENT TECHNOLOGIES, INC., CALIFORNIA ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:ACEA BIOSCIENCES, INC.;REEL/FRAME:055409/0874 2020-09-01 | 2018-04-05 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YR, SMALL ENTITY (ORIGINAL EVENT CODE: M2551) FEE PAYMENT YEAR 4 | 2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE | 2012-05-17 AS ASSIGNMENT ACEA BIOSCIENCES, CALIFORNIA ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:ABASSI, YAMA A.;WANG, XIAOBO;ATIENZA, JOSEPHINE;AND OTHERS;SIGNING DATES FROM 20060118 TO 20060130;REEL/FRAME:028228/0935 | US8921041B2 | AT442587T | AT448482T | AU2003267998A1 | AU2003267998A8 | AU2003269911A1 | AU2003269911A8 | CA2493101A1 | CA2493101C | CA2493108A1 | CA2493108C | CA2550274A1 | CA2556219A1 | CA2575297A1 | CA2575297C | CA2575573A1 | CA2580548A1 | CA2723223A1 | CA2723223C | CA2760941A1 | CA2760941C | CN100478436C | CN100487133C | CN100577811C | CN101400780A | CN101400780B | CN1681937A | CN1681938A | CN1902305A | DE60306477D1 | DE60306477T2 | DE60306871D1 | DE60306871T2 | DE60310182D1 | DE60310182T2 | DE60329187D1 | DE60330022D1 | EP1420292A1 | EP1420292B1 | EP1420293A1 | EP1420293B1 | EP1422551A1 | EP1422551B1 | EP1527328A2 | EP1527328A4 | EP1527328B1 | EP1539992A2 | EP1539992A4 | EP1539992B1 | EP1692258A2 | EP1692258A4 | EP1749203A2 | EP1749203A4 | EP1773979A2 | EP1773979A4 | EP1773979B1 | EP1773980A2 | EP1773980A4 | EP1773980B1 | EP1800312A2 | EP1800312A4 | EP1815025A2 | EP1815025A4 | EP1815025B1 | EP2291645A1 | EP2291645A4 | EP2291645B1 | EP2427543A1 | EP2427543A4 | EP2450698A1 | EP2450698B1 | EP2639576A1 | EP2639576B1 | HK1082002A1 | HK1083238A1 | JP04745056B2 | JP2004161004A | JP2004161005A | JP2004161006A | JP2005537498A | JP2005538741A | US10012636B2 | US10018581B2 | US10036216B2 | US10067121B2 | US10168318B2 | US10215748B2 | US10533985B2 | US10539523B2 | US10551371B2 | US10620188B2 | US10690677B2 | US10725023B2 | US11060362B2 | US11346797B2 | US11360072B2 | US11604197B2 | US20040096788A1 | US20040137387A1 | US20040137388A1 | US20040152067A1 | US20050112544A1 | US20050153425A1 | US20050213374A1 | US20060023559A1 | US20060050596A1 | US20060120204A1 | US20060121446A1 | US20070172939A1 | US20090205201A1 | US20090309618A1 | US20090314137A1 | US20100029506A1 | US20110039294A1 | US20110117542A1 | US20110300569A1 | US20120142031A1 | US20120225424A1 | US20120295253A1 | US20120322050A1 | US20130123136A1 | US20140057283A1 | US20140203818A1 | US20150185206A1 | US20170037689A1 | US20170205391A1 | US20170269062A1 | US20170315131A1 | US20170370907A1 | US20180095064A1 | US20180306771A1 | US20180355685A1 | US20190195861A1 | US20200158670A1 | US20200278339A1 | US20200348312A1 | US20210164961A1 | US20220291191A1 | US6902880B2 | US6908731B2 | US7060655B2 | US7192752B2 | US7459303B2 | US7468255B2 | US7470533B2 | US7560269B2 | US7732127B2 | US7876108B2 | US8026080B2 | US8206903B2 | US8263375B2 | US8344742B2 | US8420363B2 | US8916357B2 | US9097072B2 | US9399787B2 | US9612234B2 | US9625472B2 | US9709548B2 | WO2004010102A2 | WO2004010102A3 | WO2004010103A2 | WO2004010103A3 | WO2005047482A2 | WO2005047482A3 | WO2005077104A2 | WO2005077104A3 | WO2006015387A2 | WO2006015387A3 | WO2006017762A2 | WO2006017762A3 | WO2006036952A2 | WO2006036952A3 | WO2006058185A2 | WO2006058185A3 | WO2009137440A1 | WO2009149469A1 | WO2010129725A1 | WO2011146531A1 | WO2011146531A9 | 20040129CA2493101A1 |
| 2780 | US8923821B2 | Transceiver with message notification | DE10043284A | WO2001DE3304A | US2003363625A | 2000-09-02 | 2001-08-30 | 2003-09-12 | US2010696904A | 2010-01-29 | B2 | 2014-12-30 | Hans Martin|Hildesheim, DE | Kowalewski Frank|Salzgitter, DE | Laumen Josef|Hildesheim, DE | Schmidt Gunnar|Wolfenbuettel, DE | Steiger Joachim|Stuttgart, DE | Baer Siegfried|Pforzheim, DE | Beckmann Mark|Braunshweig, DE | Gottschalk Thomas|Berlin, DE | IPCOM GmbH & Co. KG,Pullach,DE | Hans Martin,Hildesheim,DE | Kowalewski Frank,Salzgitter,DE | Laumen Josef,Hildesheim,DE | Schmidt Gunnar,Wolfenbuettel,DE | Steiger Joachim,Stuttgart,DE | Baer Siegfried,Pforzheim,DE | Beckmann Mark,Braunshweig,DE | Gottschalk Thomas,Berlin,DE | IPCOM GMBH & CO. KG | W01 E | W01-C01B3E | W01-C01D3C | W01-C01G6A | H04M000100 | H04M000172436 | H04M0001663 | H04M0001724 | H04M00017243 | H04M000172433 | H04M001100 | H04M000173 | H04M0003537 | H04M001904 | H04W005202 | H04M0019048 | H04M0001724 | H04M00017243 | H04M000172433 | H04M000172436 | H04W000414 | H04M0003537 | H04W0052027 | Y02D003070 | 4554122 | 455413 | 455466 | NaN | A transceiver, comprising an interface for receiving at least one message, a display unit provided to assume at least one switched-on operating state and at least one switched-off operating state, a message indicator indicating a receipt of a message by a unit of a signal, independent of the operating state of the display unit, wherein the message is associated with at least one message parameter, and a unit for evaluating the message parameter with the signal provided as a function of evaluation of the message parameter. | Transceiver with message notification | The invention claimed is: \n1. A mobile phone comprising a housing having a front, a display unit, actuating elements and a message indicator being positioned on the front, wherein the actuating elements are positioned underneath said display unit and the message indicator is positioned above the display unit adjacent an upper edge of the housing, and wherein the message indicator is a multicolor light emitting diode, \nwherein the mobile phone further comprises an evaluation unit and a chargeable battery, the evaluation unit being adapted to receive incoming messages and control the message indicator, wherein in response to an e-mail message being received the message indicator is caused to blink with a first color and when the battery needs to be charged the message indicator is caused to blink with a second color, wherein the operation of the message indicator is independent of an operating state of the display unit. \n2. The mobile phone according to claim 1, wherein the phone is adapted to operate according to the GSM and UMTS mobile telephone standards.\n3. The mobile phone according to claim 1, wherein the second color is red.\n4. The mobile phone according to claim 3, wherein the first color is blue.\n5. The mobile phone according to claim 1, wherein the evaluation unit is encompassed by a subscriber identity module.\n6. The mobile phone according to claim 1, wherein the light emitting diode is operable to emit light of a third color.\n7. The mobile phone according to claim 1, wherein the phone further comprises a memory connected to a send and receive device.\n8. The mobile phone according to claim 1, wherein the actuating elements are buttons.\n9. The mobile phone according to claim 1, wherein the evaluation unit is controllable so that input may configure the evaluation unit to customize indicators provided by the message indicator. | 9 | 1. A mobile phone comprising a housing having a front, a display unit, actuating elements and a message indicator being positioned on the front, wherein the actuating elements are positioned underneath said display unit and the message indicator is positioned above the display unit adjacent an upper edge of the housing, and wherein the message indicator is a multicolor light emitting diode, \nwherein the mobile phone further comprises an evaluation unit and a chargeable battery, the evaluation unit being adapted to receive incoming messages and control the message indicator, wherein in response to an e-mail message being received the message indicator is caused to blink with a first color and when the battery needs to be charged the message indicator is caused to blink with a second color, wherein the operation of the message indicator is independent of an operating state of the display unit. | 1. A mobile phone comprising a housing having a front, a display unit, actuating elements and a message indicator being positioned on the front, wherein the actuating elements are positioned underneath said display unit and the message indicator is positioned above the display unit adjacent an upper edge of the housing, and wherein the message indicator is a multicolor light emitting diode, wherein the mobile phone further comprises an evaluation unit and a chargeable battery, the evaluation unit being adapted to receive incoming messages and control the message indicator, wherein in response to an e-mail message being received the message indicator is caused to blink with a first color and when the battery needs to be charged the message indicator is caused to blink with a second color, wherein the operation of the message indicator is independent of an operating state of the display unit. | RELATED APPLICATIONS \n\nThis application is continuation of U.S. patent application Ser. No. 10/363,625, filed Sep. 12, 2003 which is a 35 U.S.C. 371 national stage filing of International Application No. PCT/DE01/03304, filed 30 Aug. 2001, which claims priority to German Patent Application No. 100 43 284.0-35 filed on 2 Sep. 2000 in Germany. The contents of the aforementioned applications are hereby incorporated by reference. \n\nBRIEF DESCRIPTION OF THE DRAWINGS \n\nAn exemplary embodiment of the invention is shown in the drawings and will be explained in detail the description that follows. \n\nFIG. 1 shows a transceiver according to the invention,\n\nFIG. 2 shows the transceiver according to the invention, connected to a mobile radio network,\n\nFIG. 3 shows a flowchart for the evaluation of a message parameter of a received message, and\n\nFIG. 4 shows an example of signaling a message parameter.\n\nBACKGROUND OF THE INVENTION \n\nMobile radio systems, for example mobile radio systems that function according to the GSM standard (group spéciale mobile), are designed to allow subscribers to the mobile radio network to send and receive short messages. One example of such a short message service is the so-called SMS service (short message service). In typical mobile telephones, the recipient of a short message of this kind is notified of its arrival by a corresponding indication on the display of the telephone. \n\nSUMMARY OF THE INVENTION \n\nThe transceiver according to the invention, has the advantage over the prior art that a user of the transceiver can be notifiedwithout changing the operating state of the display unitthat a message, for example a short message, has arrived for him. This is particularly advantageous if the display unit is switched off or in a power-saving mode. To be precise, the display unit can remain switched off or in the power-saving mode, but the user can still be notified that a message has been received. This reduces the energy requirements of the transceiver according to the invention, thus yielding a longer battery life. According to the invention, the user can also be optically notified the moment the message is received. This means that the user does not have to take any action, e.g. manipulating an actuating element of the transceiver, to be informed as to the reception status of messages sent to himi.e. whether there is a message for him and if so, how many messages there are. \n\nIt is also advantageous that the message is associated with at least one message parameter, that the transceiver has means for evaluating the message parameter, and that the signal is provided as a function of the message parameter evaluation. This makes it possible to provide the user of the transceiver with information about the message parameter by varying the signal, in particular by chronologically changing the signal intensity of the output signal. \n\nIt is also advantageous that the number of the at least one received message and/or the type of the at least one received message and/or the sender of the at least one received message is provided as the message parameter. This makes it possible to provide the user of the transceiver with information regarding the number, the type, and/or the sender of the at least one received message, depending on the definition of the signal as a function of the message parameter(s). \n\nIt is also advantageous that the message indicator provides an output signal and that the signaling is provided by means of at least one predetermined intensity or intensity change of the output signal. This allows the information about the message parameter, which is to be transmitted by means of the signal, to be communicated to the user in a simple manner. \n\nIt is also advantageous that the number of the at least one intensity change corresponds to a multiple of the number of the at least one received message. This makes it possible, through simple means, to supply the user with data regarding how many messages have been received and are present. \n\nIt is also advantageous that the output signal is an optical signal and that the signaling is provided by means of a predetermined color or color change of the output signal. It is therefore possible to provide the user with more data regarding the message parameters or to relay the same data content more reliably, i.e. in a more easily recognizable and discernible way. \n\nIt is also advantageous that the message indicator is a light-emitting diode. This makes it possible, according to the invention, to transmit data to the user by means of the message indicator using simple means, i.e. inexpensively and at a low manufacturing cost. \n\nIt is also advantageous that the message indicator ( 15) can communicate a piece of operating data by means of an additional signal. As a result, the message indicator can be used, at least in chronological succession, both to communicate the receipt of the message by means of the signal and to communicate the operating data of the transceiver by means of the additional signal. Therefore in the transceiver according to the invention, it is not necessary to provide a separate indicator for the one function as well as for the other function.\n\nIt is also advantageous that an additional message indicator can communicate a piece of operating data by means of an additional signal. This makes it possible to easily distinguish between the operating data and the data that describe the message status. \n\nDESCRIPTION OF THE PREFERRED EMBODIMENTS \n\nShort message services, for example SMS service in a GSM mobile radio network (group speciale mobile), are enjoying ever greater distribution and acceptance despite their limitation to simple text messages and maximal text lengths of 160 characters. If larger text messages need to be sent, SMS, for example, offers the possibility of message concatenation, i.e. the total amount of the text to be sent is divided into a number of short messages. An appropriately specified mechanism provides for proper reassembly in the receiver. \n\nAnother supplemental service that SMS uses for notification is so-called unified messaging, a platform that combines fax, email, voicemail, etc. and offers a uniform access (usually via the Internet) to the data of these currently separate services. Here, too, the SMS messages constitute an important component, functioning as a notification for newly received data. For this reason, the invention will be described below by way of example in conjunction with SMS and SMS messages; however, it is not limited to being used exclusively with messages using the SMS standard. \n\nThe advantage of the short message service is that a message reaches the receiver directly or, if the mobile terminal is not available, is temporarily stored and is automatically resent when the mobile terminal once again becomes available. For this reason, in addition to the transmission of normal text messages, this service is also used for notification as a component of other services. One such supplemental servicewhich uses SMS for notification, is an essential component of modern mobile radio systems, and will also be a part of future mobile radio networksis voicemail, i.e. the possibility of leaving a voice message for an unavailable recipient in a memory, thus performing the function of an answering machine, for example. Voicemail is one instance, as a rule a central one, in the mobile radio network of a network provider, whichsimilar to local answering machines connected to a user's telephone jack in the fixed networkoffers the possibility of storing voice messages for a user of the mobile radio network. This can be the case if the person being called is unavailable at the time of the call, for example due to a dead zone in the coverage area of the mobile radio network or because the person being called does not have his mobile telephone turned on. If a caller then leaves a message in a voicemail box, then as a rule, the recipient is notified by means of an SMS text message as to the arrival and number of these new voice messages. As with every other SMS, this happens as soon as the mobile radio network reestablishes contact with the recipient's mobile telephone. Of the two cases mentioned above, in the first case, this would happen when the recipient comes back into a region with sufficient network coverage by his mobile radio network provider or in the second case, when the recipient reactivates his mobile telephone and the telephone logs itself back onto the mobile radio network. \n\nIn some mobile telephones, when an SMS message is received, the recipient is notified by means of a corresponding indication on the display unit of the telephone. However, many mobile telephones have the feature of a display unit, which automatically switches off or switches into a power-saving mode if unused for a certain amount of time by the user, to reduce the energy consumption of the mobile telephone in order to increase battery life. The sooner the display turns off, the less battery power is consumed, i.e. the longer the mobile telephone can be operated without having to recharge the battery. The display is reactivated, for example, by pressing the keypad of the mobile telephone. This means that the display device is switched off most of the time because most users do not use their mobile telephones actively for long periods. \n\nIf the display is turned off, this means that a user must first activate the display in order to check whether there are any messages, in particular short messages, waiting for him. In order to do so, the user must explicitly press or actuate a button or other actuating element on the mobile telephone. When a message has arrived, it is often difficult or impossible to notify the user by means of an acoustic signal, for example because the user has switched off the acoustic signaling due to the presence of other people or for other reasons, or because the user is out of earshot of the mobile telephone due to distance or noise. \n\nOne feature of the invention is that newly received messages can also be displayed in a transceiver, in particular a mobile telephone, independently of the display unit. This permits the immediate recognition of newly received messages even when a possible acoustic signal cannot be heard. \n\nFIG. 1 schematically depicts a transceiver 1 according to the invention. The transceiver 1 is provided in the form of a mobile telephone, cell phone, etc., and according to the invention, particularly functions in accordance with a standard for wireless communication, for example GSM, UMTS, or the like. According to the invention, the transceiver 1 includes the display unit 16, which is also referred to as the display 16. The transceiver 1 also includes a message indicator 15 and actuating elements 35, for example buttons or the like. In particular, the message indicator 15 is provided in the form of an LED (light emitting diode) and will therefore also be referred to below as the LED 15. According to the invention, the LED 15 is in particular embodied as a multicolor LED 15, i.e. the message indicator 15 can display several colors. This potentially broadens the data content of a signal that can be conveyed to the user by means of the message indicator 15. In one exemplary embodiment, the LED 15 is embodied, for example, as a dual-color LED 15.\n\nThe actuating elements 35 are also referred to below as an input device 35. According to the invention, the display unit 16 can assume various operating states, at least one switched-on or activated operating state, and one switched-off operating state or an operating state with reduced activation (e.g. power-saving mode).\n\nFIG. 2 shows the transceiver 1 connected to a mobile radio network 40. The transceiver 1 is connected to the mobile radio network 40 by means of an air interface 45. A device 50 is also connected to the mobile radio network 40 in a wireless fashion or via wires; the device 50 provides supplemental services in the mobile radio network 40, for example a voicemail service. A communication terminal 60 is also connected to the mobile radio network 40, as a rule by means of a wireless interface that is not shown in detail. According to the invention, the mobile radio network 40 particularly functions in accordance with a standard for wireless communication, for example GSM, UMTS, or the like. According to the invention, the transceiver 1 includes, as a means for evaluating message parameters, an evaluation unit 20, which is connected to the input device 35, a send/receive device 10, and the display unit 16. In addition, the transceiver 1 has a memory a 30 for storing data, for example short messages, which is connected to the send/receive device 10.\n\nIn a GSM-compatible transceiver 1, the memory 30 is contained as a rule in an identification module, for example the SIM module (subscriber identification module). If the SAT standard (SIM application toolkit) is included, then it is possible to combine the memory 30 and the evaluation unit 20 onto one SIM module 5. This possibility is indicated in FIG. 2 by the fact that the dashed line of the SIM module 5 encompasses the evaluation unit 20 and the memory 30.\n\nThe send/receive device 10 receives a short message from a mobile radio network 40 by means of the air interface 45, for example from the telecommunication terminal 60, from a supplementary service operated in the mobile radio network 40, or a device 50 required for this supplementary service. The short message is processed in the transceiver 1, i.e. is displayed on the display unit 16if this is in a switched-on operating stateand is stored in the memory 30. In addition, the message is sent to the evaluation unit 20, which in the simplest case registers the receipt of the message and displays or signals its arrival by means of the message indicator 15.\n\nThe input device 35 can be used to input data for controlling the evaluation unit 20 and configuring it so that the display unit 16 and/or the message indicator 15, for example, only display(s) selected short messages or so that different messages are displayed in different ways. One selection criterion, for example, is the telephone number of the sender, the type of message, the number of received messages, and/or whether the user has already accessed the message, i.e. whether the user has already listened to the message.\n\nIn the following exemplary embodiment, it has been assumed by way of example that the evaluation unit 20 functions using the sender's telephone number as a selection criterion. The user can use the input device 35 to configure the evaluation unit 20 in such a way that on the one hand, upon receipt of a short message that has been sent by the telecommunication terminal 60, which is associated with a particular telephone numberfor example the number 0172/4999008, the message indicator 15 emits a signal, e.g. blinks, with a first color, and on the other hand, upon receipt of a short message as a notification regarding the receipt of a voice message in a voicemail box, the message indicator 15 emits a signal, e.g. blinks, with a second color.\n\nThe signal, which is embodied, for example, as a blink sequence, conveys information regarding the number of messages received, or regarding other message parameters. This is possible because it indicates the arrival or presence of for example three (e.g. unplayed) messages in the device SO that is embodied for example as a voicemail box, when the message indicator 15 blinks three times in rapid succession in one of its possible colors.\n\nIn order to illustrate the exemplary embodiment, FIG. 3 shows a flowchart. At a first program point 100, a short message is received and at a second program point 110, it is stored, particularly in the memory 30. At a third program point 200, the received short message is evaluated in accordance with one or more message parameters; in the exemplary embodiment, the telephone number of the sender of the message has been selected as a message parameter. The example under consideration includes the following cases by way of example: a first case labeled with the reference numeral 201, which exists when a message has been received from the telecommunication terminal 60 that is associated, for example, with the telephone number 0172/4999008; a second case labeled with the reference numeral 204, which corresponds to the arrival of a message from the device 50, i.e. for example a voicemail box; a third case labeled with the reference numeral 208, which encompasses all other situations. If it is determined at the third program point 200 that the first case 201 applies, then at a fourth program point 210, a first counter, not shown, is incremented and at a fifth program point 220, the new state is displayed by the blinking of the LED 15 in the first color. If it is determined at the third program point 200 that the second case 204 applies, then at a sixth program point 260, a second counter, likewise not shown, is incremented and at a seventh program point 280, the new state is displayed by the blinking of the LED 15 in the second, e.g. other, color. If it is determined at the third program point 200 that the third case 208 applies, then no further action occurs.\n\nThe evaluation in the evaluation unit 20 is not limited to the telephone number of the sender. It can also relate to the text of the message or short message, the type of message, the number of messages received, or the like. For example, the presence or lack of the words mailbox or e-mail are used as selection criteria in order to determine the type of message. Likewise, elements of the SMS header, i.e. the top part of an SMS message, or of the SMS user data header can be used for the selection. In addition, it is also appropriate here to use special user-defined selection criteria, which make it possible to recognize particular notifications, i.e. particular messages, and to handle them in a particular manner, for example by having the message indicator 15 emit a special signal or by storing certain messages differently than other messages, for example storing them in the memory 30. It is therefore possible to recognize the receipt of e-mails via SMS through the recognition of particular header elements, which can also be used as selection criteria. In addition, the messages received can thus be stored in a sorted fashion, for example.\n\nFIG. 4 shows an example of a message indicator 15 signal. In a graph of the intensity 310 of the output signal of the message indicator 15 over its chronological course 300, a blink sequence is shown, which is characterized by the fact that blinks occur three times with a first chronological spacing 320. A single blink is produced by the fact that the intensity 310 of the output signal of the message indicator 15 changes for example twice, i.e. the intensity 310 is adjusted from a first value to a second value andafter a certain waiting periodis adjusted back to the first value in order to remain there for a certain additional waiting period. The first chronological spacing 320 corresponds to the time interval beginning with the intensity change from the first value of the intensity 310 to the second value of the intensity 310 and extending to the end of the additional waiting period after the readjustment of the intensity 310 of the output signal back to the first value. The above-described sequence of three blinksi.e. a total of six changes in the intensity of the output signalthe number of intensity changes corresponds to twice the number of received messagesgives an example of how it is possible according to the invention, to signal the receipt of three new messages. FIG. 4 shows two such blink sequences; a second chronological spacing 330 is provided between the blink sequences. The second chronological spacing 330 is provided so that the user can differentiate or distinguish between the blink sequences, for example by virtue of the fact that the second chronological spacing 330 is greater than the first chronological spacing. Other possibilities for embodying the message indicator 15 signal are achieved by virtue of the fact that the intensity of the output signal of the message indicator 15 does not change in a binary fashion as shown in FIG. 4i.e. there are only two states, but rather the signal can also be provided so that there are more than two discrete values for the intensity 310 and so that the intensity change of the output signal from one of these discrete values to another of these discrete values sends the user information about a received message.\n\nAccording to the invention, another embodiment includes the provision of using the message indicator 15 to send the user other data, in particular operating data, in addition to the data regarding the status of the message reception or the arrival of a message. In this case, operating data are understood in particular to include the charge state of the battery, not shown, or accumulator, not shown, (battery status), data regarding the availability of the mobile radio network 40, or data regarding whether or not the transceiver 1 is currently logged onto the mobile radio network 40. It was already possible before now to convey such operating data to the user by means of an additional signal particularly by using light emitting diodes. For information of a content-related nature about messages, such as the number, type, or even the sender of messages among others, though, transceivers previously always used the display unit, which resulted in the above-explained disadvantages, particularly the higher power consumption and the complex operation of such transceivers.\n\nIt is in keeping with the invention to execute the additional signaling of operating data and the signaling of content-related information, i.e. regarding the receipt of messages for example, to the user both separately, i.e. using the message indicator 15 and an additional message indicator not shown herefor example with two different light emitting diodesand jointly, i.e. using the message indicator 15 both for signaling the operating data and for signaling the status of the message reception. In the second case, for example, the operating data are signaled exclusively by means of a third color, while the content-related information is only signaled by means of the first and second color.\n\nIt need only be indicated as an exemplary embodiment here that a transceiver 1 according to the invention is equipped, for example, in such a way that the LED 15 blinks with a relatively low frequency in a red color if the transceiver 1 is no longer receiving the regular signals of the mobile radio network 40 or is only receiving them poorly, e.g. in the case of a dead zone in the coverage of the mobile radio network 40. In this exemplary embodiment, if the battery is almost dead, then the LED 15 blinks with a high frequency and likewise in the red color, independent of whether the transceiver 1 has reception or not. If the transceiver 1 is logged onto the network and is also still receiving the regular signals of the mobile radio network, then the LED 15 blinks with a relatively low frequency in the green color. In this exemplary embodiment, the user therefore can always see whether the transceiver 1 has reception and whether the battery urgently needs to be chargedand this, independent of whether the display unit is switched on, switched off, or in a power-saving mode. In order to signal the receipt of the message, in this case, the invention includes the provision that the light emitting diode blinks in a blue color, for example.\n\nOn the other hand, however, it is also in keeping with the invention not to provide an additional color of the LED 15 for signaling the receipt of a message, but merely to provide a different blink signal than the low frequency blinking in the green color, which occurs in the exemplary embodiment under consideration when the transceiver 1 both has contact with the mobile radio network and also has sufficient energy reserves. This assures that the user always knows whether or not the transceiver 1 is logged onto the mobile radio network 40. For example, if there are now three new messages, then the LED 15 blinks three times with a chronological spacing of the blink signal, which corresponds to the first spacing 320. This is selected so that an average blink frequency between the two low frequency blinks is set to signal a proper network connection on the one hand and that of the high frequency blinks is set to signal an insufficient charge of the battery on the other hand. Then the LED 15 executes a long pause before it blinks again three times in the average blink frequency. The duration of the long pause here should be at least as long as the chronological spacings of the blink signal of the low frequency blinking. | IPCOM GmbH & Co. KG,Pullach,DE | Hans Martin,Hildesheim,DE | Kowalewski Frank,Salzgitter,DE | Laumen Josef,Hildesheim,DE | Schmidt Gunnar,Wolfenbuettel,DE | Steiger Joachim,Stuttgart,DE | Baer Siegfried,Pforzheim,DE | Beckmann Mark,Braunshweig,DE | Gottschalk Thomas,Berlin,DE | IPCOM GmbH & Co. KG | Hans Martin | Kowalewski Frank | Laumen Josef | Schmidt Gunnar | Steiger Joachim | Baer Siegfried | Beckmann Mark | Gottschalk Thomas | BOSCH (ROBERT) GMBH | BOSCH (ROBERT) GMBH | Hans, Martin | Kowalewski, Frank | Laumen, Josef | Schmidt, Gunnar | Steiger, Joachim | Baer, Siegfried | Beckmann, Mark | Gottschalk, Thomas | 8 | Nelson Mullins Riley & Scarborough LLP | NaN | Vuong, Quochien B | US | Dead | 12 | 2014 | US | 1 | 2010 | 2000-09-02 | 2000 | H04 | H04, Y02 | 4554122 | 455413 | 455466 | US6018232A | US20040033783A1 | US6088516A | US6304763B1 | US6311282B1 | US6119014A | US6295458B1 | JP10164664A | US6209011B1 | US6104923A | EP457077A2 | US6330461B1 | US5737394A | US5550754A | US5570025A | EP1316199B1 | GB2326051A | US5633912A | DE19724995A1 | DE10043284C1 | EP633684A2 | US5881377A | US4633041A | US5946636A | US7054626B2 | WO1999000962A1 | US6405060B1 | US4649563A | US6125286A | US4975694A | US5566226A | US6078612A | US6473628B1 | DE19857902A1 | EP494525A2 | US6751484B1 | US5646636A | DE4332758A1 | DE19823882A1 | EP936793A1 | US6720863B2 | US6438390B1 | US6377821B2 | 43 | Nokia 9000i, User's Manual, (1995-1997). | Nokia, Nokia 9000 Communicator, User's Manual, (1995). | Nokia, First GSM-based communicator product hits the market. Nokia Starts Sales of the Nokia 9000 Communicator, Press Release (1996). | Nokia, Nokia introduces the new Nokia 9000i Communicator for GSM Markets, Press Release (1997). | 4 | NaN | 0 | 2023-02-28 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - 2022-12-30 | 2023-02-06 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | 2022-08-22 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | 2021-08-16 AS ASSIGNMENT IPCOM GMBH & CO. KG, GERMANY CONFIRMATION OF RELEASE OF SECURITY INTEREST;ASSIGNOR:KAROLS DEVELOPMENT CO. LLC;REEL/FRAME:057186/0643 2021-08-11 | 2018-06-26 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) FEE PAYMENT YEAR 4 | 2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE | 2013-06-07 AS ASSIGNMENT LANDESBANK BADEN-WUERTTEMBERG, GERMANY SECURITY AGREEMENT;ASSIGNOR:IPCOM GMBH & CO. KG;REEL/FRAME:030571/0649 2013-06-07 | 2013-05-07 AS ASSIGNMENT KAROLS DEVELOPMENT CO LLC, NEW YORK CORRECTIVE ASSIGNMENT TO CORRECT THE TYPE OF DOCUMENT PREVIOUSLY RECORDED ON REEL 030144, FRAME 0541. ASSIGNORS HEREBY CONFIRMS THE SUBMITTED DOCUMENT SHOULD HAVE BEEN SUBMITTED AS A SECURITY AGREEMENT NOT AN ASSIGNMENT;ASSIGNOR:IPCOM GMBH & CO. KG, REPRESENTED BY ITS GENERAL PARTNER IPCOM BETEILIGUNGS GMBH;REEL/FRAME:030407/0400 2012-05-09 | 2013-04-03 AS ASSIGNMENT KAROLS DEVELOPMENT CO LLC, NEW YORK ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:IPCOM GMBH & CO. KG, REPRESENTED BY ITS GENERAL PARTNER IPCOM BETEILIGUNGS GMBH;REEL/FRAME:030144/0541 2012-05-09 | 2010-05-19 AS ASSIGNMENT IPCOM GMBH & CO. KG, GERMANY ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:ROBERT BOSCH GMBH;REEL/FRAME:024408/0730 2007-11-26 | 2010-05-19 AS ASSIGNMENT ROBERT BOSCH GMBH, GERMANY ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:HANS, MARTIN;KOWALEWSKI, FRANK;LAUMEN, JOSEF;AND OTHERS;SIGNING DATES FROM 20030604 TO 20030828;REEL/FRAME:024408/0572 | US8923821B2 | DE10043284C1 | DE20122148U1 | DE50108026D1 | DE50115257D1 | EP1316199A1 | EP1316199B1 | EP1622348A1 | EP1622348B1 | JP05542758B2 | JP2004507982A | JP2012016056A | US20040033783A1 | US20100197280A1 | US20150156305A1 | US7684789B2 | WO2002019676A1 | 20020207DE10043284C1 |
| 2781 | US8921100B2 | Use of the adenoviral E2 late promoter | DE10150984A | WO2002EP11527A | US2004492802A | 2001-10-16 | 2002-10-15 | 2004-10-22 | US2009498208A | 2009-07-06 | B2 | 2014-12-30 | Holm Per Sonne|Fürstenfeldbruck, DE | Technische Universität München,München,DE | Holm Per Sonne,Fürstenfeldbruck,DE | TECHNISCHE UNIVERSITAET MUENCHEN | B04 C | D16 C | B04-E02 | B04-E04 | B04-E06 | B04-E08 | B14-H01 | B14-S03 | D05-H12C | D05-H12D2 | D05-H12D5 | D05-H12E | C12N001500 | C12N001509 | A61K00317125 | A61K003576 | A61K004800 | A61P003500 | C07H002104 | C07K0014075 | C07K001447 | C12N001511 | C12N001512 | C12N001585 | C12N001586 | C12N0015861 | C12N001586 | A61K004800 | A61P003500 | C07K0014075 | C07K00144702 | C12N001511 | C12N001585 | C12N271010341 | 4353201 | 53602372 | 5360241 | NaN | The invention relates to a nucleic acid construct comprising an adenoviral E2 late promoter or a fragment thereof and a nucleic acid. The nucleic acid is selected from the group of transgenes, genes and nucleic acids which are respectively different from adenoviral nucleic acid controlled by an E2 late promoter. The invention also relates to the uses of said nucleic acid construct. | Use of the adenoviral E2 late promoter | The invention claimed is: \n1. An adenoviral vector suitable for use in the treatment of a tumor disease, wherein the tumor cells express YB-1 and have YB-1 in the nucleus, wherein the adenoviral vector comprises an adenoviral E2 late promoter or a fragment thereof and a nucleic acid under the control of the adenoviral E2 late promoter or the fragment thereof, wherein the nucleic acid being selected from the group consisting of adenoviral gene E1B, adenoviral gene E4orf6, and combination thereof; and wherein the adenoviral E2 late promoter or fragment thereof is regulated by YB-1.\n2. The replication-selective oncolytic adenoviral vector of claim 1, wherein the adenoviral E2 late promoter fragment comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO:1 and SEQ ID NO:2. | 2 | 1. An adenoviral vector suitable for use in the treatment of a tumor disease, wherein the tumor cells express YB-1 and have YB-1 in the nucleus, wherein the adenoviral vector comprises an adenoviral E2 late promoter or a fragment thereof and a nucleic acid under the control of the adenoviral E2 late promoter or the fragment thereof, wherein the nucleic acid being selected from the group consisting of adenoviral gene E1B, adenoviral gene E4orf6, and combination thereof; and wherein the adenoviral E2 late promoter or fragment thereof is regulated by YB-1. | 1. An adenoviral vector suitable for use in the treatment of a tumor disease, wherein the tumor cells express YB-1 and have YB-1 in the nucleus, wherein the adenoviral vector comprises an adenoviral E2 late promoter or a fragment thereof and a nucleic acid under the control of the adenoviral E2 late promoter or the fragment thereof, wherein the nucleic acid being selected from the group consisting of adenoviral gene E1B, adenoviral gene E4orf6, and combination thereof; and wherein the adenoviral E2 late promoter or fragment thereof is regulated by YB-1. | CROSS REFERENCE TO RELATED APPLICATIONS \n\nThis is a divisional of U.S. application Ser. No. 10/492,802, filed Oct. 22, 2004, now U.S. Pat. No. 7,572,633, which is 371 application of International Patent Application No. PCT/EP02/11527, filed Oct. 15, 2002, which claims priority to DE 10150984.7 filed on Oct. 16, 2001, the contents each of which are fully incorporated herein by reference. \n\nThe invention will be illustrated in the following by the figures, examples and sequence listing from which further features, embodiments and advantages of the invention can be derived. In these \n\nFIG. 1 shows fluorescence microscopic images of U2OS cells which have been transfected with a vector encoding green fluorescent protein subject to the control of the CMV promoter (FIGS. 1A, 1B), the control of the E2 late promoter (FIGS. 1C, 1D) and the control of an E2 late promoter mutating in the YB-1 box (FIGS. 1E, 1F) following the infection with an E1/E3 deleted adenovirus (FIGS. 1A, 1C, 1E) and a YB-1 expressing E1/E3-deleting adenovirus (FIGS. 1B, 1D. 1F) and\n\nFIG. 2 shows fluorescence microscopic images of YB-1 nucleus-negative U2OS cells (FIG. 2A) and YB-1-nucleus-positive cells (FIG. 2B) following transfection with a plasmid encoding green fluorescent protein subject to the control of the adenoviral E2 late promoter.\n\nEXAMPLES \n\nExample 1 \n\nThe E2 Late Promoter is YB-1 Specific \n\nThe E2 late promoter was cloned in the vector pGL3 enhancer (Promega) into the XhoI and HindIII interface. This vector possesses the luciferase gene or, alternatively, the GFP gene as reporter gene. As soon as GFP is expressed, the cells light up green. Firstly, 200,000 U2OS cells per well were presented in the plate of 6 such wells. After 24 hours, the transfection of the different vectors containing the different fragments of the E2 late promoter was effected by Superfect in line with the manufacture's instructions (Qiagen). The plasmids were produced from the pGL3 enhancer vector, Promega, the luciferase gene being replaced by the reporter gene GFP (green fluorescent protein). \n\nAfter a further 24 hours, the cells were infected with 50 pfu/cell using a E1/E3-deleted adenovirus (AdlacZ, left hand column of FIG. 1) and AdYB-1 (right hand column of FIG. 1). AdYB-1 is an E1/E3 deleted adenovirus which expresses the transcription factor YB-1 as a transgene. After a further 24 hours, the evaluation took place under a fluorescence microscope. The result clearly shows that only the intact E2 late promoter is activated by the expression of YB-1 as illustrated in FIG. 1D. The cells illustrated in FIGS. 1A and 1B were transfected as positive controls using plasmid constructs in the case of which the green fluorescent protein was subjected to the control of the cytomegalovirus promoter (CMV). In the case of the constructs or tests illustrated in FIGS. 1C and 1D, the E2 late promoter was used according to the invention, i.e. the expression of the green fluorescent protein was subjected to the control of this promoter. In the case of the cells illustrated in FIGS. 1E and 1F, a mutated E2 late promoter of adenovirus was used instead of the E2 late promoter of adenovirus. The mutation was situated in the YB-1 box, the sequence GCCTG instead of ATTGG being used.\n\nExample 2 \n\nThe E2 Late Promoter is Specific for YB-1 Nucleus-Positive Cells \n\nFor the investigation of the specificity of the E2 late promoter in resistant YB-1 nucleus-positive cells, the following experiment was carried out. \n\n2,000,000 cells per well were presented in a plate of 6 wells. A synthesised E2 late promoter in pGL3 enhancer vector (obtainable from Promega) with the reporter gene GFP was transfected by Superfect from Qiagen in line with the manufacturer's instructions 24 hours later into the cells. After a further 48 hours, the evaluation took place under a fluorescence microscope. \n\nFIG. 2A shows the result of the osteosarcoma cells U2OS which exhibit no YB-1 in the nucleus. In FIG. 2B, the result is illustrated using multi-drug resistant stomach carcinoma cells 257RDB. In the case of these cells, YB-1 is localised in the cell nucleus. The result clearly shows that the reporter gene GFP is activated via the E2 late promoter only in YB-1 nucleus-positive 257RDB cells.\n\nThe characteristic features of the invention disclosed in the above description, the claims and the drawings can be essential either individually or in any desired combination for effecting the invention in its various embodiments. \n\nREFERENCE TO THE SEQUENCE LISTING \n\nReference is made to the Sequence Listing submitted herewith consisting of a file named SL.txt (1 KB, created Sep. 23, 2009), and the contents of which are incorporated herein by reference. \n\nThe present invention relates to the use of an adenoviral E2 late promoter, a nucleic acid construct comprising an adenoviral E2 late promoter, a vector comprising this nucleic acid construct and the use of the nucleic acid construct. \n\nNumerous therapy concepts are being followed up at present in the treatment of tumours. Apart from using surgical techniques, chemotherapy and radiotherapy are to the fore. However, all these techniques are associated with not inconsiderable side effects for the patient. \n\nBy using replication-selective oncolytic viruses, a new technological platform has been created for the treatment of tumours. In this case, a selective intratumour replication of a viral agent is brought about which subsequently leads to virus replication, lysis of the infected tumour cells and spreading of the virus to neighbouring tumour cells. As a result of the restriction, to tumour cells, of the ability of the virus to replicate, normal tissue is spared infection and consequently lysis by the virus. Examples of such replication selective oncolytic viruses are the gene attenuated adenovirus and Herpes viruses (Martuza, R. et al. Science 252, 854-858 (1991); Fueyo, J et al. Oncogene 19, 2-12 (2000)). \n\nAdenoviruses are well known in industry. They consist of dsDNA viruses (Boulanger, P et al. (1991); Biochem J. 275, 281-299). The complete nucleotide sequence of the adenoviral genome is known and has been described (Chroboczek, J. et al., Virology 1992, 186, 280-285). A part of the genome which is particularly important for the use of adenoviruses consists of the so-called early genes and their gene products referred to as E1, E2, E3 and E4. E1 comprises two gene products, namely E1A and E1B, which represent oncogenes. The gene products, three in total, of group E2 participate in the replication together with the gene products E3 and E4. \n\nAn example of an oncolytic adenovirus is dl 1520 (Onyx-015), which has already been successfully used in clinical phases I and II (Khuri, F. et al. Nature Medicine 6, 879-885 (2000). Onyx-015 is an adenovirus in the case of which the E1B 55 kDa gene has been deleted. The E1B 55 kDa gene product participates in the inhibition of p53, the transport of viral mRNA and the termination of protein synthesis of the host cell. In this case, the inhibition of p53 takes place by the formation of a complex from p53 and the adenovirus-encoded E1B kDa protein. P53, TP53 when encoded, effects complex regulatory mechanism (Zambetti, G. P. et al., FASEB J, 7, 855-865), which, among other things, leads to an efficient replication of viruses, such as adenoviruses, being suppressed in the cell. The gene TP53 is deleted or mutated in approximately 50% of all human tumours with the consequence that nodesirableapoptosis occurs as a result of chemotherapy or radiotherapy and consequently the success of this tumour treatment fails to materialise in normal cases. \n\nDNA tumour viruses such as adenoviruses propel the infected cells into the S phase of the cell cycle in order to facilitate viral DNA replication. Onyx-015 does not express the E1B 55 kDa protein and replicates selectively in tumour cells compared with normal cells. In addition, there is a further selectivity with the effect that those tumours which are p53 deficient undergo a comparatively stronger necrosis as a result of the viral lysis of the tumour cells, than those exhibiting the p53 wild type (Khuri et al, compare above). In spite of the effectiveness of Onyx-015 in virus-induced oncolysis in the case of tumours deficient in p53 on principle, the success rate of 15% of the treated tumours is very low. Ries et al. (Ries, D. J. et al. Nature Medicine 6, 1128-1132 (2000)) have shown a basic possibility of how to successfully use Onyx-015 also for tumours with p53 wild type. In this case, the tumour suppressor protein p14ARF is not expressed. As a result of the absence of p14ARF, the normal reaction of the p53 system vis-à-vis a viral infection does not occur thus allowing the replication of Onyx-015 also in these tumours. However, the practical application of this knowledge presupposes that a suitable genetic background exists in the tumour cell or is provided by suitable therapeutic measures. In the former case, the number of tumours treatable by Onyx-015 would be further reduced, in the second case, a time consuming/complicated modification of the genetic background of the tumour cells would be required. \n\nIn one aspect, the problem underlying the present invention is to provide a promoter which allows a tumour-specific expression of nucleic acids. In another aspect, the invention is based on the objective of providing a medicament for the therapy of YB-1 positive diseases, in particular of tumour diseases. \n\nAccording to the invention, the objective is achieved in a first aspect by the use of an adenoviral E2 late promoter or a fragment thereof for the expression of genes which are different from the adenoviral genes or adenoviral nucleic acids controlled by the E2 late promoter in a naturally occurring adenovirus. \n\nIn a second aspect, the task according to the invention is achieved by the use of an adenoviral E2 late promoter or a fragment thereof for the expression of a transgene or a transgenic nucleic acid. \n\nIn one embodiment of the uses according to the invention, it is provided for the promoter fragment to comprise a sequence according to SEQ. ID. No. 1. \n\nIn an alternative embodiment of the uses according to the invention it is provided for the promoter fragment to exhibit a sequence according to SEQ. ID. No. 2. \n\nIn one embodiment of the uses according to the invention, it is provided for the promoter and/or the promoter fragment to exhibit a binding site for YB-1. \n\nIn a further embodiment of the uses according to the invention it is provided for the promoter and/or the fragment to exhibit at least one element selected from the group comprising the Y-box, the TATA box and the SPI binding site. \n\nIn an even further embodiment of the uses according to the invention it is provided for the promoter and/or the promoter fragment to exhibit YB-1 in the bound form. \n\nIn one embodiment of the uses according to the invention it is provided for the transgene and/or the adenoviral gene controlled by the E2 late promoter and/or the nucleic acid controlled by the E2 late promoter to be selected from the group of genes comprising apoptosis-inducing genes, genes for prodrug systems and genes for protease inhibitors. \n\nIn one embodiment of the uses according to the invention it is provided for the transgene or the adenoviral genes or nucleic acid(s) controlled by the adenoviral E2 late promoter to be selected from the group comprising antisense molecules, ribozymes and aptamers. \n\nIn a third aspect, the objective of the invention is achieved by a nucleic acid construct comprising an adenoviral E2 late promoter or a fragment thereof and a nucleic acid, the nucleic acid being selected from the group comprising transgenes, genes and nucleic acids which are respectively different from the adenoviral nucleic acids controlled by an E2 late promoter. \n\nIn one embodiment it is provided for the promoter fragment to comprise a nucleic acid sequence selected from the group comprising SEQ. ID. No. 1 and SEQ. ID. No. 2. \n\nIn a fourth aspect, the objective according to the invention is achieved by a vector comprising a nucleic acid construct according to the invention. \n\nIn a fifth aspect, the objective according to the invention is achieved by the use of a nucleic acid construct according to the invention for the preparation of a medicament. \n\nIn one embodiment it is provided for the medicament to be used for the treatment of tumours. \n\nIn a further embodiment it is provided for the tumours to be those exhibiting YB-1 in the nucleus. \n\nIn an even further embodiment it is provided for the tumours to be those exhibiting YB-1 in the nucleus, preferably exhibiting YB-1 in the nucleus in the presence of a stress factor. \n\nIn one embodiment it is provided for the stress factor to be selected from the group comprising hypothermia, UV exposure and exposure vis-à-vis cytostatics. \n\nIn an even further embodiment it is provided for the medicament to be used together with cytostatics and/or hypothermia. \n\nFinally, in an even further embodiment it is provided for the tumour to exhibit tumour cells with multi-drug resistances. \n\nThe present invention is based on the surprising finding that YB-1 in the nucleus binds to the adenoviral E2 late promoter and this promoter is highly suitable for the expression of nucleic acids which are different from those nucleic acids which are controlled in an adenoviral system, i.e. in a naturally occurring adenovirus, by the E2 late promoter. Moreover, it has surprisingly enough been found that the adenoviral E2 late promoter, on the one hand, is a very strong promoter and, compared with the CMV promoter used as gold standard, is only negligibly weaker in the presence of a practically non-existent background expression in the case that the promoter is not active. \n\nThe use, according to the invention, of the adenoviral E2 late promoter is determined in particular by its regulatibility by YB-1, YB-1 being effective as a positive effecter, i.e. the promoter is active only in the presence of YB-1 in the nucleus. In this respect, said adenoviral E2 late promoter can be regulated in a highly selective manner and is consequently usable in systems in which YB-1 is present in the nucleus and practically any expression of the nucleic acid being subject to the control of the adenoviral E2 late promoter is prevented in the case where YB-1 is not present in the nucleus as effecter or regulator. \n\nYB-1 is a representative of the Y box protein family which binds to the DNA sequence motive Y-box. The Y-box motive represents a transcriptionally regulatory element which is present in the promoter regions or enhancer regions of a number of different genes which play a part in the regulation of cell proliferation (Ladomery, M. et al. 1995; Bioassays 17: 9-11 Didier, D. K. et al, 1988, PNAS, 85, 7322-7326). \n\nThe details provided here apply also to fragments of the said adenoviral E2 late promoter which, herein, will also occasionally be referred to as E2 late promoter or later on as E2 promoter, and in particular to those promoter fragments disclosed herein and referred to as SEQ. ID. No. 1 and SEQ. ID. No. 2. \n\nThe nucleic acid sequence according to SEQ. ID. No. 1 is as follows: \n\n\n5??atttgtacctgaggactaccacgcccacgagattaggtt \n\nctacgaagac caatcccgcccgccaaatgcggagc- 3?\n\nThe Y box (CAAT) considered relevant for the binding of YB-1 is printed in bold. \n\nThe sequence according to SEQ. ID. No. 1 is the range of positions ?22 to ?96 of the E2 late promoter. \n\nThe nucleic acid sequence according the SEQ. ID. No. 2 is as follows: \n\n\n5??ccacgagattaggttctacgaagac caatcccgcccgccaa- 3?\n\nThe nucleic acid sequence according to SEQ. ID. No. 2 comprises the range of positions ?47 to ?87 of the E2 late promoter. \n\nIn addition, it is within the scope of the present invention that each fragment or derivative of the promoter can be used for as long as it is capable of binding YB-1 and still exhibits a promoter activity. Without wishing to be restricted thereto, binding of YB-1 appears to take place to the Y box or the Y box seems to participate in the formation of secondary structures as a result of which the presence of this box is significant for the formation of the adenoviral E2 late promoter and corresponding fragments used according to the invention. \n\nThe E2 late promoter of adenovirus has been described, for example, by Swaminathan, S., and Thimmapaya, B. (1995) Curr. Top. Microbiol. Immunol., 199, 177-194. In the adenoviral system, the E2 late promoter, together with the E2 early promoter, has the function of controlling the adenoviral E2 region and/or genes E2A and E2B. In this case, the synthesis of the E2 mRNA takes places initially starting out from the E2 early promoter. Approximately five to seven hours after the infection of a cell, a switch-over to the E2 later promoter takes place. The mechanism on which this process is based is not yet known at present. \n\nIn the early phase of infection with adenoviruses, two mRNA products of the E1A region are first produced, which products are 13S or 12S in size. Investigations have shown that the E1A 12S protein prevents and/or represses the activation of the E2 region via the E2 late promoter. The gene encoding for the E1A 13S protein, on the other hand, activates the E2 region and/or genes via the E2 early promoter (Guilfoyle R A, Osheroff W P, Rossini, EMBO J 1985, 4, 707-713). \n\nMoreover, it is known that a deletion of the region of the range of the nucleotides ?51 to ?33 of the E2 late promoter represses the synthesis of the E2 region almost completely (Guilfoyle R A et al, compare above). \n\nIt is within the scope of the present invention that it is possible for any adenoviral E2 late promoter to be used. Such different adenoviral E2 late promoters can be determined by the different forms of the adenoviruses such as they are known in the state of the art. At present, approximately 50 sub-types are known in the state of the art each of which could, in principle, be used within the scope of the present invention either as a vector or as source of an E2 late promoter. \n\nThe E2 late promoter exhibits a number of structural and sequential characteristics which may be significant for its use and in particular the use of fragments of the promoter. The formation of a loop in the range of the nucleotides of ?47 to ?81 is such a characteristic, position ?1 denoting directly the first nucleotide which is transcribed under the control of the promoter. This loop is an integral part of the two fragments, disclosed herein, of the E2 late promoter which also exhibit the properties described herein for the complete E2 late promoter. A second feature which is preferably contained in the functionally active fragments of the E2 late promoter is the so-called Y-box which appears to be responsible for binding of the YB-1 protein. Further elements which may form part of preferred embodiments of the E2 late promoter and the fragments according to the invention are the TATA box and SPI binding site. In this respect, the TATA box is important for the initiation of transcription and is usually situated at a distance of approximately 25 to 32 bp upstream of the transcription initiation site. A further feature of the E2 late promoter and/or of a functionally active fragment thereof, which may optionally be present either individually or as a complement to the other features described above, is the so-called SPI binding site. The SPI binding site is formed by the so-call GC box which binds to the transcription factor SPI. More than one GC box may be present per promoter. \n\nThe nucleic acid construct disclosed herein and/or the E2 late promoter or a functionally active fragment thereof can be present either in a form in which YB-1 is bound or in a YB-1-free form. If YB-1 is bound, the promoter is functionally active and a transcription may occur in a suitable transcription system; in the absence of YB-1, the promoter is not active so that no transcription can be observed in a transcription system. Suitable transcription systems have been described, for example, by Lewin, B., Gene: Lehrbuch der molekularen Genetik VCH Verlagsgesellschaft, 6490 Weinheim, Germany. \n\nAccording to the present invention, it is possible for practically any nucleic acid to be subjected to the control of the adenoviral E2 late promoter which then controls the expression of the nucleic acid. In this case, the E2 late promoter is subject to the stringent control of YB-1. Both genes and generally encoding sequences or fragments thereof can in this case be used as possible nucleic acids, but also non-encoding nucleic acids. In the case of the expression of nucleic acids encoding in the widest sense and their control by the E2 late promoter, it is anticipated that the requirements generally applying to promoters are satisfied, i.e. a suitable initiation codon exists and the promoter is positioned at a distance from the initiation codon such that a translation is possible. The same applies, in principle, also regarding the requirements existing for transcription. \n\nIn principle, it is within the scope of the present invention that any encoding nucleic acid can be used. With a view to the specific regulatibility of the promoter by YB-1 and consequently the use of the vector in a biological system characterised by the absence or presence of this effecter, preferred combinations of encoding sequences with the E2 late promoter are obtained. Since YB-1 is associated in particular with different tumour events, preferred nucleic acids may consist of those which may be important in the treatment of tumours at the molecular level. These include apoptosis inducing genes, for example. By introducing such genes into tumours cells exhibiting YB-1 in the nucleus (for example 30% of the ovarian carcinoma [Kamura et al., 1999; Cancer, 85, 2450-2454, Shibao K, Takano H, Nakayama Y, Okazaki K, Nagata N, Izumi H, Uchiumi T, Kuwano M, Kohno K, Itoh H Enhanced coexpression of YB-1 and DNA topoisomerase II alpha genes in human colorectal carcinomas. Int J Cancer 1999 Dec. 10; 83(6):732-7]), be it natural or induced, it is only the tumour cells which are capable of expressing the genes coupled to the promoter with the result that apoptosis caused by the apoptosis inducing gene takes place only in these cells. The situation is similar for other genes introduced in this way. Preferably, those genes are introduced which lead to a modification of the behaviour of the cells such as the tumour character of the cells and/or to selective killing of the tumour cells, for example. Apart from apoptosis genes, those genes can be introduced which interfere with the cellular events in a highly indirect manner, such as protease inhibitors, for example. Such protease inhibitors should, in general, inhibit the invasive behaviour and/or metastasis of the tumours. These include matrix metallo proteases (MMP), plasminogen activator systems (uPA), cathepsin. Moreover, the E2 late promoter can be used, according to the invention, for controlling the expression of viral proteins, viral proteins being those which normally, i.e. in the naturally occurring adenoviruses, are not subject to the control of E2 late promoter. In particular, they are the viral proteins E3ADP, E4orf6 and E1B55k. E4orf6 is a multifunctional protein which is required for maximum viral DNA replication and particle formation. It also plays an important part in splicing and the transportation of the viral RNA. In addition, it interacts with the viral protein E1B55k in order to accelerate the inactivation of p53. E1B55K, too, is a multifunctional protein which promotes, in interaction with the E4orf6 protein, the export of the viral RNA, whereas the cell-inherent RNAs are retained in the cell nucleus. A further important function of E1B55k consists of inactivating, either alone and/or together with E4orf6, the cellular protein p53. E3ADP, also referred to as adenoviral death protein, is an integral membrane glycoprotein which is required for an efficient cell lysis and the liberation of the newly synthesised viruses. The viral proteins mentioned above are known to the experts in this field and have been described in the literature. \n\nThe selective killing of the cells can take place either directly as a result of the influence of the genes introduced or indirectly as a result of the changes in the cells caused by the introduced genes. Such a change can, for example, lead to further compounds supplied from outside acting on the cells first and consequently leading to a killing of the tumour cells, for example. An example of this approach is provided by genes which need to be ascribed to the prodrug system. The prodrug system is a system in particular of enzymes which lead to metabolically non-active chemical compounds supplied to an organism as a medicine, for example, being converted into the pharmaceutically effective form only in the body. The thymidine kinase system (TK system), for example, is an example of a prodrug. It is based on the expression of the Herplex simplex thymidine kinase gene (HSVtk) following the addition of the prodrug ganciclovir. This is non-toxic to man in this form. Thymidine kinase phosphorylates the ganciclovir substrate. A purin analogue is formed which is toxic. A further example is provided by the cytosin desaminase gene system (CD). \n\nCoupling of the adenoviral E2 late promoter to a non-encoding nucleic acid is possible also to an rRNA or tRNA, for example. In this respect, an enhanced expression of this RNA population which is essential for the functioning of a cellular system is possible, which populations may in turn be associated with numerous cellular effects and functions. \n\nA further form of the non-encoding nucleic acids which may be subjected to the control of the adenoviral E2 late promoter are aptamers, ribozymes, antisense molecules and siRNA. Aptamers are nucleic acids, preferably ribonucleic acids which bind specifically to a target molecule vis-à-vis which they have been selected. The preparation of such aptamers has been described in European patent EP 0 533 838, for example. A further group of nucleic acids which can be subjected to the control of the adenoviral E2 late promoter consists of the antisense molecules whose principle of action is based on the fact that these molecules form a complex with mRNA and thus prevent the translation of the mRNA. In one embodiment, antisense molecules are also known in such a form that the cellular RNase H system is activated and, as a result of the enzymatic activity of the RNase H system, the mRNA complexed or hybridised with the antisense molecule is degraded. \n\nFinally, the non-encoding nucleic acid can also consist of ribozymes, i.e. nucleic acids which are catalytically active and capable of splitting, i.e. hydrolysing, either intramolecular or intermolecular nucleic acids, in particular ribonucleic acid. As a result of the sequence specificity of ribozymes, it is possible to selectively hydrolyse specific nucleic acid populations in a biological system, such as a cell, thus influencing biological processes. \n\nThe nucleic acid construct disclosed herein can be designed to the extent such as it has been described above for the different uses of the E2 late promoter and fragments thereof. \n\nThe nucleic acid construct can be present in different forms. It is thus within the scope of the present invention for the nucleic acid construct to be part of a vector. Such vectors are known to the persons skilled in the art and comprise plasmids and viruses, for example. Preferably, the vectors are those for eukaryotic cells, in particular for mammalian cells. Viral vectors comprise, among others, adenoviral vectors, retroviral vectors, adeno-associated vectors (AAV) and Herpes simplex vectors. All vectors have been mentioned and/or described by Dougherty, G J, Chaplin, D., Dougherty, S T., Chiu, R K, McBridge, Wh. In vivo gene therapy of cancer, Tumour Targeting, 2, 106-114 (1996); Advances in Pharmacology: Gene Therapy, Editor J. Thomas August, Volume 40, Academic Press. \n\nThe nucleic acid construct according to the invention can be used in general for the preparation of medicaments. In this respect, there are no restrictions regarding the type of indication for such medicaments for as long as the medicaments are characterised in that they are formed and/or become effective by using the adenoviral E2 late promoter or a functionally active fragment thereof as disclosed herein. In other words, medicaments according to the meaning of the present invention include those which consist of known genes or general nucleic acids provided these are subject to the control of the adenoviral late E2 promoter or a functionally active fragment thereof. \n\nA preferred indication regarding the use of the medicaments according to the invention is represented by tumour diseases. This is due to the binding of YB-1, disclosed herein, to the adenoviral E2 late promoter and the specific regulatibility of the promoter, which is based thereon, such that each nucleic acid which is subject to the control of the adenoviral E2 late promoter or a functionally active fragment thereof is specifically expressed in tumour cells exhibiting YB-1 in the nucleus. Normal, in particular human, cells possess YB-1 only in the cytoplasma such that these do not exhibit any expression of the nucleic acid which is subject to the control of the adenoviral E2 late promoter or a functionally active fragment thereof. \n\nAs a result of the coupling of the activation of the nucleic acid which is subject to the control of the adenoviral E2 late promoter or a functionally active fragment thereof with YB-1 present in the cell nucleus, it is possible to treat with the nucleic acid construct according to the invention also those diseases and in particular tumour diseases in the case of which YB-1 is present in the cell nucleus only if certain conditions exist which lead to the YB-1 being present in the nucleus exclusively, mainly or to an extent increased vis-à-vis the absence of the said specific conditions. Within the region of the tumour diseases, the localisation of YB-1 in the nucleus can be effected by the cells being exposed to stress factors. Such stress factors include, for example, hypothermia, UV radiation or the treatment of the cells or the organism containing these by cytostatics. Such cytostatics comprise cis-platinum, among others. \n\nFurther cells which are basically accessible to the treatment by the nucleic acid construct according to the invention are the so-called multi-drug resistant tumour cells. Multi-drug resistance is caused by the synthesis of P-glycoprotein. The connection between YB-1 and MDR-1 gene expression (MDR multiple drug resistance) has been described by Bagou et al. (Bagou, R. C. et al., Nature Med. 3, 1997, 4: 447-450). As a result of this connection, those tumour cells and tumours containing them which are P-glycoprotein positive can be addressed and treated by the nucleic acid construct according to the invention. | Technische Universität München,München,DE | Holm Per Sonne,Fürstenfeldbruck,DE | Technische Universität München | Holm Per Sonne | TECHNISCHE UNIVERSITAT MUNICH | TECHNISCHE UNIVERSITAT MUNICH | Holm, Per Sonne | 1 | Michael Best & Friedrich LLP | NaN | Chen, Shin Lin | US | Dead | 12 | 2014 | US | 7 | 2009 | 2001-10-16 | 2001 | C12, A61, C07 | C12, A61, C07 | 4353201 | 53602372 | 5360241 | US7195896B2 | US5994132A | WO1997016547A1 | 3 | Bhat et al., 1987, EMBO Journal, vol. 6, No. 7, p. 2045-2052. 3 | Wickham et al., 2003, US 20030099619 A1. | Goding, C.R., Temperley, S.M., and Fisher, F., Multiple transcription factors interact with the adenovirus-2 Ell-late promoter: evidence for a novel CCAAT recognition factor, Nucleic Acids Research, vol. 15, No. 19, IRL Press Limited, Oxford, England, 1987. DOI:10.1093/nar/15.19.7761 1 | Huang et al., Gene Therapy, 10, 1241-1247 (2003). DOI:10.1038/sj.gt.3301987 | 4 | US10155930B2 | US10300096B2 | US10731136B2 | US11268073B2 | 4 | 2022-06-30 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 8TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1552); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY FEE PAYMENT YEAR 8 | 2018-01-02 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) FEE PAYMENT YEAR 4 | 2015-05-05 AS ASSIGNMENT TECHNISCHE UNIVERSITAET MUENCHEN, GERMANY ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:HOLM, PER SONNE;REEL/FRAME:035565/0133 2014-11-14 | 2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE | US8921100B2 | AT500338T | AU2002350545A1 | CA2466889A1 | CA2466889C | DE10150984A1 | DE50214936D1 | EP1436403A2 | EP1436403B1 | JP04402457B2 | JP2005505299A | KR1015772B1 | KR2004054719A | KR2009127361A | US20070116670A1 | US20100015700A1 | US7572633B2 | WO2003033692A2 | WO2003033692A3 | 20030417DE10150984A1 |
| 2782 | US8920474B2 | Plate for osteosynthesis device and method of preassembling such device | FR200113460A | WO2002IB4307A | US2004492827A | 2001-10-18 | 2002-10-18 | 2004-07-15 | US13454927A | 2012-04-24 | B2 | 2014-12-30 | Delecrin Joël|Vertou, FR | Allain Jérôme|Paris, FR | Tropiano Patrick|Marseille, FR | Ganglof Serge|Aplerin, FR | Poncer Rémi|Vannes, FR | LDR Medical,Rosières Près Troyes,FR | Delecrin Joël,Vertou,FR | Allain Jérôme,Paris,FR | Tropiano Patrick,Marseille,FR | Ganglof Serge,Aplerin,FR | Poncer Rémi,Vannes,FR | LDR MEDICAL | P31 N | NaN | A61B001770 | A61B001786 | A61B00177007 | A61B00177001 | A61B0017701 | A61B00177011 | A61B00177037 | A61B00177041 | A61B00177082 | A61B0017864 | Y10T002949826 | 606257 | 606264 | NaN | Various methods, devices, and systems are disclosed that facilitate easier and more compact implantation of osteosynthesis devices. In some embodiments, implants are screwed into two vertebrae and a plate is used to hold and displace the spine. In some plate embodiments, at least one longitudinally elongated opening is disposed at one end of the plate and partially opening onto an edge of the plate. In some plate embodiments, at least one longitudinally elongated opening is disposed at one end of the plate having a portion sufficiently large to be inserted without disassembly in the fixation means of an implant already screwed into the spine when the fixation means are already assembled. | Plate for osteosynthesis device and method of preassembling such device | The invention claimed is: \n1. An implant for securing a spinal stabilization bar to a vertebra, the implant comprising: \na bone screw having a longitudinal screw axis and comprising a bone penetration end disposed at a first end of the longitudinal screw axis and a protrusion end disposed at a second end of the longitudinal screw axis distal from the bone penetration end; \na clamping head having a longitudinal clamping head axis and comprising a support head disposed at a first end of the longitudinal clamping head axis, \na drive coupler disposed at a second end of the longitudinal clamping head axis and configured for engagement with a drive tool to impart rotation to the bone screw, \na stabilization bar support configured to receive a stabilization bar from the side of the implant, and \na clamp configured to secure the stabilization bar to the stabilization bar support; and \na universal joint coupling the bone screw and the clamping head. \n2. The implant of claim 1, in which the bone screw further comprises a threaded portion disposed along an external surface of the bone screw and configured for screwing into a bone.\n3. The implant of claim 1, in which the bone screw further comprises a threaded portion disposed along a hollow core that has a bone-fusion opening.\n4. The implant of claim 1, in which the stabilization bar support comprises a partially cylindrical surface complementary to a cylindrical surface of a stabilization bar.\n5. The implant of claim 1, in which universal joint is configured for transmission of a rotation of the clamping head around its longitudinal clamping head axis imparted at the drive coupler to a rotation of the bone screw around its longitudinal screw axis while an angle between the longitudinal clamping head axis and the longitudinal screw axis is non-zero, and the stabilization bar support is configured to permit said transmission while the bar is attached to the implant.\n6. The implant of claim 1, in which the drive coupler comprises a hexagonal recess and the clamp comprises a nut.\n7. The implant of claim 1, in which the stabilization bar support comprises an opening configured for rotatable disposition of the stabilization bar support about the longitudinal clamping head axis.\n8. The implant of claim 1, in which the stabilization bar support and the protrusion end have complementary surfaces configured for support of the stabilization bar support by the protrusion end.\n9. The implant of claim 8, in which the complementary surfaces are partially spherical.\n10. The implant of claim 1, in which the protrusion end comprises a housing in which the support head is disposed, and the protrusion end has a projection configured to cooperate with a concave portion of the support head to prevent rotation, relative to the bone screw, of the clamping head around its longitudinal clamping head axis.\n11. The implant of claim 1, in which the stabilization bar support is rotatable around the longitudinal clamping head axis.\n12. An implant for securing a spinal stabilization bar to a vertebra, the implant comprising: \nan elongated bone screw having a longitudinal screw axis; \na clamping head having a longitudinal clamping head axis; \na universal joint coupling the bone screw and the clamping head configured for transmission of a rotation of the clamping head around its longitudinal clamping head axis to a rotation of the bone screw around its longitudinal screw axis while an angle between the longitudinal clamping head axis and the longitudinal screw axis is non-zero; \na stabilization bar support configured to receive a stabilization bar; and \na stabilization bar support configured to permit said transmission while the bar is attached to the implant. \n13. The implant of claim 12, in which the stabilization bar support is rotatable around the longitudinal clamping head axis.\n14. The implant of claim 13, in which the bone screw further comprises a threaded portion disposed along a hollow core that has a bone-fusion opening.\n15. The implant of claim 14, in which the stabilization bar support comprises a partially cylindrical surface complementary to a cylindrical surface of a stabilization bar.\n16. The implant of claim 15, in which the stabilization bar support and an end of the bone screw have complementary surfaces configured for support of the stabilization bar support by the end of the bone screw.\n17. A system for spinal stabilization comprising: \na plurality of implants each comprising: \nan elongated bone screw having a longitudinal screw axis, \na clamping head having a longitudinal clamping head axis, \na universal joint coupling the bone screw and the clamping head configured for transmission of a rotation of the clamping head around its longitudinal clamping head axis to a rotation of the bone screw around its longitudinal screw axis while an angle between the longitudinal clamping head axis and the longitudinal screw axis is non-zero, \na stabilization bar support configured to receive a stabilization bar and permit said transmission while the bar is attached to the implant; and \nan elongated stabilization bar having a first distal end and a second distal end, the bar comprising a pair of generally parallel rods having a space between the rods, with the space having an opening along at least one of the distal ends of the bar, and with the space being sufficient sized to allow passage of the clamping head along a path from the opening to a point between the distal ends. \n18. The system of claim 17, in which the stabilization bar support is configured to allow the rods to slide laterally across the stabilization bar support as the clamping head is passed along a path from the opening to a point between the distal ends.\n19. The system of claim 18, in which stabilization bar support is rotatable about the clamping head with the clamping head disposed between the rods of the bar.\n20. The system of claim 19, in which one of the implants has a housing in an end of the bone screw in which an end of the clamping head is disposable, and that end of the clamping head has a projection configured to cooperate with a concave portion of the housing to prevent rotation, relative to the bone screw, of the clamping head around the longitudinal clamping head axis. | 20 | 1. An implant for securing a spinal stabilization bar to a vertebra, the implant comprising: \na bone screw having a longitudinal screw axis and comprising a bone penetration end disposed at a first end of the longitudinal screw axis and a protrusion end disposed at a second end of the longitudinal screw axis distal from the bone penetration end; \na clamping head having a longitudinal clamping head axis and comprising a support head disposed at a first end of the longitudinal clamping head axis, \na drive coupler disposed at a second end of the longitudinal clamping head axis and configured for engagement with a drive tool to impart rotation to the bone screw, \na stabilization bar support configured to receive a stabilization bar from the side of the implant, and \na clamp configured to secure the stabilization bar to the stabilization bar support; and \na universal joint coupling the bone screw and the clamping head. | 1. An implant for securing a spinal stabilization bar to a vertebra, the implant comprising: a bone screw having a longitudinal screw axis and comprising a bone penetration end disposed at a first end of the longitudinal screw axis and a protrusion end disposed at a second end of the longitudinal screw axis distal from the bone penetration end; a clamping head having a longitudinal clamping head axis and comprising a support head disposed at a first end of the longitudinal clamping head axis, a drive coupler disposed at a second end of the longitudinal clamping head axis and configured for engagement with a drive tool to impart rotation to the bone screw, a stabilization bar support configured to receive a stabilization bar from the side of the implant, and a clamp configured to secure the stabilization bar to the stabilization bar support; and a universal joint coupling the bone screw and the clamping head. | 12. An implant for securing a spinal stabilization bar to a vertebra, the implant comprising: an elongated bone screw having a longitudinal screw axis; a clamping head having a longitudinal clamping head axis; a universal joint coupling the bone screw and the clamping head configured for transmission of a rotation of the clamping head around its longitudinal clamping head axis to a rotation of the bone screw around its longitudinal screw axis while an angle between the longitudinal clamping head axis and the longitudinal screw axis is non-zero; a stabilization bar support configured to receive a stabilization bar; and a stabilization bar support configured to permit said transmission while the bar is attached to the implant. | 17. A system for spinal stabilization comprising: a plurality of implants each comprising: an elongated bone screw having a longitudinal screw axis, a clamping head having a longitudinal clamping head axis, a universal joint coupling the bone screw and the clamping head configured for transmission of a rotation of the clamping head around its longitudinal clamping head axis to a rotation of the bone screw around its longitudinal screw axis while an angle between the longitudinal clamping head axis and the longitudinal screw axis is non-zero, a stabilization bar support configured to receive a stabilization bar and permit said transmission while the bar is attached to the implant; and an elongated stabilization bar having a first distal end and a second distal end, the bar comprising a pair of generally parallel rods having a space between the rods, with the space having an opening along at least one of the distal ends of the bar, and with the space being sufficient sized to allow passage of the clamping head along a path from the opening to a point between the distal ends. | This application is a continuation of U.S. patent application Ser. No. 10/492,827, filed Jul. 15, 2004, and issuing Apr. 24, 2012, as U.S. Pat. No. 8,162,988, which is a National Stage entry of International Application No. PCT/IB02/04307, filed Oct. 18, 2002, which claims priority to French Patent Application No. 01/13460, filed Oct. 18, 2001, all of which are incorporated herein by reference. \n\nThe invention, with its characteristics and advantages, will be seen more clearly upon reading the description with reference to the appended figures wherein: \n\nFIGS. 1 a, 1b, and 1c represent an osteosynthesis device according to the invention in an embodiment comprising an H-shaped plate and two polyaxial head implants fitted on an interval vertebra, in three successive phases of the fitting of the plate in the implants;\n\nFIG. 2 represents a longitudinal section view of an implant of a device according to the invention in the implant clamping phase after insertion of the plate, in an embodiment comprising a plate support free to rotate around a rehabitable hollow screw implant and fixed clamping support;\n\nFIG. 3 represents a longitudinal section view of an implant of a device according to the invention in the implant clamping phase after insertion of the plate, in an embodiment comprising a plate support free to rotate around a rehabitable hollow screw implant and inclinable clamping support;\n\nFIG. 3 a represents a partial view of an implant according to the invention, in a section along a plane passing through the centre of the support head and perpendicular to the support axis;\n\nFIG. 4 represents a longitudinal section view of an implant of a device according to the invention in the plate clamping phase once the implant is in its definitive position, in an embodiment comprising a plate support free to rotate around a rehabitable hollow screw implant and inclinable clamping support;\n\nFIGS. 5 a, 5b, 5c and 5d represent a top view of a plate of a device according to the invention, in an embodiment comprising a plate which is respectively H-shaped with two through openings, h-shaped with one through opening, with two non-through openings and with one non-through opening;\n\nFIG. 6 represents a side view of an implant of the preassembled device according to the invention, in an embodiment comprising an inclinable clamping support and a rehabitable hollow screw with two oblong holes;\n\nFIG. 7 a represents a perspective view of a longitudinal section of an implant of a device according to the invention, in an embodiment comprising an inclinable clamping support and a rehabitable hollow screw with two oblong holes and according to an alternative embodiment where the screw head housing and the support head interact without being complementary in shape;\n\nFIG. 7 b represents a partial perspective view of the support head of an implant of a device according to the invention in the same alternative embodiment;\n\nFIG. 7 c represents a partial perspective view of a cross-section along the plane AA of an implant of a device according to the invention in the same alternative embodiment;\n\nFIG. 8 represents an osteosynthesis device according to the invention in an embodiment comprising an H-shaped plate and two polyaxial head implants according to an alternative embodiment where the implants only comprise a single threaded part, on their outer surface.\n\nThe present invention relates to an osteosynthesis device, particularly for spinal support or correction, enabling easier and compact implantation, that can be particularly used in the case of implantation via the anterior approach, and a preassembly method for such a device. \n\nFor spinal support or correction, a device comprising one or more support bars or plates positioned along the spinal column is used, and fixed to certain vertebrae by implants. Said implants are fixed at one end to the plate and at the other end to the vertebrae by bone anchorage means, for example a threaded part screwed inside the actual vertebra. \n\nIn such devices, it is known to use a plate comprising several holes, to join the implants fixed to several vertebrae, as described in the patent FR2726171, for example. Said bars then surround or pass through the head of the screw and are locked with a nut screwed onto said head. \n\nHowever, such a device requires that the clamping nut only be fitted on the screw after the screws and the plate have been positioned. Therefore, said nut can only be inserted onto the screw head during the operation, with all the difficulties and risks of loss that may be caused by handling and assembling a small part inside a human body. This operation is all the more problematic when said operation is conducted by means of endoscopy, for example when it is necessary to implant via the anterior approach, i.e. via the front of the body or on the front face of the spine. \n\nA device according to the prior art also requires that the implants be fixed and completely clamped before the plate is positioned. Therefore, in the event of delicate operative conditions, it is difficult to successfully position the plate very close to the spine. This problem arises for example when the shape of the spine comprises too many irregularities, due to spinal displacement or deformation or in the presence of outgrowths such as osteophytes. There are similar problems in the case of implantation by the anterior approach, i.e. via the front of the body or on the front face of the spine. Indeed, the anatomical conditions in this case frequently only leave space for a compact size. In addition, it is often necessary to work by means of endoscopy in this case, which renders the operation difficult and gives a less satisfactory view of the implant insertion depth. \n\nIn some cases, to enable subsequent consolidation of the fixation between the implant and the vertebra, an implant composed of a so-called rehabitable screw is used, i.e. a hollow screw wherein the inside communicates with the outside via openings passing through the threaded wall. During the screwing into the vertebra, part of the bone substance penetrates inside the screw. Over time, the bone substance fuses between the inside and outside of the screw via these openings, thus forming consolidation over time. \n\nIn this way, the patent FR 2726171 discloses a hollow screw wherein the openings are produced by cutting on the inner surfaces of said screw longitudinal grooves which cut into the base of the outer threading. However, during positioning or subsequently, such a screw may form anchoring which is not sufficiently strong and is liable to be dislodged or torn from the vertebra wherein it is implanted. \n\nOne of the aims of the invention of the invention is to propose a plate that can be fitted on preassembled implants already screwed into the spine. \n\nAnother aim of the invention is to propose an osteosynthesis device that can be partly preassembled before the operation to enable easier implantation. \n\nIn this way, the invention relates to a device as described above, characterised in that the plate has an elongated shape and comprises on at least one of its ends at least one longitudinally elongated opening, said opening having firstly at least one part opening onto an edge of the plate, or one part of a sufficiently large size to be able to be inserted without disassembly in the fixation means of an implant already screwed into the spine when said fixation means are already assembled, and secondly one part of a roughly constant width and able to slide longitudinally in the fixation means of said implant after having been inserted and of being fixed thereon; such a plate can thus be assembled by one end to an already fitted implant, and then slide in the fixation means of said implant to insert the other end in another already fitted implant, and then slide again to bring both ends into the fixation position, while the fixation means of said two implants were assembled before being fitting onto the spine. \n\nAccording to one embodiment, the plate comprises two parts of identical lengths or not, said two parts being joined together by a joining part, said joining part being located in an inner part of the plate, i.e. at a sufficient distance from the ends to enable the fixation of the plate onto two implants, at a rate of one implant on either side of said joining part. \n\nAccording to one embodiment, the joining part is located in a position offset with respect to the centre of the plate length. \n\nAccording to one embodiment, the plate has an H or h shape. \n\nAccording to one embodiment, the plate has at least one longitudinally elongated opening, wherein a first region is of constant width and a second region is larger in size than the first region, said opening being able to allow the fixation means of an implant to pass before sliding to bring said fixation means in the first region. \n\nAnother aim of the invention is to propose a compact osteosynthesis device, that can be fitted and adjusted in a position very close to the spine. \n\nThis aim is achieved by an osteosynthesis device, particularly for the spine, comprising a plurality of implants that can be screwed into one or more vertebrae and provide a rigid joint between said vertebrae and at least one plate or bar used to hold or displace the spine, characterised in that the plate is joined to at least one implant by fixation means able to hold said plate without preventing the implant from rotating on its screwing axis, or without preventing a specified clearance of the plate with respect to the implant, or both: thus making it possible to continue screwing the implant, or adjust the position of the plate, or both, after the plate has been assembled on the implant. \n\nAccording to one embodiment, at least one implant has an elongated shape around an axis, referred to as the implant axis, and comprises a first bone anchoring end bearing at least one threading and a second end with an elongated part passing through a plate support, said plate support being free in rotation around said elongated part, said elongated part bearing clamping means able to hold and clamp the plate against said plate support. \n\nAnother aim of the invention is to propose an osteosynthesis device that can be screwed or clamped when it is not possible to use a tool in the actual axis of the implant. \n\nThis aim is achieved by a device as described above, characterised in that the elongated part, referred to as the clamping support, of the implant is mobile with respect to the rest of the implant, along a universal type joint between a part of the implant referred to as the screw head and a part of the clamping support referred to as the support head, thus making it possible to continue screwing the implant after the plate has been assembled on the implant, by rotating the clamping support around a clamping support axis, when said axis forms a non-null angle with the axis of the implant. \n\nAccording to one embodiment, the plate surrounds the clamping support or the second end of the implant at least partly and rests on a surface of its complementary plate support, said plate support having on the implant side a concave surface in the form of a spherical portion which is supported in a complementary fashion on the outer surface of the implant screw head. \n\nAccording to one embodiment, the clamping support has a first elongated end along the support axis and a second end bearing the support head, said support head having a non-circular cross-section having at least one concave part and comprising at least one dimension greater than at least one cross-section of the first end of the clamping support; said support head having firstly one section roughly partly circular along a plane including the support axis, and being secondly arranged in the screw head inside a housing wherein the inner surface has at least one projecting part cooperating with the concave part of the support head to prevent rotation of the clamping support around its axis. \n\nAccording to one embodiment, the inner surface of the screw head housing has a shape roughly complementary to the outer surface of the support head. \n\nAccording to one embodiment, the housing receiving the support head has, on the side of said clamping head, a specified dimension to allow the clamping support a clearance along a specified angle, between the axis of the clamping support and the axis of the implant, without said clamping support escaping from said housing. \n\nAccording to one embodiment, the clamping support head has a star-shaped cross-section with rounded ends, along a plane perpendicular to the support axis. \n\nAccording to one embodiment, the clamping support clamping means comprise a threading cooperating with a nut to hold or clamp the plate against the plate support. \n\nAccording to one embodiment, the clamping support comprises at its end opposite the implant an inner or outer recess capable of receiving a rotational drive tool and thus enable the screwing or clamping of the implant in the vertebra. \n\nOne of the aims of the invention is to propose an osteosynthesis device enabling improved screw implantation strength, during fitting, during the period prior to bone fusion or after consolidation. \n\nThis aim is achieved by a device such as that described above, characterised in that the first bone anchorage end of at least one implant has a longitudinal bore concentric to its outer surface, said bore communicating with the outside by at least one bone fusion opening produced in the wall between said inner bore and said outer surface, thus enabling a fusion between the inside and the outside of the bone substance in contact with said first end. \n\nAccording to one embodiment, the first bone anchorage end of at least one implant has two threadings winding in the same direction during the screwing of the implant, and borne respectively by the outer surface of said first end and the inner surface of the bore that it comprises. \n\nAccording to one embodiment, at least one bone fusion opening has the shape of a longitudinal oblong hole. \n\nAnother aim of the invention is to propose a preassembly method for such an osteosynthesis device. \n\nThis aim is achieved by the preassembly method for a device according to the invention, characterised in that it comprises the following steps: \n * assembly of the plate support on the clamping support of an implant;\n * assembly of the nut on the threading of the clamping support of said implant.\n\nIn an embodiment represented in FIG. 2, the device according to the invention comprises an implant 1 comprising a first end 11 equipped with an outer threading 111, and is illustrated after a first screwing in the bone substance of a vertebra 0, after insertion of a plate 2 and during the final approach. Said first end 11 also comprises a cavity or an inner bore, itself equipped with an inner threading 112 wherein the screwing direction is the same as that of the outer threading 111. During the screwing of the implant into the vertebra 0, part of the bone substance tends to fill said cavity and is assisted therein by the action of the inner threading. Preferentially, the inner threading 112 and the outer threading 111 are of the same pitch, so as to minimise the strain exerted on the bone substance at the entry of the bore during screwing.\n\nThe wall between the inner cavity and the outside of the implant has one or more openings, referred to as bone fusion holes 110, in its part which is inside the vertebra after the clamping of the implant. In the periods following the implantation, generally approximately six months, the bone substance present outside and inside the implant tends to fuse. The fusing produced in this way improves the strength of said implantation, both by means of blocking via the bone fusion holes 110, and by means of cooperation of the inner threading 112 with the bone pin formed in this way.\n\nIn one alternative embodiment, the inner threading 112 has a greater pitch than that of the outer threading 111. During the screwing of the implant 1, the bone substance present inside the cavity is then attracted slightly more quickly than the implant progresses in the vertebra 0. This effect may make it possible to compensate for a filling defect liable to occur, for example by compression of the bone substance inside the bore. This effect may also make it possible to obtain more complete or more compact filling of said cavity, for example in order to obtain a specific compression or better filling of the cavity or the bone fusion holes 110, and thus favour bone substance fusion.\n\nAt its second end, i.e. opposite the vertebra, the implant 1 comprises fixation means used to insert, hold and finally clamp a bar or a plate 2. Said second end also comprises drive means using a tool of known type, such as a hexagonal recess 124.\n\nSaid fixation means comprise for example an elongated part 12a of a cross-section less than the central part of the implant, comprising a shoulder. Said elongated part 12a passes through a plate support 3 resting on said shoulder, and comprises at its end a threading 123 receiving a clamping nut 4. In one embodiment, said plate 2, FIG. 5a, is roughly H-shaped, comprising for example two cylindrical bars joined at their centre by a rigid distance sleeve. In an alternative embodiment, the two bars are joined by a non-rigid joint enabling more latitude in the positioning of the plate. Said plate 2 is inserted between the plate support 3 and the nut 4, so as to surround the elongated part 12a of the implant. Once the plate is in position, the nut 4 is fastened, by hand or using a tool of a known type 52, FIG. 4, and cooperates with the threading 123 to clamp the plate 2 against the plate support 3 and thus lock the fixation.\n\nIn said embodiment, the plate support 3 comprises a bore 30 with a roughly rectangular insert passing through its centre. Said plate support 3, on the side of the plate, has one or more roughly complementary surfaces 2 to the surface of the plate 2 resting on them. In said embodiment, the central bore of the plate support 3 is sufficiently larger than the part 12a passing through it to allow a clearance of said support 3 transversally and at an angle with respect to the axis d1 of the implant. Said clearance makes it possible to adjust the relative position of the plate supports of two implants 1, 1a easily, and thus insert the plate 2 easily even if the implants are not well aligned or in the event of a relatively inaccessible anatomical environment. According to an alternative embodiment not shown, the plate support receives a plate 2a, FIG. 5b, comprising a single bar at one of its ends. Said plate support can then comprise an offset bore instead of the central bore 30, without leaving the scope of the invention.\n\nSince the plate support 3 is free in rotation around the part 12a of the implant 1, it is clearly understood that it is possible to continue screwing said implant into the vertebra 0, even when the plate is already in position, provided that the fixation means are not fastened on said plate 2. In this way, by inserting the plate 2 into said fixation means before the implant 1 is not entirely screwed on, it is possible not to be hindered by the various differences in levels or outgrowths liable to be present in the immediate vicinity of the spine. Once the plate is held in place but not clamped, it is still possible to finish screwing the implant into the vertebra, by rotating it via an opening of the plate support 3. The fixation means then hold the plate 2 close to the spine, the screwing of the implant providing sufficient force to oblige the plate to come closer to the spine. Therefore, the plate can be positioned and inserted with little effort, while being positioned definitively very close to the surface of the vertebra, which makes it possible to obtain a compact device size once fitted.\n\nIn a preferential embodiment of the device according to the invention, represented in FIGS. 3, 3a and 4, the implant 1 comprises a mobile part, referred to as the clamping support 12, at its second end opposite the first end 11 screwing into the vertebra 0. Said clamping support 12 has an elongated first end 121 along a support axis d12. Said elongated end passes through the central bore of the plate support 3 and bears a threading 123 receiving the clamping nut 4.\n\nAt a second end opposite its elongated end 121, the clamping support 12 bears a part, referred to as the support head 122, joining said clamping support 12 to the implant by its second end, referred to as the screw head 102, opposite the end 11 screwed into the vertebra 0. Along a plane perpendicular to the support axis d12, said clamping support head 122 has at least one dimension s122; FIG. 3a, greater than at least one cross-section s121 of the elongated end 121 of said clamping support 12. Said support head 122 is retained in a housing provided in the screw head 102 of the implant 1. For this purpose, said housing has an opening of a specified size s102 so as to retain the support head 122 inside said housing, while allowing a clearance of a specified angle a between the support axis d12 and the implant axis d1.\n\nSaid angular clearance of the clamping support 12 with respect to the implant enables angular and lateral movements facilitating to the insertion of the plate in the fixation means of the implant, as described below. Said angular clearance also makes it possible to compensate for any alignment defects between the different implants 1, 1a; FIG. 1c, of a device according to the invention and therefore renders the positioning of the plate 2 in the fixation means of said implants less delicate.\n\nIn said preferential embodiment, the plate support 3 rests on the screw head 102 of the implant 1, by means of a lower surface 31 composing a spherical portion for example. Said lower surface 31 of the plate support is in complementary contact with an upper surface 13 of said screw head. Said spherical complementary contact allows freedom of rotation and inclination of the plate support 3 with respect to the implant 1. Said spherical complementary contact of said surfaces 13, 31 also enables a uniform and stable support of said surfaces with respect to each other, after the plate 2 has been clamped onto the plate support, irrespective of the definitive angular position of said plate support 3 or the clamping support 12.\n\nThe implant 1 is screwed into the vertebra 0 by means of a rotational drive of said implant by rotating the clamping support 12 around its own clamping axis d12. Said clamping support is rotated for example by a tool, of known type, inserted into at least one recess 124 contained in the elongated end 121 of said clamping support. The clamping support 12 rotates the implant 1 by means of a universal type joint, i.e. the rotation of either of the two components around its axis rotates the other component around its own axis, the angle between the two axes possibly being non-null.\n\nSaid universal joint is produced by the cooperation of the outer surface 120 of the support head 122 with the inner surface 100 of the housing of the screw head 102 of the implant 1. Along a plane perpendicular to the support axis d12, the support head 12 has a section with a non-circular outline, for example in the shape of a star or cross with rounded corners, as illustrated in FIG. 3a. The housing of the screw head 102 which receives the support head 122, then has an inner surface 100 in roughly complementary contact with the outer surface 120 of said support head 122, said two surfaces 100, 120 cooperating to form the rotational join between these two components 102, 122. The angular variation is allowed by the fact that the support head 122, and its complementary housing, have a section with a circular outline along at least one plane including the clamping support axis d12, or the implant axis d1, or both.\n\nAccording to an alternative embodiment illustrated in FIGS. 7a to 7c, the inner surface 100 of the screw head housing receiving the support head simply has one or more projecting parts 100a, for example two. The outer surface 120 of the support head 122 then has one or more concave parts 120a with which the projecting parts 100a of the screw head housing cooperate to prevent the rotation of the clamping support 12 around its axis d12.\n\nIn this way, it is clear that it is possible to continue screwing the implant 1 into the vertebra 0, while the plate 2 is already inserted between the clamping nut 4 and the plate support 3, by adjusting the elongated end 121 of the clamping support 12 accessible via the nut 4. Since the plate support 3 is free to rotate with respect to the implant 1, said implant can rotate during screwing while leaving the plate 2 and the plate support 3 immobile.\n\nOnce the implant 1 is completely screwed into the vertebra 0, as illustrated in FIG. 4, the plate 2 can then be adjusted and locked in its definitive position, by tightening the clamping nut 4. Said nut may be tightened by hand, for example on a knurled part of its outer surface on the support axis d12, or using a tool 52 of known type, for example by adjusting two inner or outer recesses on the nut.\n\nAccording to an alternative embodiment illustrated in FIG. 8, a device according to the invention uses such implants but wherein the end 11 intended to be anchored in the vertebra only comprises one outer threaded part 111. In said alternative embodiment, the implant may comprise a longitudinal bore passing through it from one end to another, to enable positioning by means of sliding around a pin implanted beforehand in the vertebra.\n\nSeveral implants according to various alternative embodiments in the same device can of course be combined without leaving the scope of the invention. \n\nDepending on the applications, in order to join two implants 1, 1a; FIG. 1c, it is possible to use a plate of different configurations, for example such as those represented in FIGS. 5a, 5b, 5c and 5d. \n\nIn the example of an embodiment illustrated in FIGS. 1a, 1b, and 1c, two implants 1, 1a are screwed into the body of two vertebrae 0, 0a respectively of the spine, spaced by an interval of one vertebra. These two implants are then fixed together by a plate 2 inserted into their fixation means around the clamping support and then clamped between the plate support and the nut of each of said implants.\n\nIn the preferential embodiment represented in FIG. 5a, the plate 2 is elongated in shape and comprises two roughly parallel bars 201, 202, which are for example cylindrical, joined together in a rigid or flexible manner by a joining part 20. Said joining part joins the two bars at an inner part of the plate, i.e. at a specified non-null distance from each of the ends 21, 22 of the plate. More specifically, said joining part is located at a sufficient distance from each end of the plate so that said end can be inserted into the fixation means of an implant, and possibly slide in said fixation means. The position of said joining part 20 may be located at the centre of the plate, or be offset to allow a greater clearance for sliding during insertion as explained below.\n\nAt each end 21, 22 respectively, of the plate 2, the space between the two bars forms an opening 210, 220 respectively, opening out onto the edge of the plate. Said openings have a roughly constant transversal gap s211, s221, enabling longitudinal sliding of the plate in the fixation means of an implant 1, 1a. This roughly constant transversal gap also makes it possible to clamp said fixation means in any part of said openings 210, 220. Since said openings open onto the edge of the plate, it is possible to insert each of the ends of the plate into the fixation means of an implant 1, 1a as illustrated in FIG. 1a, without having to remove the nut 4 if it was preassembled beforehand. At each end, this insertion consists of sliding the end of the two bars between the nut 4 and the plate support 3 of the implant 1, at either side of the clamping support 12.\n\nIn another embodiment represented in FIG. 5b, the plate 2a is elongated in shape and comprises a first end 21a comprising a single bar, which is cylindrical for example. Said first end can be inserted into an implant according to the prior art or into an implant as described in the present invention, for example in an alternative embodiment (not shown) where the plate support only comprises a single surface 32 in contact with the plate. The plate 2a also has a second end 22a comprising two roughly parallel bars, which are cylindrical for example. These two bars form a longitudinally elongated opening 220a together, of a roughly constant width s221a. Either of the two ends of said plate 2a can be inserted, or slide, or both, in the fixation means of an implant according to the invention, in the manner described in the preferential embodiment.\n\nIn another embodiment represented in FIG. 5c, the plate 2b is elongated in shape and comprises a first end 21b having at least one opening 210b and a second end 22b having at least one second opening 220b, at least one of these openings not opening onto the edge of the plate 2b. These two openings 210b, 220b have a longitudinally elongated shape, i.e. along the length of the plate, and may be separated by one or more joining parts 20. These two openings have a roughly constant width s211b, s221b, and can be positioned by means of sliding and then be clamped in the fixation means of the implants. At least one of said openings has a part, referred to as a notch, of a larger size s210b, s220b, of a shape and size able to allow the nut 4 of the fixation means of an implant to pass through. Therefore, such a bar 2b can also be inserted in the fixation means of an implant 1 when said fixation means are already assembled, therefore not requiring handling, in the patient's body, of small parts such as the nut 4 or the plate support 3.\n\nIn an alternative embodiment represented in FIG. 5d, the plate 2c has a single opening comprising two notches as described above (see FIG. 5c). In an embodiment not shown, the plate may comprise a sufficient number of openings and notches to be able to assemble the plate with more than two implants.\n\nIt is clear that these different types of openings, which are either through or have a wider part, can be combined in various ways without leaving the scope of the invention. \n\nIn the same way, the position of the joining part 20 can vary and be offset along the length of the plate, so as to leave the clearance required for the plate to slide during positioning. In a preferential embodiment, said position is slightly offset with respect to the centre of the plate, so as to be able to slide the plate sufficiently in the first implant 1; FIG. 1b, to be able to insert it into the second implant 1a. \n\nIt is necessary to understand here that the device described can equally well comprise any other combination of different alternative embodiments of plates and alternative embodiments of implants without leaving the scope of the invention. \n\nFIGS. 1 a, 1b, and 1c illustrate different steps in the positioning of the plate 2 in two implants 1, 1a, in the preferential embodiment. This positioning is carried out while the implants are already screwed into the spine, their fixation means, in this case the plate support 3 and the nut 4 being alrea... | LDR Medical,Rosières Près Troyes,FR | Delecrin Joël,Vertou,FR | Allain Jérôme,Paris,FR | Tropiano Patrick,Marseille,FR | Ganglof Serge,Aplerin,FR | Poncer Rémi,Vannes,FR | LDR Medical | Delecrin Joël | Allain Jérôme | Tropiano Patrick | Ganglof Serge | Poncer Rémi | LCR HOLDING CORP | ZIMVIE INC. (SPINOFF OF DENTAL & SPINE BUSINESS) | Delecrin, Joël | Allain, Jérôme | Tropiano, Patrick | Ganglof, Serge | Poncer, Rémi | 5 | Denko Coburn Lauff LLP | NaN | Philogene, Pedro / Comstock, David | US | Dead | 12 | 2014 | US | 4 | 2012 | 2001-10-18 | 2001 | A61 | A61, Y10 | 606257 | 606264 | US6641583B2 | US6613053B1 | US6287309B1 | 3 | NaN | 0 | US10188528B2 | US10350088B2 | US10398574B2 | US20150182264A1 | US20170196596A1 | US9549766B2 | US9763699B2 | US9987044B2 | 8 | 2022-06-15 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 8TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1552); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY FEE PAYMENT YEAR 8 | 2018-06-14 MAFP MAINTENANCE FEE PAYMENT + PAYMENT OF MAINTENANCE FEE, 4TH YEAR, LARGE ENTITY (ORIGINAL EVENT CODE: M1551) FEE PAYMENT YEAR 4 | 2018-03-19 FEPP FEE PAYMENT PROCEDURE ENTITY STATUS SET TO UNDISCOUNTED (ORIGINAL EVENT CODE: BIG.) | 2014-12-10 STCF INFORMATION ON STATUS: PATENT GRANT PATENTED CASE | 2013-05-23 AS ASSIGNMENT LDR MEDICAL, FRANCE ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:DELECRIN, JOEL;ALLAIN, JEROME;TROPIANO, PATRCIK;AND OTHERS;SIGNING DATES FROM 20040329 TO 20040624;REEL/FRAME:030477/0152 | US8920474B2 | EP1435861A1 | EP1435861B1 | ES2387480T3 | FR2831049A1 | FR2831049B1 | US20050010215A1 | US20120265248A1 | US20150182264A1 | US20170196596A1 | US8162988B2 | US9549766B2 | US9987044B2 | WO2003032851A1 | 20030424WO2003032851A1 |
| 2783 | US8921321B2 | Therapeutic strategies for prevention and treatment of alzheimer's disease | GB200117645A | US2002200023A | 2001-07-19 | 2002-07-19 | US13690646A | 2012-11-30 | B2 | 2014-12-30 | Nagy Zsuzsanna|Birmingham, GB | Isis Innovation Ltd.,Oxford,GB | OXFORD UNIVERSITY INNOVATION LIMITED | B04 C | B05 C | D16 C | B02-A | B02-C01 | B02-G | B02-R | B02-T | B04-C01G | B04-F01 | B04-J01 | B04-N04 | B05-A01B | B06-H | B07-H | B10-A18 | B10-B01B | B10-C04C | B10-C04E | B11-C08E2 | B12-K04E | B14-G02 | B14-J01A4 | B14-L06 | D05-H09 | A61P002528 | A61K003100 | A61K003119 | A61K0031395 | A61K0031436 | A61K0031439 | A61K0031496 | A61K0031517 | A61K003156 | A61K0031573 | A61K0031704 | A61K004506 | G01N003350 | G01N003368 | A61K003119 | A61K0031395 | A61K0031439 | A61K0031496 | A61K0031517 | A61K003156 | A61K0031573 | A61K0031704 | A61K004506 | A61P002528 | G01N00335005 | G01N00335008 | G01N00335044 | G01N00336896 | G01N250000 | G01N250010 | 5140178 | 435004 | 43500724 | 435029 | 435366 | 514034 | 514183 | 51425217 | 514557 | NaN | The invention relates to therapeutic agents for use in the prevention or treatment of Alzheimer's disease. In particular the invention relates to use of inhibitors of cell cycle reentry and progression to the G1/S transition or inhibitors of progression of the cell cycle through the G1/S transition point in the prevention or treatment of Alzheimer's disease. | Therapeutic strategies for prevention and treatment of alzheimer's disease | What is claimed is: \n1. A method of selecting a candidate compound for use in the treatment of Alzheimer's disease in a human patient, which method comprises: \n(a) incubating proliferating lymphocytes of said patient in the presence of one or more pharmaceutical agent(s), wherein said proliferating lymphocytes exhibit a cell cycle regulatory defect at the G1/S phase transition and wherein said pharmaceutical agent(s) are: \ni) inhibitors of cell cycle re-entry or progression to the G1/S transition; or \nii) inhibitors of progression of the cell cycle through the G1/S transition point; and \n(b) screening and selecting a compound that corrects said regulatory defect at the G1/S transition in said proliferating lymphocytes as a candidate compound for use in the treatment of Alzheimer's disease in said patient. \n2. The method according to claim 1, wherein said one or more pharmaceutical agent(s) include(s): \n(A) one or more inhibitors of cell cycle re-entry or progression to the G1/S transition that is an inhibitor of the G0/G1 transition, or \n(B) one or more inhibitors of progression of the cell cycle through the G1/S transition point that blocks cell cycle progression in G1, induces cell cycle arrest in G1, induces cell cycle arrest at the G1/S checkpoint, blocks the G1/S transition or inhibits DNA synthesis. \n3. The method according to claim 2, wherein said one or more pharmaceutical agent(s) include(s) sodium valproate.\n4. The method according to claim 2, wherein said one or more pharmaceutical agent(s) include(s) a retinoid or retinoid receptor selective ligand, an ansamycin, a vitamin D analogue, a steroid or glucocorticoid, or an alpha adrenergic receptor antagonist.\n5. The method according to claim 1, wherein the pharmaceutical agent is an inhibitor of the G0/G1 transition.\n6. The method according to claim 1, wherein the pharmaceutical agent induces cell cycle arrest in the G0/G1 phase.\n7. The method according to claim 1, wherein the pharmaceutical agent is sodium valproate.\n8. The method according to claim 1, wherein the pharmaceutical agent blocks cell cycle progression in G1.\n9. The method according to claim 1, wherein the pharmaceutical agent induces cell cycle arrest in G1.\n10. The method according to claim 1, wherein the pharmaceutical agent induces cell cycle arrest at the G1/S checkpoint.\n11. The method according to claim 1, wherein the pharmaceutical agent blocks the G1/S transition.\n12. The method according to claim 1, wherein the pharmaceutical agent inhibits DNA synthesis.\n13. The method according to claim 1, wherein the pharmaceutical agent is: \n(a) a retinoid or retinoid receptor selective ligand; \n(b) an ansamycin; \n(c) a steroid or glucocorticoid; or \n(d) an alpha adrenergic receptor antagonist. \n14. The method according to claim 13, wherein the candidate pharmaceutical agent is alpha adrenergic receptor antagonist, and wherein said alpha adrenergic receptor antagonist is doxazosin. | 14 | 1. A method of selecting a candidate compound for use in the treatment of Alzheimer's disease in a human patient, which method comprises: \n(a) incubating proliferating lymphocytes of said patient in the presence of one or more pharmaceutical agent(s), wherein said proliferating lymphocytes exhibit a cell cycle regulatory defect at the G1/S phase transition and wherein said pharmaceutical agent(s) are: \ni) inhibitors of cell cycle re-entry or progression to the G1/S transition; or \nii) inhibitors of progression of the cell cycle through the G1/S transition point; and \n(b) screening and selecting a compound that corrects said regulatory defect at the G1/S transition in said proliferating lymphocytes as a candidate compound for use in the treatment of Alzheimer's disease in said patient. | 1. A method of selecting a candidate compound for use in the treatment of Alzheimer's disease in a human patient, which method comprises: (a) incubating proliferating lymphocytes of said patient in the presence of one or more pharmaceutical agent(s), wherein said proliferating lymphocytes exhibit a cell cycle regulatory defect at the G1/S phase transition and wherein said pharmaceutical agent(s) are: i) inhibitors of cell cycle re-entry or progression to the G1/S transition; or ii) inhibitors of progression of the cell cycle through the G1/S transition point; and (b) screening and selecting a compound that corrects said regulatory defect at the G1/S transition in said proliferating lymphocytes as a candidate compound for use in the treatment of Alzheimer's disease in said patient. | BRIEF DESCRIPTION OF THE DRAWINGS \n\nIn FIGS. 1a, 2a, 3a, 4a, 5a, 6a and 7a, cells were treated with rapamycin (Rapa), doxorubicin (Doxo) or dexrazoxone (DexRaz). In FIGS. 1b, 2b, 3b, 4b, 5b, 6b and 7b, cells were subject to oxidative stress alone or following pre-treatment with rapamycin or dexrazoxone. In FIGS. 1c, 2c, 3c, 4c, 5c, 6c and 7c, cells were treated with doxorubicin alone, or following treatment with rapamycin or dexrazoxone. Various effects of the indicated treatments were measured on day 1 (d1) and day 2 (d2).\n\nFIG. 1 illustrates the effects of cell cycle inhibitor drugs and oxidative stress on cell survival and proliferation, as measured using an MTT proliferation assay. FIG. 1a shows the effect of different drugs on cell survival and proliferation. FIG. 1b shows the effects of oxidative stress on cell survival and proliferation. FIG. 1c shows the effects of doxorubicine on cell survival and proliferation.\n\nFIG. 2 illustrates the effects of cell cycle inhibitor drugs and oxidative stress on apoptosis, as measured using FACS analysis. FIG. 2a shows the effect of cell cycle regulator drugs on apoptosis. FIG. 2b shows the effects of oxidative stress on apoptosis. FIG. 2c shows the effects of doxorubicine on apoptosis.\n\nFIG. 3 illustrates the effects of cell cycle inhibitor drugs and oxidative stress on length of the G1 phase of the cell cycle. The y-axis is relative lengthening of the G1 phase of the cell cycle expressed as a percentage. FIG. 3a shows the effect of various drugs on the length of the G1 phase of the cell cycle. FIG. 3b shows the effect of sub-lethal oxidative stress on the length of the G1 phase of the cell cycle. FIG. 3c shows the effect of doxorubicine on the length of the G1 phase of the cell cycle.\n\nFIG. 4 illustrates the effects of cell cycle inhibitor drugs and oxidative stress on length of the G2 phase of the cell cycle. The y-axis is relative lengthening of the G3 phase of the cell cycle expressed as a percentage. FIG. 4a shows the relative change of G2 length under the effect of cell cycle inhibitors. FIG. 4b shows the relative change of G2 length under the effect of oxidative stress. FIG. 4c shows the relative change of G2 length under the effect of doxorubicine.\n\nFIG. 5 illustrates the effects of cell cycle inhibitor drugs and oxidative stress on expression of amyloid precursor protein (APP). The y-axis is percent increase in the amount of protein relative to untreated control culture. The absolute values used to perform this analysis were derived from optical density measurements (OD) obtained from the ELISA assay performed. FIG. 5a shows the effect of cell cycle inhibitor drugs on APP expression. FIG. 5b shows the effect of oxidative stress on APP expression. FIG. 5c shows the effect of doxorubicine on APP expression.\n\nFIG. 6 illustrates the effects of cell cycle inhibitor drugs and oxidative stress on expression of AD-type hyperphosphorylated tau. The y-axis is percent increase in the amount of protein relative to untreated control culture. The absolute values used to perform this analysis were derived from optical density measurements (OD) obtained from the ELISA assay performed. FIG. 6a shows the effect of cell cycle inhibitor drugs on the expression of AD-type hyperphosphorylated tau. FIG. 6b shows the effect of oxidative stress on the expression of AD-type hyperphosphorylated tau. FIG. 6c shows the effect of doxorubicine on the expression of AD-type hyperphosphorylated tau.\n\nFIG. 7 illustrates the effects of cell cycle inhibitor drugs and oxidative stress on expression of AD-type PHF tau. The y-axis is percent increase in the amount of protein relative to untreated control culture. The absolute values used to perform this analysis were derived from optical density measurements (OD) obtained from the ELISA assay performed. FIG. 7a shows the effect of cell cycle inhibitor drugs on the expression of AD-type PHF tau. FIG. 7b shows the effect of oxidative stress on the expression of AD-type PHF tau. FIG. 7c shows the effect of doxorubicine on the expression of AD-type PHF tau.\n\nCROSS-REFERENCE TO RELATED APPLICATIONS \n\nThis application claims priority to U.S. patent application Ser. No. 10/200,023 (filed on Jul. 19, 2002; pending), which application claims priority to GB 0117645.2 (filed Jul. 19, 2001), each of which applications are herein incorporated by reference in its entirety. \n\nFIELD OF THE INVENTION \n\nThe present invention relates to novel strategies for treatment and prevention of Alzheimer's disease. \n\nBACKGROUND OF THE INVENTION \n\nAs life expectancy increases Alzheimer's disease (AD) is becoming a major health problem in the western world. There has been intensive research aimed at identifying a reliable cure or preventive measures for the disease, so far without success. \n\nCurrently there are two mainstream therapeutic approaches to the treatment of Alzheimer's disease. The first is treatment with acetylcholine esterase inhibitors, which reduce the effects of neuron loss in the central nervous system and therefore provide some symptomatic relief for the cognitive defects. However, this approach is appropriate only in those patients in which there is substantial functional reserve left in the brain. \n\nThe second approach is to reduce the amount of or stop the deposition of beta-amyloid plaques in the brain. The main drawback of this approach is that amyloid deposition is not the cause but rather a consequence of Alzheimer's disease, and the accumulation of this protein does not have any effect on the cognitive status or functional capacity of the brain. \n\nIn recent years it is becoming more widely accepted that the pathogenic basis of Alzheimer's disease is the aberrant re-entry of different neuronal populations into the cell division cycle (Nagy Z, Esiri M M and Smith A D (1998) Neuroscience 84: 731-739). In healthy elderly individuals rapid cell cycle arrest and re-differentiation may follow this cell cycle re-entry. In contrast, in individuals with Alzheimer's disease the regulatory mechanisms appear to fail and the neurons progress into the late stages of the cell cycle leading to the accumulation of AD-related pathology and/or neuronal death (Nagy Z, Esiri M M and Smith A D (1998) Neuroscience 84: 731-739).\n\nStudies by the present inventors and others indicate that the cell cycle regulatory failure in Alzheimer's disease occurs at the G1/S transition checkpoint (Arendt T, Rodel L, Gartner U and Holzer M (1996) Neuroreport 7: 3047-9). Previous studies on fibroblasts and lymphocytes from Alzheimer's disease patients indicate that the regulation of the cell division cycle might be disrupted in cells other than neurons in this condition (Eckert A, Hartmann H, Forstl H and Muller W E (1994) Life Sci 55: 2019-29; Fischman H K, Reisberg B, Albu P, Ferris S H and Rainer J D (1984) Biol Psychiatry 19: 319-27; Tatebayashi Y, Takeda M, Kashiwagi Y, Okochi M, Kurumadani T, Sekiyama A, Kanayama G, Hariguchi S and Nishimura T (1995) Dementia 6: 9-16). It is also known that Alzheimer's disease patients are more prone to some forms of cancer (Burke W J, McLaughlin J R, Chung H D, Gillespie K N, Grossbcrg G T, Luque F A and Zimmerman J (1994) Alzheimer Dis Assoc Disord 8: 22-8) and that Down's syndrome patients, who develop AD in early adult life, are more prone to leukaemia than the general population (Drabkin H A and Erickson P (1995) Prog Clin Biol Res 393: 169-76; Fong C T and Brodeur G M (1987) Cancer Genet Cytogenet 28: 55-76). It is plausible therefore to hypothesize that the cell cycle regulatory failure in neurons, even in early (pre-clinical) stages of AD, might be reflected by similar cell cycle regulatory malfunction in lymphocytes.\n\nSUMMARY OF THE INVENTION \n\nThe present inventor has shown that the in vitro responsiveness of lymphocytes to G1 inhibitor treatment is significantly less effective in Alzheimer's disease patients than in control subjects. Additionally, in subjects showing clinical signs of incipient Alzheimer's disease the lymphocyte response is similar to that seen in Alzheimer's disease patients. These findings represent direct evidence that failure of the G1/S transition control is not restricted to neurons in Alzheimer's disease patients, but also occurs in peripheral cells, such as lymphocytes. \n\nThe two main targets of therapeutic intervention identified by the inventor are to prevent/inhibit cell cycle re-entry and progression to the G1/S transition point, or to prevent/inhibit the cell cycle progression at the G1/S transition point. \n\nAccording to one aspect of the invention, methods of treating or preventing Alzheimer's disease in a human patient are provided. The methods include administering to a human patient in need thereof an effective amount of one or more inhibitors of cell cycle re-entry and progression to the G1/S transition. In certain embodiments, the inhibitor of cell cycle re-entry and progression to the G1/S transition is an inhibitor of the G0/G1 transition, and in other embodiments the inhibitor of cell cycle re-entry and progression to the G1/S transition induces cell cycle arrest in the G0/G1 phase. \n\nPreferred inhibitors of cell cycle re-entry and progression to the G1/S transition for use in the foregoing methods include NA22598, sodium valproate, fascaplysin and brefeldin A. \n\nAccording to another aspect of the invention, additional methods of treating or preventing Alzheimer's disease in a human patient are provided. The methods include administering to a human patient in need thereof an effective amount of one or more inhibitors of progression of the cell cycle through the G1/S transition point. In some embodiments, the inhibitor of progression of the cell cycle through the G1/S transition point blocks cell cycle progression in G1, and/or induces cell cycle arrest in G1, and/or induces cell cycle arrest at the G1/S checkpoint, and/or blocks the G1/S transition, and/or inhibits DNA synthesis. \n\nPreferred inhibitors of progression of the cell cycle through the G1/S transition point include squamocin, peptide aptamers which specifically inhibit E2F binding activity, manumycin A, indole carbazolc K252a, 4-sodium phenyl butyrate, retinoids or retinoid receptor selective ligands, combinations of oncostatin M and interleukin 6, an ansamycin (preferably herbimycin, geldanamycin or TT-B), vitamin D analogs, steroids or glucocorticoids, alpha adrenergic receptor antagonists (preferably doxazosin), iron chelators (preferably O-Trensox, desferrioxamine, an aroylhydrazone ligand, dexrazoxane or EDTA), angiotensin II receptor antagonists (preferably bradykinin), immunosuppressive chemotherapeutic drugs (preferably doxorubicin, adriamycin, rapamycin, cyclosporin A, FK506 or a prodigiosin), and melatonin. \n\nThe foregoing inhibitors of cell cycle re-entry and progression to the G1/S transition and inhibitors of progression of the cell cycle through the G1/S transition point can be administered alone or in combination with other of these inhibitors, or in combination with one or more non-cell cycle therapeutic agents for treating Alzheimer's disease, such as acetylcholine esterase inhibitors (such as donepezil, rivastigmine and galantamine), beta- and gamma-secretase inhibitors, Abeta vaccines, CuZn chelators, cholesterol-lowering drugs and non-steroidal anti-inflammatory drugs. Preferred combinations of cell cycle therapeutic agents include doxorubicin and rapamycin (particularly administration of the rapamycin followed by the administration of the doxorubicin), and dexrazoxane and doxorubicin (particularly administration of the dexrazoxone followed by the administration of the doxorubicin). \n\nAccording to a further aspect of the invention, methods of selecting a pharmaceutical agent for use in the treatment Alzheimer's disease in a human patient are provided. The methods include the steps of (a) exposing cells from the patient, which cells are non-neuronal cells that exhibit a cell cycle regulatory defect at the G1/S phase transition, to a panel of pharmaceutical agents which are known inhibitors of cell cycle re-entry and progression to the G1/S transition or known inhibitors of progression of the cell cycle through the G1/S transition point, (b) analyzing the regulation of the G1/S transition the cells in the presence and absence of the pharmacological agents, and (c) identifying an agent which corrects the regulatory defect at the G1/S transition in the cells, which agent is identified as likely to be of benefit in the treatment of Alzheimer's disease in the patient. In some embodiments, the panel of pharmaceutical agents includes one or more inhibitors of cell cycle re-entry and progression to the G1/S transition and/or one or more inhibitors of progression of the cell cycle through the G1/S transition point as described herein. \n\nIn another aspect of the invention, methods of screening compounds for potential pharmacological activity in the treatment of Alzheimer's disease are provided. The methods include contacting SH-SY5Y neuroblastoma cells with candidate compounds and testing for at least one parameter indicative of Alzheimer's disease pathology selected from the group consisting of: (i) cell survival and proliferation, (ii) apoptosis, (iii) relative lengthening of the G1 phase of the cell cycle, (iv) relative lengthening of the G2 phase of the cell cycle, (v) expression of amyloid precursor protein (APP), (vi) expression of hyperphosphorylated tau protein, and (vii) expression of PHF tau protein. Candidate compounds which cause a reduction in the tested parameter(s), as compared to control cells not exposed to the candidate compound, are scored as having potential pharmacological activity in the treatment of Alzheimer's disease. \n\nIn some embodiments, the candidate compound to be tested using the method is a known inhibitor of cell cycle re-entry and progression to the G1/S transition or a known inhibitor of progression of the cell cycle through the GUS transition point. \n\nAccording to yet another aspect of the invention, pharmaceutical kits for treating Alzheimer's disease are provided. The kits include a therapeutically effective amount of one or more cell cycle therapeutic agents for treating Alzheimer's disease selected from one or more inhibitors of cell cycle re-entry and progression to the G1/S transition and/or inhibitors of progression of the cell cycle through the G1/S transition point. In certain embodiments, combinations of cell cycle therapeutic agents are provided in the kits, such as doxorubicin and rapamycin, or dexrazoxone and doxorubicin. In other embodiments, the kits can also include a non-cell cycle therapeutic agent for treating Alzheimer's disease. The kits preferably also will contain instructions for simultaneous, separate or sequential administration of the cell cycle therapeutic agent and optionally the non-cell cycle therapeutic agent for treating Alzheimer's disease. \n\nThese and other embodiments of the invention are described in greater detail below. \n\nDETAILED DESCRIPTION OF THE INVENTION \n\nThe invention relates to several strategies for therapeutic intervention in order to arrest progression of Alzheimer's disease or to prevent its development. \n\nThe two main targets of therapeutic intervention identified by the inventor are to prevent/inhibit cell cycle re-entry and progression to the G1/S transition point, or to prevent/inhibit the cell cycle progression at the G1/S transition point. Neuronal cell cycle re-entry can be prevented by therapies that act as differentiation factors or by interventions that reinforce synaptic connections and therefore the differentiated state of neurons. Therapies aimed at arresting the progression of the cell division cycle at the G1/S transition point include treatment with classical inhibitors of cell division, for example drugs used in cancer therapy and chemo-prevention. \n\nThe preferred agent for treatment of Alzheimer's disease in any given patient will vary depending on the precise nature of the underlying cell cycle regulatory defect present in that patient. It is not the case that all agents that prevent cell cycle re-entry and progression to the G1/S transition point, or which prevent the cell cycle progression at the G1/S transition point, will be effective in all Alzheimer's patients. The inventor's finding that the failure of the G1/S transition control is not restricted to neurons in Alzheimer's disease patients, but also occurs in peripheral cells, such as lymphocytes, has led to the development of an in vitro assay which can be used to identify and select agents which are effective in a particular patient. The ability to select an agent that will work in a given patient via a simple in vitro test is absolutely critical. Prior to the development of this in vitro screen it would simply not have been possible to select an agent having clinical utility in a particular patient without to extensive, ethically unacceptable, trial and error in that patient. \n\nIn summary, the development of an in vitro screen which can be used identify agents capable of correcting the cell cycle regulatory defects present in Alzheimer's patients has made it possible for the first time to provide effective treatment and prophylaxis for Alzheimer's disease based on prevention/inhibition of cell cycle re-entry and progression to the G1/S transition point, or on prevention/inhibition of cell cycle progression at the G1/S transition point. \n\nTherefore, in a first aspect the invention relates to use of at least one substance which is an inhibitor of cell cycle re-entry and progression to the G1/S transition for the manufacture of a medicament for the treatment or prevention of Alzheimer's disease. \n\nThe invention is also directed to method of treating or preventing Alzheimer's disease in a human patient comprising administering to a human patient in need thereof an effective amount of an inhibitor of cell cycle re-entry and progression to the G1/S transition. \n\nInhibitors of cell cycle re-entry and progression to the G1/S transition may act via various mechanisms, for example inhibition of the G0/G1 transition, or induction of cell cycle arrest in the G0/G1 phase. \n\nPreferably the inhibitor of cell cycle re-entry and progression to the G1/S transition will be a substance that, when assessed using the in vitro assay described herein, produces significant correction of the cell cycle regulatory defect at the G1/S transition in an Alzheimer's patient, most preferably the Alzheimer's patient which it is intended to treat using the substance. \n\nPreferred known inhibitors of cell cycle re-entry and progression to the G1/S transition, which may be used in accordance with this aspect of the invention, include the following, however this is not to be construed as limiting the invention to these specific embodiments: \n\nNA22598an anticancer drug that inhibits G0/G1 transition (Kawada, M., Kuwahara, A., et al. (1999) Exp Cell Res, 249(2): 240-247).\n\nSodium valproate and its derivativesan inhibitor of the growth of human neuroblastoma cells and known antiepileptic agent (Cinatl, J. Jr., Cinatl, J., et al. (1997) Anticancer Drugs, 8(10): 958-963; Cinatl, J. Jr., Cinatl, J., et al. (1996) Anticancer Drugs, 7(7): 766-773).\n\nFascaplysinwhich specifically inhibits cdk4 therefore inhibiting the G0/G1 transition (Soni, R., Muller, L., et al. (2000). Biochem Biophys Res Comm, 275(3): 877-884).\n\nBrefeldin Awhich induces cell cycle arrest in the G0/G1 phase (Nojiri, H., Manya, H., et al. (1999) FEBS Lett, 453(1-2): 140-144).\n\nIn a second aspect the invention is relates to use of at least one substance which is an inhibitor of progression of the cell cycle through the G1/S transition point for the manufacture of a medicament for the treatment or prevention of Alzheimer's disease. \n\nThe invention is also directed to a method of treating or preventing Alzheimer's disease in a human patient comprising administering to a human patient in need thereof an effective amount of an inhibitor of progression of the cell cycle through the G1/S transition point. \n\nInhibitors of progression of the cell cycle through the G1/S transition point may act via various mechanisms. For example, they may block cell cycle progression in G1, induce cell cycle arrest in G1, induce cell cycle arrest at the G1/S checkpoint via various pathways, block the G1/S transition, or inhibit DNA synthesis. \n\nPreferably the inhibitor of progression of the cell cycle through the G1/S transition point will be a substance that, when assessed using the in vitro assay described herein, produces significant correction of the cell cycle regulatory defect at the G1/S transition in an Alzheimer's patient, most preferably the Alzheimer's patient which it is intended to treat using the substance. \n\nPreferred known inhibitors of progression of the cell cycle through the G1/S transition point, which may be used in accordance with this aspect of the invention, include the following, however this is not to be construed as limiting the invention to these specific embodiments: \n\nSquamocinan annonaceous acetogenin which blocks cell cycle progression in the G1 phase (Raynaud, S., Nemati, F., et al. (1999) Life Science, 65(5): 525-533).\n\nPeptide aptamers that functionally antagonize E2F activitysuitable peptide aptamers are those described and shown to be inhibitors of the cell cycle in G1 by Fabbrizio, E., Le Cam, L., et al. (1999) Oncogene, 18(30): 4357-4363.\n\nManumycin Ashown to cause G1 arrest (Wang, W. and Macaulay, R. J. (1999) Int J Cancer, 82(3): 430-434).\n\nIndole carbazole K252aa compound shown to cause cell cycle arrest at the G1/S checkpoint via p21 (Chin, L. S., Murray, S. F., et al. (1999) Cancer Invest., 17(6): 391-395).\n\nOncostatin M and interleukin 6 in combinationthis combination of cytokines induces cell cycle arrest at G1/S via p27 (Klausen, P., Pedersen, L., et al. (2000) Oncogene, 19(32): 3675-3683).\n\n4-sodium phenylbutyratean agent that has been used for many years in the treatment of urea cycle defects, which has been shown to cause cell cycle arrest in G1 via p21 (McGrath-Morrow, S. A. and Stahl, J. L. (2000) J Pharmacol Exp Ther, 294(3): 941-947).\n\nRetinoids and retinoid receptor selective ligands (e.g. ligands which mimic the effect of retinoic acid binding to the retinoid receptor, for example Targretin)suitable retinoids include retinoic acid, which has been shown to mediate cell cycle arrest in G1 (Hsu, S. L., Hsu, J. W. et al. (2000) Exp Cell Res, 258(2): 322-331).\n\nAnsamycinsmembers of the ansamycin class of antibiotics have been shown to inhibit the growth of human tumor cell lines in vitro. Suitable ansamycins include thiazinotrienomycin B (TT-B), shown to inhibit cell cycle progression from G0/G1 to S (Hosokawa, N., Yamamoto, S., et al. (1999) J. Antibiot, 52(5): 485-490; Hosokawa, N., Naganawa, H., et al. (2000) J. Antibiot, 53(9): 886-894), and related compounds such as, for example, herbimycin and geldanamycin.\n\nVitamin D analogssuitable analogs include, but are not limited to, the compounds EB1089 and CB1093, which have been shown to cause cell cycle arrest in the G0/G1 phase (Pettersson, F., Colston, K. W., et al. (2000) Br J Cancer, 83(2): 239-245).\n\nGlucocorticoidssuitable glucocorticoids include, but are not limited to, the synthetic glucocorticoid dexamethasone, which has been shown to induce cell cycle arrest in G1 via p27 and p57 (Samuelsson, M. K., Pazirandeh, A., et al. (1999) Mol Endocrinol, 13(11): 1811-1822).\n\nAlpha adrenergic receptor antagonistssuitable examples include the alpha1-adrenergic receptor antagonist doxazosin, which has been shown to induce cell cycle arrest in G1 via p27 (Kintsher, U., Kon, D., et al. (2001) J Cardiovasc Pharmacol, 37(5): 532-539; Kintsher, U., Wakino, S., et al. (2000) Arterioscler Thromb Vasc Biol, 20(5): 1216-1224).\n\nIron chelatorssuitable examples include EDTA, dexrazoxane, the synthetic iron chelator O-Trensox and desferrioxamine, both of which have been shown to block the G1/S transition (Rakba, N., Loyer, P., et al. (2000) Carcinogenesis, 21(5): 943-951) and also aroylhydrazone iron chelators of the pyridoxal isonicotinoyl hydrazone class, such as those shown by Becker, E. and Richardson, D. R. (1999) J Lab Clin Med, 134(5): 510-521 to be mediators of cell cycle arrest at G1/S.\n\nAngiotensin II receptor antagonistssuitable examples include bradykinin, which is known to inhibit DNA synthesis (Patel, K. V. and Schrey, M. P. (1992) Cancer Res, 52(2): 334-340).\n\nImmunosuppressive chemotherapeutic drugssuitable examples are Doxorubicin, Adriamycin, Rapamycin, Cyclosporin A, FK506 (Tacrolimus) and compounds of the prodigiosin family. These immunosuppressive drugs are all known to promote G1 inhibition via p21 and p27. \n\nMelatoninwhich is known to induce G1/S inhibition (Urata, Y., Honma, S., et al. (1999) Free Radic Biol Med, 27(7-8): 838-847).\n\nThe above agents may also be used in combination in order to achieve the desired therapeutic effect. Certain combinations of agents may act co-operatively, additively or synergistically, when co-administered or when administered sequentially. A preferred combination is doxorubicin with rapamycin. Most preferably the two agents are administered sequentially, rapamycin followed by doxorubicin. As illustrated in the accompanying Examples, a combined treatment with rapamycin and doxorubicin has a strong protective effect against the accumulation of AD-related proteins. A further preferred combination is dexrazoxane with doxorubicin. Again the two agents are most preferably administered sequentially, dexrazoxone followed by doxorubicin. As illustrated in the accompanying Examples, treatment with dexrazoxane followed by doxorubicin enhances protection against AD-related protein expression. \n\nThe invention is also directed to the use of pharmaceutically acceptable salts of the agents listed above, and to derivatives of the listed agents which retain the desired activity of inhibiting cell cycle re-entry and progression to the G1/S transition point, or inhibiting cell cycle progression at the G1/S transition point. Derivatives that substantially retain the same activity as the starting material, or more preferably exhibit improved activity, may be produced according to standard principles of medicinal chemistry, which are well known in the art. Such derivatives may exhibit a lesser degree of activity than the starting material, so long as they retain sufficient activity to be therapeutically effective. Derivatives may exhibit improvements in other properties that are desirable in pharmaceutical active agents such as, for example, improved solubility, reduced toxicity, enhanced uptake into the brain, etc. \n\nThe above-listed agents, or pharmaceutically acceptable salts or derivatives thereof, may be formulated into pharmaceutical dosage forms, together with suitable pharmaceutically acceptable carriers, such as diluents, fillers, salts, buffers, stabilizers, solubilizers, etc. The dosage form may contain other pharmaceutically acceptable excipients for modifying conditions such as pH, osmolarity, taste, viscosity, sterility, lipophilicity, solubility etc. \n\nSuitable dosage forms include solid dosage forms, for example, tablets, capsules, powders, dispersible granules, cachets and suppositories, including sustained release and delayed release formulations. Powders and tablets will generally comprise from about 5% to about 70% active ingredient. Suitable solid carriers and excipients are generally known in the art and include, e.g. magnesium carbonate, magnesium stearate, talc, sugar, lactose, etc. Tablets, powders, cachets and capsules are all suitable dosage forms for oral administration. \n\nLiquid dosage forms include solutions, suspensions and emulsions. Liquid form preparations may be administered by intravenous, intracerebral, intraperitoneal, parenteral or intramuscular injection or infusion. Sterile injectable formulations may comprise a sterile solution or suspension of the active agent in a non-toxic, pharmaceutically acceptable diluent or solvent. Suitable diluents and solvents include sterile water, Ringer's solution and isotonic sodium chloride solution, etc. Liquid dosage forms also include solutions or sprays for intranasal administration. \n\nAerosol preparations suitable for inhalation may include solutions and solids in powder form, which may be combined with a pharmaceutically acceptable carrier, such as an inert compressed gas. \n\nAlso encompassed are dosage forms for transdermal administration, including creams, lotions, aerosols and/or emulsions. These dosage forms may be included in transdermal patches of the matrix or reservoir type, which are generally known in the art. \n\nPharmaceutical preparations may be conveniently prepared in unit dosage form, according to standard procedures of pharmaceutical formulation. The quantity of active compound per unit dose may be varied according to the nature of the active compound and the intended dosage regime. Generally this will be within the range 0.1 mg to 1000 mg. \n\nOther delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of the therapeutic agents of the invention described herein, increasing convenience to the subject and the physician. Many types of release delivery systems are available and known to those of ordinary skill in the art. They include polymer based systems such as poly(lactide-glycolide), copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides. Microcapsules of the foregoing polymers containing drugs are described in, for example, U.S. Pat. No. 5,075,109. Delivery systems also include non-polymer systems that are: lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono- di- and tri-glycerides; hydrogel release systems; sylastic systems; peptide based systems; wax coatings; compressed tablets using conventional binders and excipients; partially fused implants; and the like. Specific examples include, but are not limited to: (a) erosional systems in which the therapeutic agent(s) of the invention are contained in a form within a matrix such as those described in U.S. Pat. Nos. 4,452,775, 4,675,189, and 5,736,152, and (b) diffusional systems in which an active component permeates at a controlled rate from a polymer such as described in U.S. Pat. Nos. 3,854,480, 5,133,974 and 5,407,686. In addition, pump-based hardware delivery systems can be used, some of which are adapted for implantation. \n\nUse of a long-term sustained release implant may be particularly suitable for treatment of chronic conditions such as Alzheimer's disease. Long-term release, are used herein, means that the implant is constructed and arranged to delivery therapeutic levels of the active ingredient for at least 30 days, and preferably 60 days. Long-term sustained release implants are well-known to those of ordinary skill in the art and include some of the release systems described above. \n\nIn some embodiments, the invention involves co-administration of at least two different types of therapeutic agent for treating Alzheimer's disease. Thus, the invention provides methods and products for combination therapy in which a first therapeutic agent (e.g., an inhibitor of cell cycle re-entry and progression to the G1/S tra... | Isis Innovation Ltd.,Oxford,GB | Isis Innovation Ltd. | ISIS INNOVATION LTD | UNIVERSITY OF OXFORD | Nagy, Zsuzsanna | 1 | Auerbach, Jeffrey I. | Kreppel, Lisa | AuerbachSchrot LLC | NaN | Kim, Taeyoon | US | Dead | 12 | 2014 | US | 11 | 2012 | 2001-07-19 | 2001 | A61, G01 | A61, G01 | 5140178 | 514034 | 514183 | 51425217 | 514557 | 435029 | 435366 | 435004 | 43500724 | US6147094A | US6264994B1 | JP1997221421A | JP2000290184A | WO2000019200A1 | WO2001012236A2 | WO2001056982A1 | WO2002073212A2 | WO2003083067A2 | JP9221421A | WO1998051702A1 | WO1999037294A2 | WO2001000619A1 | US5922761A | WO1998047854A1 | US5663201A | WO1993011762A1 | WO1996009299A1 | WO1998009523A1 | WO2001051464A1 | WO1994000095A2 | WO1998025887A2 | WO1999048489A2 | US7842455B2 | EP778023A1 | US6187950B1 | EP1006108A1 | EP1239038A1 | GB2314268A | WO1998002435A1 | WO2001010829A1 | WO2004002488A1 | US5846984A | US8137916B2 | US8343926B2 | 35 | Arendt, Th. et al., Neuroprotection by Repressing G0-G1 Transition: A Therapeutic Strategy for AD? Eur. J. Neuroscience 12(Supplement 11):552 TWH 4 (2000). 5 | Chyan, C.J. et al., Neuroprotective Activity of Melatonin Against Alzheimer Beta-Amyloid is Not Mediated by Melatonin Receptors, Society of Neuroscience Abstracts, vol. 24(1/2):1455 (1998). | Copani, A., et al., Mitotic Signaling by Beta-Amyloid Causes Neuronal Death, FASEB J. 13/15:2225-2234, (1999). 12 | Crapper Mclachlan, D.R. et al., Intramuscular Desferrioxamine in Patients With Alzheimer's Disease, The Lancet 337(8573):1304-1308, (1991). DOI:10.1016/0140-6736(91)92978-B 22 | Database WPI Week 199744, Derwent, AN 1997-475453 & JP 09 221421 (Kyowa Hakko Kogyo KK) (Aug. 26, 1997). | Database WPI Week 200114, Derwent, AN 2001-127322 & JP 2000 290184 (Kyowa Hakko Kogyo KK) (Oct. 17, 2000). | European Search Report EP 06025392 (Jun. 13, 2007) pp. 1-23. | European Search Report EP 06025393 (Apr. 26, 2007) pp. 1-12. | European Search Report EP 06025394 (May 30, 3007) pp. 1-8. | Giovanni, A. Involvement of Cell Cycle Elements, Cyclin-dependent Kinases, pRv, and E2F.DP, in B-amyloid-induced Neuronal Death, J. Biol. Chem. 274(27):19011-19016 (1999). DOI:10.1074/jbc.274.27.19011 3 | Giovanni, A E2F1 Mediates Death of B-amyloid-treated Cortical Neurons in a Manner Independent of p53 and Dependent on Bax and Caspase 3, J. Biol. Chem. 275(16):11553-11560, (2000). DOI:10.1074/jbc.275.16.11553 4 | Howlett, D.R., Common Structural Features Determine the Effectiveness of Carvedilo, Daunomycin and Rolitetracycline As Inhibitors of Alzeheimer B-Amyloid Fibril Formation, Biochem. J. 343, pp. 419-423, 1999. DOI:10.1042/0264-6021:3430419 7 | Israel, C.W. et al., Discrimination Between Ventricular and Supraventricular Tachycardia by Dual Chamber Cardioverter Defibrillators: Importance of the Atrial Sensing Function, J. Pacing and Clinical Electrophysiology, 24(2):183-190, 2001. DOI:10.1046/j.1460-9592.2001.00183.x | Janicki, S.M. et. al., Presenilin Overexpression Arrests Cells in the G1 Phase of the Cell Cycle, Arrest Potentiated by the Alzheimer's Disease PS2(N1411) Mutant, Amer. J. Pathology 155(1):135-144, (1999). DOI:10.1016/S0002-9440(10)65108-5 6 | Kwada, M. et al., A Novel Antitumor Compound, Reduces Cyclin D1 Levels, Arrests Cell Cycle At G1 Phase, and Inhibits Anchorage-Independent Growth of Human Tumor Cells, Exper. Cell. Res. 249(2), 240-247, (1999). DOI:10.1006/excr.1999.4467 | Lazarovici, P. et al., K252a and Staurosoporine Microbial Alkaloid Toxins As Prototype of Neurotropic Drugs, Advances in Experimental Medicine & Biology, 391(31):367-377, (1996). | Liu, D.X. et al., Neuronal apoptosis at the GI/S cell cycle checkpoint, Cell Tissue Res., 305:217-228, (2001). DOI:10.1007/s004410100396 | Nagy, Z. et al., Cell Cycle Markers in the Hippocampus in Alzheimer's Disease, Acta Neuropathol. 94:6-15 (1997). | Nagy, Z., et al., Expression of Cell Division Markers in the Hippocampus in Alzheimer's Disease and Other Neurodegenerative Conditions, Acta Neuropathol. 93:294-300 (1997). | Nagy, Z., et al., The Cell Division Cycle and the Pathophysiology of Alzheimer's Disease, Neuroscience 87(4):731-739 (1998). 10 | Nagy, Z. et al., Cell Cycle Regulation in Alzheimer's Disease, Eur. J. Neuroscience 12(Supplement 11):552 TWH 3 (2000). | Nagy, Z. Cell Cycle Regulatory Failure in Neurones: Causes and Consequences, Neurobiology of Aging 21:761-769 (2000). DOI:10.1016/S0197-4580(00)00223-2 | Nagy, Z. et al., Cell Cycle Kinesis in Lymphocytes in the Diagnosis of Alzheimer's Disease, Neuroscience Lett. 317:81-84 (2002). DOI:10.1016/S0304-3940(01)02442-9 | Nagy, Z. The Last Neuronal Division: A Unifying Hypothesis for the Pathogenesis of Alzheimer's Disease, J. Cell. Mol. Biol. 9(3):531-541 (2005). DOI:10.1111/j.1582-4934.2005.tb00485.x 1 | Nagy, Z. The Dysregulation of the Cell Cycle and the Diagnosis of Alzheimer's Disease, Biochimica Biophs. Acta 1772:402-408 (2007). DOI:10.1016/j.bbadis.2006.11.001 2 | Nakai, M. et al., PKC and Tyrosine Kinase Involvement in Amyloid (25-35)-Induced Chemotaxis of Microglia, Neuroreport Rapid Communications of Oxford 9(15):467-3470, (1998). DOI:10.1097/00001756-199810260-00024 | Nitsch, R.M. Vasopressin and Bradykinin Regulate Secretory Processing of the Amyloid Protein Precursor of Alzheimer's Disease, Neurochemical Research 23(5):807-814, (1998). DOI:10.1023/A:1022423813362 | Pappolla, M.A. Melatonin Prevents Death of Neuroblastoma Cells Exposed to the Alzheimer Amyloid Peptide, J. Neuroscience 17(5):1683-1690, (1997). | Racchi, M. et al., Bradykinin-Induced Amyloid Precursor Protein Secretion in Fibroblasts from Alzheimer's Disease Down's Syndrome and Control Donors, Society of Neuroscience Abstracts, 22(1-3):1944 (1996). | Regenold, W.T., Uses of Intravenous Valproate in Geriatric Psychiatry, Am J. Geriatric Psychiatry, 9(3):306-308, (2001). DOI:10.1176/appi.ajgp.9.3.306 | Sival, R.C. et al., The Effects of Sodium Valproate on Disturbed Behavior in Dementia, J. Amer. Geriatrics Soc. 42(8):906-907 (1994). | Takahashi, M. et al., Shorei Hokoku Valproic Acid Natrium . . . , Brain and Nerve, 48(8):757-760 (1996). | Nagy, Z. (2007) The Dysregulation of the Cell Cycle and the Diagnosis of Alzheimer's Disease, Biochimica et Biophysica Acta 1772:402-408. DOI:10.1016/j.bbadis.2006.11.001 | Ueberham, U. et al. (2005) The Expression of Cell Cycle Proteins in Neurons and its Relevance for Alzheimer's Disease, CNS & Neurological Disorders 4:293-306. | Wang, Z. et al. (2014) Valproic Acid Reduces Neuritic Plaque Formation and Improves Learning Deficits in APPSwe/PSIA246E Transgenic Mice via Preventing the Prenatal Hypoxia-Induced Down-Regulation of Neprilysin, CNS Neuroscience & Therapeutics 20:209-217. DOI:10.1111/cns.12186 | Zhang, X.-Z. et al. (2010) Valproic Acid As a Promising Agent to Combat Alzheimer's Disease, Brain Research Bulletin 81:3-6. DOI:10.1016/j.brainresbull.2009.09.003 | 36 | NaN | 0 | 2019-02-26 FP LAPSED DUE TO FAILURE TO PAY MAINTENANCE FEE - 2018-12-30 | 2019-02-04 STCH INFORMATION ON STATUS: PATENT DISCONTINUATION - PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362 | 2019-02-04 LAPS LAPSE FOR FAILURE TO PAY MAINTENANCE FEES - PATENT EXPIRED FOR FAILURE TO PAY MAINTENANCE FEES (ORIGINAL EVENT CODE: EXP.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | 2018-08-13 FEPP FEE PAYMENT PROCEDURE MAINTENANCE FEE REMINDER MAILED (ORIGINAL EVENT CODE: REM.); ENTITY STATUS OF PATENT OWNER: LARGE ENTITY | 2016-08-02 AS ASSIGNMENT OXFORD UNIVERSITY INNOVATION LIMITED, GREAT BRITAI CHANGE OF NAME;ASSIGNOR:ISIS INNOVATION LIMITED;REEL/FRAME:039550/0045 2016-06-16 | 2016-08-02 AS ASSIGNMENT OXFORD UNIVERSITY INNOVATION LIMITED, GREAT BRITAIN CHANGE OF NAME;ASSIGNOR:ISIS INNOVATION LIMITED;REEL/FRAME:039550/0045 2016-06-16 | 2015-04-21 CC CERTIFICATE OF CORRECTION | 2014-11-21 AS ASSIGNMENT ISIS INNOVATION LIMITED, UNITED KINGDOM ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:NAGY, ZSUZSANNA;REEL/FRAME:034232/0725 2002-09-05 | US8921321B2 | AT481093T | AT524169T | AT535236T | DE60237725D1 | EP1408938A1 | EP1764092A2 | EP1764092A3 | EP1764092B1 | EP1767197A2 | EP1767197A3 | EP1767197B1 | EP1769791A2 | EP1769791A3 | EP1769791B1 | EP2286803A1 | EP2286875A1 | EP2289511A1 | EP2292238A1 | EP2292240A1 | ES2352964T3 | ES2373565T3 | ES2375293T3 | GB200117645D0 | US20030032673A1 | US20130102553A1 | US8343926B2 | WO2003007925A1 | 20010912GB200117645D0 |